ID: 1132573983

View in Genome Browser
Species Human (GRCh38)
Location 16:656426-656448
Sequence CTCCCACACCGCCCCGGTGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132573977_1132573983 16 Left 1132573977 16:656387-656409 CCTGGACACGCTGTCCCGGGTGT 0: 1
1: 0
2: 1
3: 6
4: 74
Right 1132573983 16:656426-656448 CTCCCACACCGCCCCGGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 90
1132573974_1132573983 25 Left 1132573974 16:656378-656400 CCTGGGCTTCCTGGACACGCTGT 0: 1
1: 0
2: 1
3: 20
4: 214
Right 1132573983 16:656426-656448 CTCCCACACCGCCCCGGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 90
1132573981_1132573983 -8 Left 1132573981 16:656411-656433 CCACATGCTGGCTCGCTCCCACA 0: 1
1: 0
2: 7
3: 52
4: 404
Right 1132573983 16:656426-656448 CTCCCACACCGCCCCGGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 90
1132573980_1132573983 1 Left 1132573980 16:656402-656424 CCGGGTGTACCACATGCTGGCTC 0: 1
1: 0
2: 0
3: 20
4: 169
Right 1132573983 16:656426-656448 CTCCCACACCGCCCCGGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 90
1132573979_1132573983 2 Left 1132573979 16:656401-656423 CCCGGGTGTACCACATGCTGGCT 0: 1
1: 0
2: 0
3: 13
4: 184
Right 1132573983 16:656426-656448 CTCCCACACCGCCCCGGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 90
1132573973_1132573983 28 Left 1132573973 16:656375-656397 CCACCTGGGCTTCCTGGACACGC 0: 1
1: 0
2: 0
3: 21
4: 219
Right 1132573983 16:656426-656448 CTCCCACACCGCCCCGGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132573983 Original CRISPR CTCCCACACCGCCCCGGTGT TGG Exonic
900343780 1:2201212-2201234 CTCCCTCGCTGCCCCTGTGTTGG + Intronic
900409960 1:2508007-2508029 CTCCCCCTCAGCCCAGGTGTGGG - Intergenic
904199127 1:28807899-28807921 TTTCCCCACCACCCCGGTGTAGG - Intergenic
907523598 1:55040545-55040567 TTCCCACCCCGCCCCTGTCTCGG - Intronic
907575450 1:55521892-55521914 CTCCCACACTGTCCCTGGGTGGG + Intergenic
911449450 1:98045564-98045586 CTCCGGCACCGCCCCGGGCTCGG + Intergenic
914490765 1:148148969-148148991 TTCGCCCACCGCCACGGTGTTGG + Intronic
915073781 1:153292992-153293014 CTCCAACCCCGCCCCTGTGGAGG - Intergenic
922704104 1:227779927-227779949 CTCCCACACCCCCACGGTGCTGG + Intronic
924125533 1:240846674-240846696 CTCCCACACTGCACCAGGGTTGG + Intronic
1073286920 10:102395151-102395173 GTCCCACACCGCACCGGTTCTGG - Intronic
1073495904 10:103890657-103890679 CTCCCACACCGTCCCAGGATGGG - Intronic
1075228668 10:120652093-120652115 CTCACACATCACCCCGATGTGGG - Intergenic
1075539341 10:123299381-123299403 CTCCAACCCAGCCCCGGGGTGGG + Intergenic
1076687938 10:132206516-132206538 CTCCCACTCTGCCCCAGTGTGGG + Intergenic
1080683390 11:34496180-34496202 CAGCAACACCTCCCCGGTGTGGG - Intronic
1083653799 11:64219543-64219565 CTCCCCCACCTCCCCGCTCTGGG - Exonic
