ID: 1132573070

View in Genome Browser
Species Human (GRCh38)
Location 16:652399-652421
Sequence GGAGTTGGTCGGGCATTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132573062_1132573070 1 Left 1132573062 16:652375-652397 CCCAGCTAGGGGTTGGCGGGGCT 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1132573070 16:652399-652421 GGAGTTGGTCGGGCATTCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 92
1132573053_1132573070 28 Left 1132573053 16:652348-652370 CCAGGGCAGTCTTCTTGAGAGGC 0: 1
1: 0
2: 3
3: 12
4: 127
Right 1132573070 16:652399-652421 GGAGTTGGTCGGGCATTCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 92
1132573063_1132573070 0 Left 1132573063 16:652376-652398 CCAGCTAGGGGTTGGCGGGGCTC 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1132573070 16:652399-652421 GGAGTTGGTCGGGCATTCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132573070 Original CRISPR GGAGTTGGTCGGGCATTCTG GGG Intronic
900625753 1:3607852-3607874 AGAGATGGGCGGGCATGCTGCGG + Intronic
900764487 1:4494768-4494790 GGCGTGGGTCGGGCATTCAGAGG - Intergenic
901328548 1:8385634-8385656 GTAGCTGGTCAGGCGTTCTGAGG - Intronic
901937723 1:12638187-12638209 CGAGTGAGTCTGGCATTCTGGGG + Intergenic
902468066 1:16630383-16630405 GGAGTTTGTCTGGCATCCCGGGG - Intergenic
907705495 1:56828908-56828930 GGAATGGGTCTGGCATTCTCAGG + Intergenic
910679051 1:89843809-89843831 GGAGCGGGTCGGGAAGTCTGCGG + Intronic
917311756 1:173685995-173686017 GTAGTTGGTCCAACATTCTGTGG - Intergenic
917540699 1:175910975-175910997 GGAGTTGGGCGTGCATTAAGAGG - Intergenic
918194046 1:182205247-182205269 GGTGCTGGTCTGGTATTCTGGGG - Intergenic
921836609 1:219784910-219784932 GGAGTTAGTGAGGCAATCTGAGG + Intronic
1063306673 10:4909174-4909196 GGAGTAGGTCGGAGATTCTCTGG - Intergenic
1065163159 10:22944661-22944683 TGAGGTCCTCGGGCATTCTGGGG + Intronic
1065931012 10:30479132-30479154 GTAGTTGGTCCAACATTCTGTGG + Intergenic
1066222114 10:33345109-33345131 GGAGTTGTTGGGGCAGTCAGTGG + Intergenic
1069096469 10:64265466-64265488 GGAGTTGGTCTTGCTGTCTGAGG + Intergenic
1072334806 10:94388536-94388558 GTAGTTGGTCCAACATTCTGTGG + Intergenic
1075437667 10:122457648-122457670 GGAGTGGGTCTGGCACTCTGAGG + Intergenic
1075966086 10:126612965-126612987 AGAGTTGGTCTTGAATTCTGGGG + Intronic
1076605819 10:131689284-131689306 GGAGAAGCTCGGGCCTTCTGCGG - Intergenic
1078273265 11:9817227-9817249 GGATTTGCTAGGTCATTCTGAGG - Intronic
1083156573 11:60827088-60827110 GGGGAAGGTCGGGGATTCTGGGG - Intergenic
1088848628 11:113687995-113688017 GGACTTGGTTGGGCATGCTGTGG - Exonic
1092922799 12:13247304-13247326 GGAGTTCTTCAGGCATGCTGGGG + Intergenic
