ID: 1132567011

View in Genome Browser
Species Human (GRCh38)
Location 16:628171-628193
Sequence ACCGGGGCCCTGGCTCCCAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 237}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132566995_1132567011 29 Left 1132566995 16:628119-628141 CCAGAGGCCGGGGGAGCAGACAG 0: 1
1: 0
2: 4
3: 38
4: 383
Right 1132567011 16:628171-628193 ACCGGGGCCCTGGCTCCCACGGG 0: 1
1: 0
2: 0
3: 22
4: 237
1132566994_1132567011 30 Left 1132566994 16:628118-628140 CCCAGAGGCCGGGGGAGCAGACA 0: 1
1: 0
2: 4
3: 16
4: 261
Right 1132567011 16:628171-628193 ACCGGGGCCCTGGCTCCCACGGG 0: 1
1: 0
2: 0
3: 22
4: 237
1132567001_1132567011 4 Left 1132567001 16:628144-628166 CCGGTGCTCCCTCTGGAAGCTTG 0: 1
1: 0
2: 1
3: 21
4: 302
Right 1132567011 16:628171-628193 ACCGGGGCCCTGGCTCCCACGGG 0: 1
1: 0
2: 0
3: 22
4: 237
1132567004_1132567011 -4 Left 1132567004 16:628152-628174 CCCTCTGGAAGCTTGGGTGACCG 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1132567011 16:628171-628193 ACCGGGGCCCTGGCTCCCACGGG 0: 1
1: 0
2: 0
3: 22
4: 237
1132567005_1132567011 -5 Left 1132567005 16:628153-628175 CCTCTGGAAGCTTGGGTGACCGG 0: 1
1: 0
2: 0
3: 3
4: 101
Right 1132567011 16:628171-628193 ACCGGGGCCCTGGCTCCCACGGG 0: 1
1: 0
2: 0
3: 22
4: 237
1132566999_1132567011 22 Left 1132566999 16:628126-628148 CCGGGGGAGCAGACAGGGCCGGT 0: 1
1: 0
2: 2
3: 20
4: 210
Right 1132567011 16:628171-628193 ACCGGGGCCCTGGCTCCCACGGG 0: 1
1: 0
2: 0
3: 22
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132567011 Original CRISPR ACCGGGGCCCTGGCTCCCAC GGG Exonic