ID: 1132574915

View in Genome Browser
Species Human (GRCh38)
Location 16:659815-659837
Sequence CAGGGCAGGGACGCTGGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 579
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 516}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132574901_1132574915 5 Left 1132574901 16:659787-659809 CCCGGCCAACCCCGTGAGCAGTG 0: 1
1: 0
2: 2
3: 13
4: 114
Right 1132574915 16:659815-659837 CAGGGCAGGGACGCTGGTGCCGG 0: 1
1: 0
2: 4
3: 58
4: 516
1132574911_1132574915 -6 Left 1132574911 16:659798-659820 CCGTGAGCAGTGGAGGGCAGGGC 0: 1
1: 0
2: 4
3: 51
4: 438
Right 1132574915 16:659815-659837 CAGGGCAGGGACGCTGGTGCCGG 0: 1
1: 0
2: 4
3: 58
4: 516
1132574895_1132574915 17 Left 1132574895 16:659775-659797 CCTCCCCGTTCCCCCGGCCAACC 0: 1
1: 0
2: 0
3: 15
4: 333
Right 1132574915 16:659815-659837 CAGGGCAGGGACGCTGGTGCCGG 0: 1
1: 0
2: 4
3: 58
4: 516
1132574898_1132574915 12 Left 1132574898 16:659780-659802 CCGTTCCCCCGGCCAACCCCGTG 0: 1
1: 0
2: 2
3: 30
4: 189
Right 1132574915 16:659815-659837 CAGGGCAGGGACGCTGGTGCCGG 0: 1
1: 0
2: 4
3: 58
4: 516
1132574902_1132574915 4 Left 1132574902 16:659788-659810 CCGGCCAACCCCGTGAGCAGTGG 0: 1
1: 0
2: 0
3: 10
4: 116
Right 1132574915 16:659815-659837 CAGGGCAGGGACGCTGGTGCCGG 0: 1
1: 0
2: 4
3: 58
4: 516
1132574899_1132574915 7 Left 1132574899 16:659785-659807 CCCCCGGCCAACCCCGTGAGCAG 0: 1
1: 0
2: 0
3: 15
4: 104
Right 1132574915 16:659815-659837 CAGGGCAGGGACGCTGGTGCCGG 0: 1
1: 0
2: 4
3: 58
4: 516
1132574907_1132574915 -4 Left 1132574907 16:659796-659818 CCCCGTGAGCAGTGGAGGGCAGG 0: 1
1: 0
2: 3
3: 19
4: 222
Right 1132574915 16:659815-659837 CAGGGCAGGGACGCTGGTGCCGG 0: 1
1: 0
2: 4
3: 58
4: 516
1132574894_1132574915 21 Left 1132574894 16:659771-659793 CCTGCCTCCCCGTTCCCCCGGCC 0: 1
1: 0
2: 8
3: 68
4: 809
Right 1132574915 16:659815-659837 CAGGGCAGGGACGCTGGTGCCGG 0: 1
1: 0
2: 4
3: 58
4: 516
1132574897_1132574915 13 Left 1132574897 16:659779-659801 CCCGTTCCCCCGGCCAACCCCGT 0: 1
1: 0
2: 0
3: 8
4: 172
Right 1132574915 16:659815-659837 CAGGGCAGGGACGCTGGTGCCGG 0: 1
1: 0
2: 4
3: 58
4: 516
1132574900_1132574915 6 Left 1132574900 16:659786-659808 CCCCGGCCAACCCCGTGAGCAGT 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1132574915 16:659815-659837 CAGGGCAGGGACGCTGGTGCCGG 0: 1
1: 0
2: 4
3: 58
4: 516
1132574909_1132574915 -5 Left 1132574909 16:659797-659819 CCCGTGAGCAGTGGAGGGCAGGG 0: 1
1: 1
2: 10
3: 51
4: 477
Right 1132574915 16:659815-659837 CAGGGCAGGGACGCTGGTGCCGG 0: 1
1: 0
2: 4
3: 58
4: 516
1132574893_1132574915 22 Left 1132574893 16:659770-659792 CCCTGCCTCCCCGTTCCCCCGGC 0: 1
1: 0
2: 2
3: 49
4: 510
Right 1132574915 16:659815-659837 CAGGGCAGGGACGCTGGTGCCGG 0: 1
1: 0
2: 4
3: 58
4: 516
1132574905_1132574915 0 Left 1132574905 16:659792-659814 CCAACCCCGTGAGCAGTGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1132574915 16:659815-659837 CAGGGCAGGGACGCTGGTGCCGG 0: 1
1: 0
2: 4
3: 58
4: 516
1132574896_1132574915 14 Left 1132574896 16:659778-659800 CCCCGTTCCCCCGGCCAACCCCG 0: 1
1: 0
2: 1
3: 19
4: 175
Right 1132574915 16:659815-659837 CAGGGCAGGGACGCTGGTGCCGG 0: 1
1: 0
2: 4
3: 58
4: 516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132574915 Original CRISPR CAGGGCAGGGACGCTGGTGC CGG Intronic
900147769 1:1165894-1165916 CAGGGCAGGGGACCTGGTGTGGG + Intergenic
900182603 1:1318923-1318945 CCGGGCAGGGAGGCAGGGGCTGG - Intronic
900223831 1:1523599-1523621 CAGGGAGGGGACCCTGGAGCTGG + Intronic
900482056 1:2904203-2904225 CAGGGCTGGGAGGGTGGTGGAGG + Intergenic
900488770 1:2935963-2935985 CAGGGCAGGCCCACTGGGGCGGG - Intergenic
900589558 1:3453667-3453689 CAGGCCAGGGAGGCAGGTCCTGG + Intergenic
900619033 1:3578522-3578544 CAGGGCAGGGGCCCTGGGGGGGG + Intronic
901122489 1:6906967-6906989 CAGGGCTGGGACGCGGGGGATGG - Intronic
901511420 1:9719855-9719877 GAGGGCAGGGAAGCTGGGTCTGG + Intronic
901652971 1:10753595-10753617 CAGGCCAGGGAGGCGGGTGGGGG + Intronic
901761999 1:11477841-11477863 CAGGGCAGGGACACTGGCTCAGG + Intergenic
902350118 1:15847982-15848004 CAGCGCCGGGAGGCGGGTGCCGG - Exonic
902414642 1:16231578-16231600 CAGGGTAGGGTCTCTGGGGCTGG + Intergenic