1094056759 12:26275941-26275963 GGAGTTGGTGGGTTATTCTATGG + Intronic
1094168792 12:27469407-27469429 GGGCTTGGTCGATCATTCTGTGG - Intronic
1097119196 12:56718756-56718778 GGAGTTGCTCGGGCCTTTTTGGG + Intronic
1104622285 12:130325748-130325770 GGGTTTGGTAGGGCAATCTGTGG + Intergenic
1109473140 13:62838002-62838024 GGAGTTGGAAGAGCATTCTTTGG + Intergenic
1113561086 13:111282233-111282255 GGAGTGGGGCCGGCATTCTGAGG - Intronic
1123420081 15:20124433-20124455 GGAGTGGGCAGGGCATCCTGAGG + Intergenic
1123445781 15:20329099-20329121 GGAGTGGGCAGGGCATCCTGAGG - Intergenic
1123529303 15:21130969-21130991 GGAGTGGGCAGGGCATCCTGAGG + Intergenic
1124934440 15:34156920-34156942 GTAGTTGGTCCAACATTCTGTGG - Intronic
1132573070 16:652399-652421 GGAGTTGGTCGGGCATTCTGGGG + Intronic
1136720966 16:32319509-32319531 GGAGTGGGCAGGGCATCCTGAGG + Intergenic
1136839349 16:33525795-33525817 GGAGTGGGCAGGGCATCCTGAGG + Intergenic
1140386601 16:74545466-74545488 GGAGTGGGTCAGGCATGGTGTGG - Intronic
1141516314 16:84547675-84547697 GGAGTTGGCTGGGTCTTCTGGGG - Intronic
1141665591 16:85463644-85463666 GGAGGTGATCGGGCAGTTTGGGG - Intergenic
1203005466 16_KI270728v1_random:198261-198283 GGAGTGGGCAGGGCATCCTGAGG - Intergenic
1203137016 16_KI270728v1_random:1734382-1734404 GGAGTGGGCAGGGCATCCTGAGG - Intergenic
1203149514 16_KI270728v1_random:1826080-1826102 GGAGTGGGCAGGGCATCCTGAGG + Intergenic
1143628158 17:8122556-8122578 GCATTTGGTCGCGCGTTCTGTGG - Intronic
1146676363 17:34776212-34776234 GGAGTGGCTCGGGCATTTGGAGG - Intergenic
1147162547 17:38576625-38576647 GCAGTGGGTAGGGCATTCTTGGG - Intronic
1148828960 17:50416768-50416790 GTAGTTGGTCCAACATTCTGTGG - Intergenic
1150358098 17:64505699-64505721 TGGGGTGGCCGGGCATTCTGTGG - Intronic
1152454951 17:80409439-80409461 GTAGTTGGTCCAACATTCTGTGG + Intergenic
1153308588 18:3655226-3655248 GGAGTTTGTCGGCCATGCTTTGG - Intronic
1155528659 18:26743487-26743509 TGAGTTGGGTGGGTATTCTGTGG + Intergenic
1163867086 19:19782545-19782567 GTAGTTGGTCCAACATTCTGTGG - Intergenic
1167711236 19:51112487-51112509 GGAGATGGCAAGGCATTCTGAGG - Intergenic
925777849 2:7352428-7352450 GCAATTGATCGGGGATTCTGGGG + Intergenic
926295623 2:11566574-11566596 GGAGATGGTCCGGCAGGCTGGGG - Exonic
936148283 2:109996382-109996404 GGAGTGGGCAGGGCATCCTGAGG + Intergenic
936196394 2:110374986-110375008 GGAGTGGGCAGGGCATCCTGAGG - Intergenic
937329622 2:121018592-121018614 GGAGGTGGTCAGGCATCTTGGGG - Intergenic
939570071 2:143830599-143830621 GGAGTGAGTCTGGCATTCAGAGG + Intergenic
941931825 2:170948182-170948204 GGAGCTGGACGGGCATTATCTGG + Intronic
946708891 2:222486274-222486296 GGAGATGGTCAGGAATGCTGGGG - Intronic