1089355692 11:117851175-117851197 CTCCCACACTGCACCAGGGTTGG + Intronic
1090198726 11:124839262-124839284 CTCCCCCACCTCCCCGGGCTGGG + Intergenic
1091108549 11:132944176-132944198 CCCCCACCCCGCCCCTCTGTAGG - Intronic
1096226437 12:49869503-49869525 CTCCCACACAGCCTCGGGTTAGG + Exonic
1096651791 12:53065512-53065534 TTCCCTCACCGGCCCTGTGTGGG - Exonic
1104843855 12:131837059-131837081 CTCCTACTCAGCTCCGGTGTGGG + Intronic
1105290909 13:19052882-19052904 CCCCCACACCCCCATGGTGTCGG + Intergenic
1106226296 13:27789689-27789711 CTCCCACCCCGCCCCGCTCTGGG + Intergenic
1107016109 13:35708896-35708918 CTCCCACACTGCCCATGTGAAGG + Intergenic
1107812721 13:44215690-44215712 CTCCCCCAACTCCCCAGTGTGGG - Intergenic
1114986855 14:28239717-28239739 CTCCCACAATTCCCAGGTGTTGG + Intergenic
1115401747 14:32969315-32969337 CACCCACACCGCACCAGGGTTGG - Intronic
1123473445 15:20571084-20571106 CTCCCACACCGACCAGTAGTGGG + Intergenic
1123579041 15:21699798-21699820 ATCCCACACCTCCCCAGTCTTGG + Intergenic
1123615668 15:22142280-22142302 ATCCCACACCTCCCCAGTCTTGG + Intergenic
1123644564 15:22429269-22429291 CTCCCACACCGACCAGTAGTGGG - Intergenic
1126008742 15:44282918-44282940 CTCCCACACCAACCAGGTTTTGG - Intergenic
1127268068 15:57376817-57376839 CTCCCACCCCGCCCCGAAGCGGG - Intronic
1128119222 15:65133494-65133516 CTCCTCCGCCGCCCCAGTGTCGG - Exonic
1202987911 15_KI270727v1_random:434043-434065 ATCCCACACCTCCCCAGTCTTGG + Intergenic
1132573983 16:656426-656448 CTCCCACACCGCCCCGGTGTTGG + Exonic
1139402837 16:66696267-66696289 CTCCCTCCCCGCCCCGCTGCGGG - Intronic
1144830170 17:18126728-18126750 CTCCCACACCTCCCAGGGATTGG - Intronic
1145191346 17:20843565-20843587 TTCGCCCACCGCCGCGGTGTTGG + Intronic
1149961874 17:61118532-61118554 CTCCAACACCACCCCTGTGGAGG + Intronic
1152610892 17:81314566-81314588 CTCCCAGGCCACCCCGGTGCTGG - Intronic
1152803454 17:82342963-82342985 ATCCCACACCGCGCAGGTCTGGG + Intergenic
1152905964 17:82971104-82971126 CTCCCACACAGCCACGCTGGGGG + Intronic
1155231440 18:23778782-23778804 CTCCTGCAGCGCCACGGTGTGGG + Intronic
1160994854 19:1877857-1877879 TTCGCCCACCGCCACGGTGTTGG - Intronic
1161330370 19:3683967-3683989 GTCCCACACCTCCCCCATGTTGG + Intronic
1165236843 19:34428555-34428577 CTCCCACATCGACCTGGTGAGGG + Exonic
1165511312 19:36268221-36268243 CCCCCACCCCGCCACGGGGTAGG - Intergenic
925419713 2:3702564-3702586 CACACACAAAGCCCCGGTGTCGG + Exonic
926079499 2:9972942-9972964 TTCCCACACCGCCCACATGTGGG - Intronic
927207597 2:20619874-20619896 CGCCCACAGTGCCCCGCTGTGGG + Intronic
936920935 2:117687660-117687682 CTCTGACATCACCCCGGTGTGGG - Intergenic
942959857 2:181817299-181817321 CTCCCACACAACCCCTGTATTGG - Intergenic
946015849 2:216603228-216603250 CTCCCCCACCCTCCCAGTGTAGG - Intergenic