902454322 1:16521108-16521130 CAGGGCAGGGATGGTGGTGAGGG + Intergenic
902498132 1:16889209-16889231 CAGGGCAGGGATGGTGGTGAGGG - Intronic
902612161 1:17603630-17603652 CAGGGGAGGGAGGCTGGGACTGG + Intronic
902708590 1:18223273-18223295 CAGGGCAGGGAAGCCAGTGCAGG - Intronic
903239545 1:21973866-21973888 GAGGGCAGGGAAGCTGGCGAGGG - Intergenic
903328679 1:22585990-22586012 CAGGCCAGGGATGGGGGTGCTGG - Intronic
903384395 1:22917031-22917053 CAGAGCAGGGACCCGGGTGGCGG + Intergenic
904213152 1:28898800-28898822 CAGGGCAGGGCATCTAGTGCAGG - Intronic
904584747 1:31574011-31574033 AAGGGCAGGGCCGGGGGTGCTGG - Intergenic
905913975 1:41672403-41672425 CAGGGCAGAGAAGCTGAGGCCGG - Intronic
905995282 1:42376008-42376030 CAGCGCAGGGAGGGTGGGGCAGG + Intergenic
906551005 1:46666442-46666464 CTGGGCAGTGAAGCTGTTGCTGG + Intronic
907429764 1:54405403-54405425 CTGGGCAGCGACGGTGGTGCCGG - Intronic
907659430 1:56378377-56378399 CAGGGCAGGGTGTTTGGTGCTGG - Intergenic
910387925 1:86704964-86704986 CCGTGCAGGTACCCTGGTGCTGG + Exonic
911527491 1:99004593-99004615 CATGGCAGGGACGGTGATGCTGG - Exonic
913208069 1:116559570-116559592 GAGGGCAGGGAAACTGGTGGTGG - Intronic
913460860 1:119084779-119084801 CAGGGCACGTACTCTGGTTCAGG + Intronic
913655111 1:120952770-120952792 CAGGGCAGGGATGGTGGTGAGGG + Intergenic
914006463 1:143736444-143736466 CAGGGCAGGGATGGTGGTGAGGG + Intergenic
914082072 1:144418794-144418816 CAGGGCAGGGATCGTGGTGAGGG - Intergenic
914095371 1:144540143-144540165 CAGGGCAGGGATGGTGGTGAGGG + Intergenic
914099033 1:144568037-144568059 CAGGGCAGGGATCGTGGTGAGGG + Intergenic
914176975 1:145287294-145287316 CAGGGCAGGGATCGTGGTGAGGG - Intergenic
914199977 1:145475905-145475927 CAGGGCAGGGATCGTGGTGAGGG + Intergenic
914201265 1:145487463-145487485 CAGGGCAGTGATGATGGTGAGGG + Intergenic
914299952 1:146369629-146369651 CAGGGCAGGGATCGTGGTGAGGG - Intergenic
914303155 1:146393753-146393775 CAGGGCAGGGATGGTGGTGAGGG - Intergenic
914313412 1:146487093-146487115 CAGGGCAGGGATAGTGGTGAGGG + Intergenic
914479096 1:148049040-148049062 CAGGGCAGGGATCGTGGTGAGGG + Intergenic
914480384 1:148060595-148060617 CAGGGCAGGGATGATGGTGAGGG + Intergenic
914500938 1:148246288-148246310 CAGGGCAGGGATAGTGGTGAGGG - Intergenic
914516570 1:148379420-148379442 CAGGGCAGGGATCGTGGTGAGGG + Intergenic
914636687 1:149558943-149558965 CAGGGCAGGGATCGTGGTGAGGG + Intergenic
914645296 1:149646930-149646952 CAGGGCAGGGATGGTGGTGAGGG + Intergenic
915093321 1:153441605-153441627 CATGGCAGGGACCCCGGTGCTGG + Intergenic
915511979 1:156391473-156391495 GAGAGCAGGGCTGCTGGTGCAGG - Intergenic
915732865 1:158066631-158066653 TAGGTCAGGGAGGCAGGTGCAGG + Intronic
916737094 1:167617681-167617703 GAGGGCAGGGGGTCTGGTGCCGG + Intergenic
917046652 1:170867993-170868015 CAGGGCAGGAACAGTGGTGCTGG + Intergenic
919750746 1:201036476-201036498 CTGGGCAGCGACCCTGCTGCGGG + Intergenic
919939476 1:202276419-202276441 CAGGGCAGGGAGGTTGTTGAGGG - Exonic
921152272 1:212412181-212412203 AAGGGCAGGGAGGCTGGTGAAGG + Intronic
922726503 1:227925362-227925384 CGTGGCAGAGACGCTGGTGGAGG - Exonic
923396586 1:233571763-233571785 CAGAGCAAGGATACTGGTGCAGG - Intergenic
923630306 1:235645255-235645277 CAGGGCAGGGAGGCTGCTGAGGG - Intronic
923662706 1:235972239-235972261 CTGGGCCGTGACGCTGCTGCGGG + Intergenic
924552930 1:245095139-245095161 CCGTGCAGGGCCGCTGCTGCAGG + Intronic
924934861 1:248759073-248759095 CAGGTCAGGGAAGCTGGGGCAGG + Intergenic
1062856264 10:780941-780963 CAGTGCAGGGTCTATGGTGCAGG + Intergenic
1062885254 10:1011178-1011200 CAGGGTGGGGAAGGTGGTGCAGG - Intronic
1063181713 10:3607356-3607378 CAAGGCAGAGATCCTGGTGCAGG + Intergenic
1063187135 10:3661655-3661677 CAGAGAAGAGAGGCTGGTGCGGG + Intergenic
1066443717 10:35462687-35462709 CAGAGCAGAGGGGCTGGTGCTGG + Intronic
1067048851 10:43000696-43000718 CGGGGCTGGGGAGCTGGTGCTGG + Intergenic
1067297558 10:44983569-44983591 CAGGCCAGGGTAGCTAGTGCTGG - Intronic
1067346584 10:45442706-45442728 CAGCCCAGGCCCGCTGGTGCTGG + Intronic
1067693456 10:48519277-48519299 CTGGGCAGGAATGCTGTTGCTGG - Intronic
1067739011 10:48880891-48880913 CAGGGCAGGGTCCCTGGTGAGGG + Intronic