1174331403 20:49821919-49821941 GGAGGTGGTGGGGTATGCTGTGG + Intronic
1175523669 20:59618973-59618995 GGAGTTGGACGTGGATTCCGTGG + Intronic
1179260881 21:39757364-39757386 GCATTTGGTCAGGCATTCAGAGG + Intronic
1180551807 22:16546801-16546823 GGAGTGGGCAGGGCATCCTGAGG - Intergenic
1181352199 22:22267122-22267144 GGAGTGGGCAGGGCATCCTGAGG + Intergenic
1182823843 22:33244898-33244920 AGACTTGGTGGGGCATTTTGAGG - Intronic
959902537 3:111676319-111676341 GGAGTTTGTCTGGTAGTCTGTGG - Intronic
960582611 3:119294051-119294073 GGAGGTGCGCTGGCATTCTGCGG - Intergenic
966412994 3:179662400-179662422 GGAGTCTTTTGGGCATTCTGGGG + Intronic
968053587 3:195673693-195673715 GAAGTAGGTCGGGCATGCAGTGG - Intergenic
968102226 3:195974669-195974691 GAAGTAGGTCGGGCATGCAGTGG + Intergenic
968663145 4:1807018-1807040 GGTGTGGGGCGGGCCTTCTGGGG + Intronic
969868585 4:10091350-10091372 TGAGTGGATCGGGCCTTCTGGGG - Intronic
971245971 4:24928370-24928392 GGAGAGGGTAGGGCATTGTGAGG + Intronic
975205647 4:71641922-71641944 GTAGTTGGTCCAACATTCTGTGG + Intergenic
977043567 4:92042462-92042484 GTAGTTGGTCCAACATTCTGTGG - Intergenic
987553958 5:19421175-19421197 GGAGTTGGTCTTGCTTTCTCAGG + Intergenic
991306083 5:65177570-65177592 GTAGTTGGTCCAACATTCTGTGG + Intronic
992511131 5:77436224-77436246 GGAGTTGCTTGGACATTCTGTGG + Intronic
997834899 5:137184423-137184445 GGAGCTGATGGGACATTCTGGGG - Intronic
997983785 5:138487880-138487902 GGAGATGGGCGCCCATTCTGGGG + Intergenic
999053516 5:148549254-148549276 GTCCTTGGTCGGGCATTCTCAGG + Intronic
1002999114 6:2314452-2314474 GTAGTTGGTCCAACATTCTGTGG - Intergenic
1003520005 6:6850381-6850403 GGAGGGGGTAGAGCATTCTGGGG + Intergenic
1018191374 6:161311849-161311871 ATAGTTGGTCCAGCATTCTGTGG - Intergenic
1019374010 7:679381-679403 AGGGCTGGTCAGGCATTCTGCGG + Intronic
1020064492 7:5177023-5177045 GGAGGTGGTCAGGAATTCTGTGG + Intergenic
1020745434 7:12073204-12073226 GTAGTTGGTCCAACATTCTGTGG + Intergenic
1023799512 7:43821749-43821771 GTAGTTGGTCCTACATTCTGTGG + Intergenic
1036755392 8:11467693-11467715 GCGGCTGGTCGGGCCTTCTGTGG + Intronic
1038354727 8:26816956-26816978 GGAGTTAGTCAAGGATTCTGGGG + Intronic
1041863798 8:62545044-62545066 GGAGTTGGTCTGGCTGTCTTGGG + Intronic
1044605207 8:94042092-94042114 GGAGTTGGAAGGGCCTTCTATGG + Intergenic
1046420529 8:113977265-113977287 TGAGTGGGTGGGGCATTCAGAGG + Intergenic
1050319370 9:4435441-4435463 GGAATTGGTCTGGCAGGCTGAGG - Intergenic
1058844411 9:108942147-108942169 GGAGTTGTTCCAGGATTCTGTGG + Intronic
1196460073 X:115920480-115920502 GTAGTTGGTCCAACATTCTGTGG + Intergenic
1199418384 X:147613998-147614020 GGAGTTGGTCTTGCCGTCTGAGG - Intergenic