946248550 2:218400181-218400203 CTCCCACGGCGCCCCGGCTTCGG - Intronic
948444900 2:238025013-238025035 CTCCCACACCCCCTGGGTTTGGG - Intronic
948631632 2:239306649-239306671 CCCCCACACTGCCCAGGTGATGG + Intronic
949069137 2:242013060-242013082 CTCCCTCACCGCCTCGGGCTGGG + Intergenic
1172274479 20:33672353-33672375 CTCCCACCCTGCCCCACTGTGGG + Intronic
1172846232 20:37931353-37931375 CTCCCACAGCGCCCGGCTGCTGG + Intronic
1174296337 20:49547951-49547973 CTCCCACACCACCGCGTCGTAGG + Exonic
1175965245 20:62657083-62657105 CGCACACACCGCGCCGGGGTTGG - Exonic
1179329612 21:40386459-40386481 CTCCCGCAGCGGCCCGGCGTGGG - Intronic
1181120912 22:20668390-20668412 TTCGCCCACCGCCGCGGTGTTGG - Intergenic
1182439845 22:30356810-30356832 CTGCCAGTCCGCCTCGGTGTCGG + Exonic
950670609 3:14523133-14523155 CTCCCACACAGCCCCTGAGCAGG + Intronic
960944460 3:122956692-122956714 CGCCCAGACCACCCCGGGGTGGG + Intronic
961357467 3:126348102-126348124 CTCCCTCTGCACCCCGGTGTTGG - Intronic
968531712 4:1095452-1095474 CTCCCACAGCTCCACGGTCTCGG + Intronic
985009731 4:185570123-185570145 CTCCCCCACTGCCCAGGTGGGGG - Intergenic
997391981 5:133524673-133524695 CCCCCACCCCGCCCCTGGGTGGG + Intronic
1003942929 6:11045539-11045561 CTCCCACACCGCCCCAGGTGTGG - Intergenic
1018898949 6:168041406-168041428 CAGCCACACCGCCCCTGTATCGG - Intronic
1019280555 7:197763-197785 CTCCCACACCTCTTCAGTGTTGG - Intronic
1019607210 7:1916143-1916165 GCCCCACACCCTCCCGGTGTTGG - Intronic
1026824149 7:73570812-73570834 CTCCCCCAACGCCCAGGTCTTGG - Exonic
1035566497 8:644676-644698 CTCCCTCCCTGCCCCAGTGTTGG + Intronic
1035761313 8:2070918-2070940 CTCCCACACCGTCCTGGCATTGG + Intronic
1036623353 8:10443885-10443907 CACCCACACCGCCTCGTTGACGG - Intergenic
1037294136 8:17383075-17383097 CTTCCACACCCCCCAGGTGGTGG - Intronic
1037529337 8:19757874-19757896 CTCTCACACCGCACCACTGTGGG + Intronic
1038304038 8:26383289-26383311 CTCCCGCGCCGCGCCGGTGGCGG - Intronic
1038741458 8:30220561-30220583 CTCCCACACCACCCTCGTGAGGG - Intergenic
1044281526 8:90362535-90362557 CTCCCACACTCCCCTAGTGTGGG + Intergenic
1048344763 8:133568323-133568345 CTCTCACAGGGCCCCGGTCTGGG + Intronic
1048859503 8:138713709-138713731 CACCCCCACCGCCCCGCCGTAGG + Intronic
1051332785 9:16040291-16040313 CTCCCACACCTCCCCAGTGAAGG + Intronic
1061090150 9:128421565-128421587 CCCCCCCACCGCCCCCGTGCTGG + Intronic
1061487139 9:130925628-130925650 CTCCAACACAGCCCTGGGGTTGG + Intronic
1061754313 9:132802252-132802274 CTCCCACACCACACCGGGGAAGG - Intronic
1186456707 X:9715415-9715437 GTACCACACAGCCTCGGTGTGGG - Intronic
1190879605 X:54483246-54483268 CTCCCACACCCGCGCGGTGGGGG + Intronic
1190879606 X:54483248-54483270 CTCCCCCACCGCGCGGGTGTGGG - Intronic
1200089230 X:153626560-153626582 CAGCCACAGCGCCCCGGTGAAGG - Intergenic