1067879001 10:50027442-50027464 GATGGCAGTGGCGCTGGTGCTGG - Intergenic
1068196786 10:53727286-53727308 AAGGGCAGGGTCCCTGGTGAGGG - Intergenic
1069660108 10:70117780-70117802 CAGGGCAGGGAGGGAGGTGAGGG + Intronic
1069662564 10:70133021-70133043 CAGGACTGGGGCGCGGGTGCTGG - Intergenic
1069787541 10:70998302-70998324 CAGGACAGGGATGCTGTGGCAGG + Intergenic
1069867917 10:71515056-71515078 CAGGGAGGTGACCCTGGTGCTGG + Intronic
1070642545 10:78180116-78180138 CAGGGCAGGGAGGCAGGCGGAGG - Intergenic
1070723219 10:78770984-78771006 CAGGACAGGGACCCTGGGCCAGG - Intergenic
1070924151 10:80207214-80207236 CTGGGCAGGTGTGCTGGTGCCGG + Intergenic
1072298381 10:94035064-94035086 CAGGACAGGCATGCTGGTGAGGG - Intronic
1072658541 10:97347724-97347746 CAGGGCTGAGAGGCTGGTGGCGG - Intergenic
1072864218 10:99041583-99041605 GAGGCTAGGGAAGCTGGTGCTGG - Intronic
1074003116 10:109392239-109392261 CAGGGTAAGGACGCTGGTGCTGG + Intergenic
1074290951 10:112137685-112137707 AAGGGGAGGGATGCTGGGGCTGG - Intergenic
1074825932 10:117215968-117215990 CTGGGCAGGGATGCTGAAGCGGG + Intergenic
1074830129 10:117241849-117241871 CGGGGAAGGGGCGCTGGGGCTGG - Intronic
1076413104 10:130265707-130265729 CTGGGCAGGGCCGCGGGTCCTGG + Intergenic
1076483665 10:130801873-130801895 CTGTGCAGGGACCCTGGTGAAGG - Intergenic
1076731637 10:132442331-132442353 CAGAGCAGGGGCGCTGGGGAAGG + Intergenic
1076776108 10:132699192-132699214 CAGGGCGGGGGCTGTGGTGCAGG + Intronic
1076893905 10:133299508-133299530 CGCGGCAGGGACGTTGATGCTGG + Exonic
1077024923 11:434910-434932 GAGGGGAGGGACTCAGGTGCAGG - Intronic
1077033180 11:479445-479467 GAGGGCAGGGCCAGTGGTGCAGG + Intronic
1077154686 11:1086047-1086069 CAGGGCAGTGAGACTGGTGAGGG - Intergenic
1077266346 11:1652688-1652710 CAGCTCAGGGGCGCTGATGCCGG - Intergenic
1077365505 11:2159961-2159983 CTGGGCGGGGGCCCTGGTGCAGG - Exonic
1081424125 11:42906402-42906424 CAGGACAGGGACCCTGATCCAGG + Intergenic
1081703975 11:45169772-45169794 AAGAGCATGGACTCTGGTGCTGG - Intronic
1083223534 11:61269060-61269082 CAGGGCGGGGAGGCAGGGGCCGG - Intronic
1083492437 11:63022779-63022801 CAGGGGAGGGAACCTGGTGCTGG + Intergenic
1083638634 11:64133620-64133642 CTGGGAAGGGAGGCTGGGGCGGG - Intronic
1083737077 11:64687502-64687524 CAGGGCAGCAAGGCTGGTGGGGG + Intronic
1083755375 11:64789264-64789286 CAAGGCAGGGACCCTGGGCCTGG - Exonic
1083808494 11:65088828-65088850 CAGGGCAGGGACGCAAGGGCTGG - Intronic
1083857706 11:65401324-65401346 CAGGGGAGGGAGGCTGGGGAGGG - Intronic
1083857729 11:65401376-65401398 CAGGGGAGGGAGGCTGGGGAGGG - Intronic
1083935355 11:65867135-65867157 CAGGGAGGTGACGCTGGGGCAGG - Intronic
1083955023 11:65978318-65978340 CTGGGCCTGGACGCTGGGGCTGG - Intronic
1084204566 11:67584188-67584210 CAGGGAAGGGAGGCAGGGGCTGG + Intronic
1084270512 11:68026944-68026966 CAGGGCAGGGAGGCGGGTTGAGG - Intronic
1084482902 11:69432369-69432391 ATGGGCAGGGCCGCTGTTGCTGG - Intergenic
1084888866 11:72226801-72226823 CTGGGGAGGGAGGCAGGTGCTGG + Intronic
1084973276 11:72782690-72782712 GATGGCAGGAGCGCTGGTGCAGG - Intronic
1085021768 11:73214505-73214527 AAGGGAAGGGAGGATGGTGCAGG + Intergenic
1085336594 11:75701369-75701391 CAGGGCTGGGTGGCTGGGGCGGG - Intergenic
1085516552 11:77115325-77115347 CAGACCAGGGACTCAGGTGCTGG - Intronic
1086406074 11:86499977-86499999 CAGGGCAGGGTTCCTGGTTCAGG + Intronic
1086892188 11:92271064-92271086 CAGGGCTTGGAGGCTGCTGCAGG - Intergenic
1087242034 11:95790560-95790582 AAGGGCAAGGGTGCTGGTGCTGG - Exonic
1089689277 11:120176926-120176948 TGGGGCAGGGACACTGGTCCAGG - Intronic
1090383240 11:126341506-126341528 TAGGGCATGGAGCCTGGTGCTGG - Intronic
1091205298 11:133816901-133816923 CAGAGCAGGGACTCTGGGACGGG - Intergenic
1091680469 12:2523143-2523165 GAGGGCGGGGGCGGTGGTGCTGG + Intronic
1092215517 12:6679062-6679084 GAGGGCAGGGACACTGAGGCAGG + Exonic
1092784905 12:12018012-12018034 CAGTGGAGGGACCCTGGTGGGGG + Intergenic
1097190473 12:57217037-57217059 CAGGGCTGGGGCGCTAGCGCGGG + Intronic
1098486677 12:71029482-71029504 CAGGGCTGGCATGCTGGTGCTGG - Intergenic
1100297428 12:93275757-93275779 GAAGGCAGGGGCGCTGGCGCGGG - Intergenic
1102053369 12:109879350-109879372 AAGGGCAGGGGCAGTGGTGCTGG + Intronic
1102068652 12:109999605-109999627 CAGGGCAGGCAGGCGGGCGCGGG + Exonic
1102452637 12:113053272-113053294 GAGGGCAGGGACCATGCTGCTGG + Intergenic
1102968818 12:117149696-117149718 CAGGGCTGGGTCTCTGGAGCAGG - Intronic
1103395527 12:120604035-120604057 CATGGCTGGCAGGCTGGTGCTGG + Intergenic
1103485362 12:121279251-121279273 CCGGGCAGGGACGTCGGCGCTGG + Intronic
1103617277 12:122162323-122162345 CATGGCAGGGATGCTGAGGCTGG + Intergenic
1103843759 12:123887087-123887109 CAGGGAAGGGAGGCTGGTGGTGG + Intronic
1104556684 12:129806742-129806764 CAGGCCAGGCACGGTGGTTCAGG + Intronic
1104656293 12:130576077-130576099 CTCTGCAGGGAGGCTGGTGCGGG + Intronic
1105029062 12:132869925-132869947 AAGGCCAGGCACGGTGGTGCAGG + Intronic
1105572014 13:21611627-21611649 CATGGCAGGGAGGGTGCTGCTGG + Intergenic
1107630169 13:42334677-42334699 CAGAGAAGGGACGCTGGTGGTGG - Intergenic
1107832207 13:44384545-44384567 CAGGGCAGGTGTGCAGGTGCAGG - Intronic
1107931554 13:45311687-45311709 CAGGGCTCGGACGCCGGGGCGGG - Intergenic
1109536762 13:63732131-63732153 CATTGCAGGTACGCTGGTGATGG + Intergenic
1109810676 13:67509221-67509243 CAGCGCAGGGACTCTGGGCCTGG - Intergenic
1113491175 13:110693255-110693277 CAGGACTGGGCCGTTGGTGCTGG - Intronic
1113588531 13:111482311-111482333 CGGGGTGGTGACGCTGGTGCTGG + Intergenic
1116600600 14:46917368-46917390 CAGGCCAGGTACTCTTGTGCAGG - Intronic
1117810239 14:59537603-59537625 CAGGGCATGGATGCTGGGGGAGG - Intronic
1118229704 14:63936642-63936664 CAGGGAAGGGCAGATGGTGCTGG + Intronic
1118964106 14:70563370-70563392 CAGAGCAGGAACTCTGGTGTTGG + Intergenic
1119263460 14:73251461-73251483 GGGGGCAGAGACGCAGGTGCTGG - Intronic
1119304884 14:73599581-73599603 TATGGCAGGGAGGTTGGTGCTGG - Intergenic
1119326833 14:73764836-73764858 CAGGGCAGGGAGGCTGGGGAGGG - Intronic
1121309536 14:92928142-92928164 CAGGGCAGGACCACTGGTGGTGG + Intronic
1121660607 14:95632509-95632531 CAGGGCAGAGAGGCAGCTGCTGG - Intergenic
1122101093 14:99410110-99410132 CAGGGCAGCCACGCTGGAGGAGG + Intronic
1122118124 14:99537665-99537687 CAGGGCGGGGAGGCTGGGCCTGG - Intronic
1122275545 14:100589094-100589116 GAGGGAAGGGACACTGGAGCTGG - Intergenic
1122288237 14:100665545-100665567 CAGGGCAGGGTGGCAGGAGCTGG - Intergenic
1122370025 14:101224554-101224576 CAGGGAAGGGACACTGAGGCAGG + Intergenic
1122540195 14:102493727-102493749 CACAGCAGGGAGGCTGGGGCGGG - Intronic
1122693508 14:103542286-103542308 GAAGGCAGGGAGGCTGGGGCAGG + Intergenic
1122744351 14:103889221-103889243 CATGGCTGGGACGAGGGTGCAGG + Intergenic
1122870173 14:104634857-104634879 CGGGGCAGGGCTGCTGGAGCTGG - Intergenic
1122919686 14:104874884-104874906 CAGGGCAGGGAAGCTGCAGCTGG - Intronic
1122930358 14:104930652-104930674 CAGGCCAGGGATGTTGGGGCAGG - Intronic
1122972195 14:105156913-105156935 CAGGGCAGGGACGGCGGTGGGGG - Intronic
1123035184 14:105469073-105469095 CAGGGCAGCCACGCTGTGGCCGG - Intronic
1123115047 14:105890758-105890780 CAGGGCAGGGCCTTTGGTCCTGG + Intergenic
1123119888 14:105911629-105911651 CCGGGCAGTGACTCTGGTGTGGG + Intergenic
1124190845 15:27574864-27574886 CATGCCAGGGACCCAGGTGCGGG - Intergenic
1124208574 15:27743819-27743841 CGGGGCAGGGGTGCTGGTGAAGG - Intergenic
1124343195 15:28903136-28903158 GAGGCCAGGGACACTGCTGCCGG - Intronic
1124633907 15:31353074-31353096 CAGGGAAGGGACCCTGGGCCAGG + Intronic
1124940436 15:34212632-34212654 CAGGGGAGGGATGGTGGAGCTGG + Intergenic
1125422646 15:39519914-39519936 CTGGGTAGGAACGCTGCTGCTGG - Intergenic
1125828297 15:42693824-42693846 CAGGGCAGGGGCTGAGGTGCTGG - Exonic
1125879966 15:43185351-43185373 CAGGGCAGGGCCTCTGGGACGGG + Exonic
1128510821 15:68313115-68313137 CTAGGCAGAGACGCTGGGGCAGG - Intronic
1128691282 15:69726530-69726552 CAGAGGAGGGACGCTGGCACTGG + Intergenic
1128784062 15:70381804-70381826 CACAGCAGGGAAGCTGATGCTGG - Intergenic
1129038658 15:72665918-72665940 GTGGGCATGGGCGCTGGTGCAGG + Intronic
1129211233 15:74071312-74071334 GTGGGCATGGGCGCTGGTGCAGG - Intronic
1129261131 15:74367917-74367939 CAGGGCATGGACTCCGCTGCAGG - Intergenic
1129600481 15:76995485-76995507 CAGGACTGGGACGCTGCTGCTGG + Exonic
1129671620 15:77610911-77610933 CAGGGCTGGGACGATGGAGGGGG + Intergenic
1129671639 15:77610965-77610987 CAGGGCTGGGACGATGGAGGGGG + Intergenic
1129671659 15:77611019-77611041 CAGGGCTGGGACGATGGAGGGGG + Intergenic
1129710737 15:77819238-77819260 CCGGGCCGGGACGCTGCAGCGGG - Intronic
1130838561 15:87675504-87675526 CATGGCTGGTACGTTGGTGCTGG + Intergenic
1131077720 15:89506252-89506274 CAGGGCAGGGCCTCAGGTGCTGG + Intergenic
1131096060 15:89655045-89655067 CGGGGCAGGGCAGCTGGGGCTGG + Intronic
1131382385 15:91974602-91974624 CAGGGCAGGGAGGCGGGAGGTGG + Intronic
1131598995 15:93828006-93828028 CTGGGCAGGGTGGCAGGTGCCGG + Intergenic
1131986211 15:98044729-98044751 CATGGGTGGGAGGCTGGTGCTGG + Intergenic
1132508155 16:322884-322906 CAGAGCTGGGACGCAGCTGCAGG - Intronic
1132567225 16:629058-629080 CAGGACAGGGAAGCTGGAGCAGG - Exonic
1132574915 16:659815-659837 CAGGGCAGGGACGCTGGTGCCGG + Intronic
1132695631 16:1200607-1200629 CACGGCAGGGGAGCGGGTGCAGG + Intronic
1132991508 16:2798165-2798187 CAGGGCCAGGCCCCTGGTGCTGG + Intergenic
1133996658 16:10753508-10753530 CAGTGCATGGAAGCTGGGGCTGG + Intronic
1134477175 16:14584973-14584995 CGTAGCAGGGATGCTGGTGCTGG - Intronic
1134521541 16:14921191-14921213 AAGGCCAGGCTCGCTGGTGCAGG + Intronic
1134709212 16:16319842-16319864 AAGGCCAGGCTCGCTGGTGCAGG + Intergenic
1134716421 16:16359871-16359893 AAGGCCAGGCTCGCTGGTGCAGG + Intergenic
1134950393 16:18348803-18348825 AAGGCCAGGCTCGCTGGTGCAGG - Intergenic
1134958329 16:18392288-18392310 AAGGCCAGGCTCGCTGGTGCAGG - Intergenic
1135400360 16:22162587-22162609 CCAGGGAGGGACGCAGGTGCTGG + Intergenic
1136621684 16:31433652-31433674 GAGAGCAGAGACCCTGGTGCAGG - Intronic
1137617018 16:49854709-49854731 CAGGGGAGGGGCTCTGCTGCCGG + Intronic
1137634384 16:49973344-49973366 ATGGGCAGGTAGGCTGGTGCTGG - Intergenic
1137708120 16:50548974-50548996 GAGGGCAGGGACGCGGGAGGGGG - Intronic
1138337428 16:56264115-56264137 CAGGCCAGGGCCGATGATGCAGG + Intronic
1138533039 16:57645485-57645507 CAGGGCAGGGAAGAGAGTGCTGG + Intronic
1139549036 16:67663389-67663411 CTGGGCAGGGAGGCTGGAGGGGG - Intronic
1141828395 16:86496464-86496486 CAGGGCAGCCAGGCTGATGCGGG - Intergenic
1141833675 16:86524186-86524208 CAGGGCTGTGACACAGGTGCCGG - Intergenic
1142148301 16:88501790-88501812 CAGGGCCCTGCCGCTGGTGCTGG + Intronic
1142158137 16:88542306-88542328 CAGGCCAGGCAGGCTGGTGGGGG - Intergenic
1142558644 17:796672-796694 CAGGGAAGGGAGGCTGAGGCCGG - Intergenic
1142720029 17:1769869-1769891 CAGCACAGGGGCGCTGGTGGAGG + Exonic
1142959417 17:3543209-3543231 CAGGGCTGGGACCCTGAAGCAGG - Intronic
1143498625 17:7326405-7326427 CCGGGCAGGGGCGGGGGTGCAGG - Intronic
1143558114 17:7675132-7675154 CATGGCGCGGACGCGGGTGCCGG + Exonic
1144161424 17:12564169-12564191 GAGGGAAGAGAGGCTGGTGCTGG + Intergenic
1144362140 17:14505717-14505739 CAGGGCAAGGTCGCTGGACCTGG - Intergenic
1144438600 17:15262194-15262216 CAGGGCAAGGGTGATGGTGCTGG - Intronic
1145787855 17:27605609-27605631 TCGGGCAGGGCCGCTGGGGCCGG + Exonic
1146017557 17:29245963-29245985 CAGGGCAGTGACTTTGGTGTTGG + Intergenic
1146271541 17:31488548-31488570 GAGGGCAGGGGCGCTGCGGCCGG - Intronic
1146357009 17:32142749-32142771 GAGGGCAGGGACTCAGGGGCCGG - Intronic
1147140573 17:38458517-38458539 CAGGGAGGGGTGGCTGGTGCAGG + Intronic
1147191326 17:38739730-38739752 GAGGGCGGGGAGGCTGGTCCTGG - Intronic
1147258205 17:39194648-39194670 CAGGGGAGGGTGCCTGGTGCTGG + Intronic
1147988433 17:44319559-44319581 CTTGGGAGGGACCCTGGTGCTGG - Intergenic
1148152113 17:45403077-45403099 GAGGGCAGGGAGGCTGGGGGTGG - Intronic
1148178027 17:45584703-45584725 CCCGGCCGGGGCGCTGGTGCTGG + Intergenic
1148505302 17:48122360-48122382 CACAGCAGAGACGCTGGTGGCGG - Exonic
1148683341 17:49486973-49486995 CAGGGCAAGGACACAGGTGGAGG - Intergenic
1148701763 17:49591617-49591639 CAGGGAAGGGACCCTGATGGGGG - Intergenic
1149263136 17:54900664-54900686 CGGGGCAGGGACGCGAGGGCGGG - Exonic
1149595354 17:57861880-57861902 CGGGGCCGGGACGCTGGCTCGGG - Exonic
1150209566 17:63434695-63434717 CAGGGCAGGGAGGCAGGGGCTGG - Intronic
1150407915 17:64918989-64919011 CCCGGCCGGGGCGCTGGTGCTGG + Intronic
1150747311 17:67825978-67826000 CCGGCCCGGGGCGCTGGTGCTGG - Exonic
1151448447 17:74182304-74182326 GAGGGGAGGGAAGCTGGTGCTGG - Intergenic
1151815708 17:76470438-76470460 TGGGGCAGGGAAGCTGGTGCAGG + Intergenic
1152163696 17:78686719-78686741 CAGGGGAGGGAAGATGGTTCGGG + Intronic
1152227956 17:79101453-79101475 CAGGGCTGGGACACTGGGGACGG + Intronic
1152303625 17:79509112-79509134 CAGGGCCGGGGCCCTGGGGCTGG - Intronic
1152559015 17:81068646-81068668 CAGGGCAGGGAAGCGGGGACAGG - Intronic
1153489203 18:5630297-5630319 GTGGGCAGGGGCGCGGGTGCGGG - Intronic
1153815457 18:8786434-8786456 CAGAGCAGGGAAGCCCGTGCTGG - Intronic
1155972262 18:32092992-32093014 CGGGGCAGCGACGCTCGGGCAGG - Intronic
1156439338 18:37167833-37167855 AAGGGCAGGGTCCCTGGTGAGGG - Intronic
1157339792 18:46768901-46768923 CAGGACAGTGACCCTAGTGCAGG + Intergenic
1157394829 18:47332766-47332788 AAGGTCATGGACTCTGGTGCTGG + Intergenic
1160521473 18:79510750-79510772 CAGGGCAGGGACGCCTCCGCAGG - Intronic
1160774488 19:848718-848740 CAGGGGAGGGATGTGGGTGCAGG + Intergenic
1161089853 19:2354281-2354303 CAGGGCAGAGACGTCCGTGCGGG + Intronic
1161537020 19:4825814-4825836 CAGGGCATGGTGGCAGGTGCTGG + Intronic
1161576409 19:5056870-5056892 TGGGGCGGGGACGCTGGGGCGGG + Intronic
1161640329 19:5418728-5418750 CAGGGCAAGGACCCTGAGGCTGG + Intergenic
1161653150 19:5497559-5497581 CAGGGCAGGGACAGGCGTGCAGG + Intergenic
1162566841 19:11449187-11449209 CAAGGCAGGGGAGCTGGGGCGGG + Intronic
1162917379 19:13881653-13881675 TAGGGCAGAGCCGCTGGGGCTGG + Intergenic
1163051765 19:14689862-14689884 CAGAGCATGGAGGGTGGTGCTGG - Intronic
1163151646 19:15418606-15418628 CAGGCCAGGGACGGAGGTGGTGG + Intronic
1163383795 19:16986459-16986481 CAGGGTGGGGACGCTGGTGCTGG - Intronic
1163692138 19:18743763-18743785 CAGGGCAGGGATCCTTGGGCTGG + Intronic
1164869540 19:31631675-31631697 CTGGGCAGGGATGATGGTGAAGG - Intergenic
1164934986 19:32203095-32203117 CAGAGAAGGGAGGCTGGTCCCGG + Intergenic
1165106044 19:33470184-33470206 CAGGCCAGAGAGGCTGGGGCTGG - Intronic
1165117565 19:33538124-33538146 CAGGGCAGGGAGACTAGGGCTGG - Intergenic
1165256734 19:34580807-34580829 CTAGGCAGTGAGGCTGGTGCCGG - Intergenic
1165265858 19:34663585-34663607 CTAGGCAGTGAGGCTGGTGCCGG + Intronic
1165821094 19:38676597-38676619 CCGGGCAGGGCCTCTGGGGCCGG + Intronic
1165886837 19:39084530-39084552 AAGGGCAGGGACGCTGGGGATGG + Intronic
1166095971 19:40539377-40539399 AAGGGCATGGATGCTGGCGCTGG + Intronic
1166213913 19:41323743-41323765 GGGGGCAGGGACGCTGGGGCAGG - Exonic
1166412638 19:42566472-42566494 CAGGACAGGGACGGGGGTCCTGG + Intergenic
1166747196 19:45146939-45146961 CCGGGCAGGCAGCCTGGTGCCGG + Exonic
1166803696 19:45472770-45472792 AAGGGCAGGGGCGGTGGTGGCGG - Exonic
1166932361 19:46308797-46308819 GAGGGCGGGGACGCTGGGGCTGG + Intronic
1167143273 19:47666818-47666840 CAAGGCAGGGAAGCTGAGGCAGG - Intronic
1167249513 19:48392748-48392770 CAGGGCAGAAACTCTGGAGCAGG - Intergenic
1167260384 19:48454656-48454678 GAGGACAGGGATGCTGGGGCAGG - Exonic
1167348387 19:48960966-48960988 GGGGGCAGGGACGGTGGGGCAGG - Exonic
1168161179 19:54511358-54511380 GAGGGGAGGGACGCTGTTCCTGG + Intergenic
1168244300 19:55103447-55103469 CAGGGCAGAGGCGCCTGTGCGGG + Exonic
1168722176 19:58560153-58560175 CAGGGCAGGGAAACTGGCCCAGG + Intergenic
925157934 2:1661529-1661551 CAGTGCAGGGATGCAGGTGGAGG + Intronic
925328255 2:3039322-3039344 CAGGGCAGAGACGGTGGACCAGG + Intergenic
925346775 2:3177128-3177150 CAGGGCAAGGACCGTGGTCCAGG - Intergenic
925869839 2:8260466-8260488 CAGGGAAGGGAAGGTGCTGCTGG - Intergenic
927038204 2:19202808-19202830 CAGGACAGGGACACTGGTGCAGG - Intergenic
927052903 2:19348007-19348029 CAGGCCAGTGCTGCTGGTGCCGG - Intergenic
927286166 2:21359138-21359160 CAGTGCAGGGCAGCTGTTGCAGG - Intergenic
927358029 2:22196412-22196434 TAGGGCAGGGGAGCTGGTGCAGG + Intergenic
927510527 2:23641391-23641413 GAGGGGAGGGACCCTGGTGGGGG - Intronic
927843909 2:26461665-26461687 CAGGGCAGGGATGGGGGTTCAGG - Intronic
928249458 2:29662250-29662272 AAGGGCAGGGAGGCTGGCCCCGG - Intronic
929481438 2:42312269-42312291 CCTGGCAGGGACGATGGTGGGGG - Intronic
929811369 2:45191718-45191740 AAGGGTAGGGAGGCTGCTGCAGG + Intergenic
930037336 2:47094928-47094950 CAGGGCTGGGAGGCTGGGACTGG + Intronic
932416514 2:71576669-71576691 CAGGGCAGGAAGGCTGGAGCGGG + Intronic
934570958 2:95373086-95373108 CATGGCTGGTACTCTGGTGCTGG - Intronic
934663374 2:96154686-96154708 TGAGGCAGGGACGCTGGTCCTGG + Intergenic
934735528 2:96687974-96687996 CAGGGCAGGCACGCGGGGGTGGG + Intergenic
934851890 2:97707017-97707039 GAGGGCAGGGACAATGGTGTGGG + Intergenic
935778103 2:106489538-106489560 CAGGGCAGAGACGCAGGAGTTGG - Intergenic
937045292 2:118848033-118848055 AGGGGGAGGGACGCGGGTGCGGG - Intergenic
937255880 2:120555216-120555238 CAGGCCTGGCACACTGGTGCTGG + Intergenic
937283309 2:120735394-120735416 CAGAGAAGGGACGCGGGGGCTGG - Intergenic
937320476 2:120957920-120957942 CAGGGAAGGGCAGATGGTGCTGG - Intronic
937404457 2:121613980-121614002 CATGTCTGGGACTCTGGTGCTGG + Intronic
937532304 2:122844160-122844182 CAGGTCAGGGAAGCTTTTGCTGG + Intergenic
937629512 2:124084548-124084570 CAGGGCAGGCACGGTGGCTCAGG - Intronic
938364998 2:130727473-130727495 CAGGCCAGGGCAGCTGGGGCAGG + Intergenic
938382846 2:130846404-130846426 CGGGGCAGGGAGGCTGGCGTAGG - Intronic
938500357 2:131828978-131829000 CTGGGCTGCTACGCTGGTGCGGG + Intergenic
939199649 2:139018213-139018235 CAGGGAAGGGGTGCTGGTGGGGG + Intergenic
940855328 2:158724743-158724765 CAGGGAAGGGACCCTGGAGGGGG + Intergenic
941803631 2:169688102-169688124 CAGCACAGGGACCCTGGTCCTGG + Intronic
941884675 2:170515751-170515773 CTGGGCAGTGGCGCTGGGGCTGG - Intronic
942243603 2:173986833-173986855 CAAGGCAAGGAAGCTGGTGTTGG + Intergenic
946163556 2:217850108-217850130 CAGGAAAGGGACGCGGGTCCTGG + Intronic
947202467 2:227626889-227626911 CAGGCCATGGACCCTGGTACAGG - Intronic
948352026 2:237348711-237348733 CAGGGCAGAGACGGTGGTTATGG - Intronic
948404350 2:237706129-237706151 CAGGGCAGGTACACTAGTGGTGG + Intronic
948806068 2:240453817-240453839 CAGGGCGGCGACGCTGCCGCCGG + Intronic
948844215 2:240675549-240675571 CCGGGCAGGGGCGCTGGGGCTGG - Intergenic
948846164 2:240683724-240683746 CAGGGCAGGGAATGTGGGGCTGG - Intergenic
948847693 2:240691004-240691026 CAGGGCAGGGAATGTGGGGCTGG + Intergenic
948849645 2:240699330-240699352 CCGGGCAGGGGCGCTGGGGCTGG + Intergenic
948888651 2:240896474-240896496 CCTGGCAGGGAGGCTGGGGCAGG - Intronic
1169171800 20:3471215-3471237 CAGGGCTGGGAGGCCGGGGCTGG + Exonic
1169902024 20:10562651-10562673 AAGGGCAGGGTCCCTGGTGAGGG - Intronic
1171011894 20:21513519-21513541 GAGGGCCGGGCCGCTGGGGCAGG - Exonic
1171816154 20:29787621-29787643 CCGGCCAGAGCCGCTGGTGCAGG + Intergenic
1171972456 20:31572968-31572990 CAGGGCGGGGAGGCAGGGGCAGG - Intronic
1172008595 20:31833659-31833681 CAGGGCAGGGGGGCAGCTGCAGG - Intronic
1172097321 20:32466813-32466835 CAGCCCAGGGAGGCTGGTGCAGG + Intronic
1172277167 20:33686076-33686098 CAGGTCAGGGTCGCAGGGGCCGG + Exonic
1172292227 20:33784388-33784410 CAGGGGAGGGAGGCTGGAGGGGG - Intronic
1172554499 20:35829048-35829070 CAGGGCTGGCAAGTTGGTGCTGG + Intronic
1172635192 20:36405600-36405622 TGGGGCAGGGAGGCTGGAGCGGG + Intronic
1173083282 20:39890226-39890248 CATGGCAGGGATGTTGTTGCAGG + Intergenic
1173734177 20:45348008-45348030 CAGGGAAGGGACGAGGGTGTGGG + Intronic
1173858229 20:46265007-46265029 CAGGGCAGGGAGACAGGTGCAGG - Intronic
1173934298 20:46847759-46847781 CAAGGCAGGGCGGGTGGTGCTGG - Intergenic
1174624674 20:51904181-51904203 CAGGGCAAAGGCTCTGGTGCAGG + Intergenic
1175230599 20:57471166-57471188 CAGGGCAGGCACAATTGTGCTGG + Intergenic
1175539337 20:59738476-59738498 TGGGGCAGGGATGCTGGTACTGG + Intronic
1175594497 20:60220059-60220081 CAGGCCAGGAACGCTGGCTCAGG + Intergenic
1175777563 20:61662861-61662883 CAGGGTAGAGCCGGTGGTGCAGG + Intronic
1175883141 20:62271956-62271978 CAGGGCAGGGCCGATGGGGCAGG + Intronic
1175885305 20:62286882-62286904 CAGGGCCGGGACGCAGCTCCAGG - Intronic
1176254079 20:64141484-64141506 GAGGGCAGGGAAGGTGCTGCAGG + Intergenic
1176254107 20:64141548-64141570 GAGGGCAGGGAAGGTGCTGCAGG + Intergenic
1176316211 21:5246874-5246896 CAGGGCAAGGAGCCTGGTGTGGG - Intergenic
1177844106 21:26268436-26268458 AAGGGCAGGGTCCCTGGTGAGGG - Intergenic
1178824487 21:36004688-36004710 CAGAGCTTGGAAGCTGGTGCCGG + Intergenic
1179133627 21:38660773-38660795 CGGGGCAGGGACGCGTGGGCGGG + Intronic
1179440518 21:41390390-41390412 CAGGGCAGGGCCGCCGGGGCAGG + Intronic
1179820431 21:43934039-43934061 CAGGGCAGGGGCAGTGGAGCAGG + Intronic
1179896497 21:44366348-44366370 AAGGGCAGAGACCCCGGTGCAGG + Intronic
1179957889 21:44751368-44751390 CAGCACAGGGACCCTGGCGCTGG - Intergenic
1180038954 21:45265948-45265970 CAGGCCAGGCACGCCAGTGCAGG + Intronic
1180225374 21:46388894-46388916 CAGGGCTGGGCAGCTGGTCCCGG - Intronic
1180848445 22:18997463-18997485 CAGGGCAGGGATGCCTGAGCAGG - Intergenic
1181116527 22:20635400-20635422 CTGGGCAGGGCAGCAGGTGCAGG - Intergenic
1181898416 22:26131641-26131663 CAGGGCCGGGAAGCTGTTGGAGG + Intergenic
1182481827 22:30614268-30614290 CAGGCCAGGGTCCCAGGTGCTGG + Intronic
1183071634 22:35400349-35400371 CAGGGCAGGGACCCAGGCGTCGG + Intronic
1183097266 22:35560424-35560446 AAGGCCAGGCACGGTGGTGCAGG + Intergenic
1183166114 22:36148575-36148597 CAGAGCAGAGGGGCTGGTGCAGG + Intronic
1183172555 22:36198846-36198868 CAGAGCAGAGGGGCTGGTGCAGG + Intronic
1183664829 22:39241310-39241332 CAGGGCAGGCCTGCTGGTGGAGG - Intronic
1184021928 22:41826745-41826767 CAGGGCAGGGAAGCTGCAGAGGG + Intergenic
1184254064 22:43277048-43277070 CAGGGCAGGGAGGCTGAGGGTGG + Intronic
1184654955 22:45936447-45936469 CTGGGCAGGGCCGATGGGGCTGG - Intronic
1185038066 22:48489921-48489943 CAGGGAAGGGAGGCTCGGGCCGG - Intronic
949927759 3:9055554-9055576 CAGGGGAGGGAGGCTGGGCCTGG + Intronic
950496970 3:13339704-13339726 CACTGCAGGGGCCCTGGTGCAGG - Intronic
952541247 3:34370542-34370564 CAGCACAGGGACCCTGGGGCCGG - Intergenic
952841087 3:37646014-37646036 CAGAGTAAGGACGCTGGGGCTGG - Intronic
952959781 3:38582020-38582042 CAGGTGAGGGACGCTGGGACAGG + Intronic
954412678 3:50377865-50377887 CAGAGCAGGGACTGAGGTGCAGG + Intronic
954437307 3:50503104-50503126 CAGGGCAGAGGCGCTGGGTCCGG - Intronic
958978747 3:100696752-100696774 AAGGGCAGGGTCCCTGGTGAGGG + Intergenic
960812255 3:121636327-121636349 GAGGGAGGGGACGGTGGTGCTGG - Intronic
961525772 3:127496478-127496500 CATGGCAGGGAGGCTGAGGCAGG + Intergenic
961555391 3:127693459-127693481 CCAGTCAGGGACGCTGGTGGCGG - Intronic
962326931 3:134442192-134442214 CTGGCAAGGGAGGCTGGTGCTGG - Intergenic
964786458 3:160400812-160400834 CGGGGCATGGTCGCTGGGGCCGG - Exonic
965491292 3:169339529-169339551 CAGTCCAGGGATGCTGGTCCAGG - Intronic
966272714 3:178127520-178127542 CAGCGCAGGTAAGCGGGTGCAGG - Intergenic
966446605 3:180007842-180007864 CAGTGCAGGGACCCTGGGCCTGG + Intronic
966949886 3:184806783-184806805 CAGGGCTGGGTGGCTGGTGCTGG + Intergenic
967117607 3:186355714-186355736 TAGGACAGTGATGCTGGTGCTGG - Intronic
967271890 3:187739277-187739299 CACGGCAGGGCCCCTGATGCGGG - Intronic
968044058 3:195613659-195613681 CAGGGCAGGAGCGCTGATGAAGG - Intergenic
968222066 3:196947064-196947086 CTGGGCTGGGACGCTGGGACAGG - Exonic
968509292 4:988300-988322 CTGGGCCCTGACGCTGGTGCAGG + Exonic
968579874 4:1384905-1384927 TGGGGCAGGGGCGCTGGTGGGGG + Intronic
968658326 4:1788058-1788080 CTTGGCAGGAAGGCTGGTGCTGG + Intergenic
968669850 4:1843401-1843423 GAGGGCAGTGCGGCTGGTGCAGG + Intronic
968733125 4:2281077-2281099 CAGGGCAGGGAGGCAGGAGAGGG - Intronic
968799735 4:2733977-2733999 CAAGTCAGGGACCCTGGAGCTGG - Intergenic
968867371 4:3222069-3222091 CAGGGCAGGGACGCCCATGCAGG - Intronic
968973995 4:3811639-3811661 CAGTGCAGGGAGGGGGGTGCTGG + Intergenic
968986223 4:3876035-3876057 TAGGGCAGAGAAGCTGGTTCAGG - Intergenic
969037827 4:4269539-4269561 CCGGGCAGGGCTCCTGGTGCAGG - Intronic
969257239 4:6010795-6010817 CAGGGGAAGGACGATGGGGCTGG - Intergenic
969288410 4:6222459-6222481 CAGGTCAGGGCCGCTGCTCCGGG + Intergenic
969444470 4:7236349-7236371 CAGTGCAGGGGCCCTGGGGCAGG + Intronic
969522060 4:7684119-7684141 AGGGGCAGGGATGCTGGTGGTGG - Intronic
969539483 4:7777989-7778011 CAGGGAAGGGAAGAGGGTGCTGG + Intronic
969597978 4:8159519-8159541 CAGGGCCTGGACGCGGGTGCAGG + Intergenic
969837126 4:9850974-9850996 CAGGGGTGGGACACTGGTGGGGG - Intronic
970273210 4:14368842-14368864 AAGGGCAGGGTCCCTGGTGAGGG - Intergenic
970459525 4:16258911-16258933 CAGGGCAAGGACTCTGATCCAGG - Intergenic
972170719 4:36342392-36342414 CAGACCAGGGAAACTGGTGCAGG + Intronic
973733880 4:53850946-53850968 CAGGGCAGGGACCCACATGCAGG - Intronic
974555645 4:63444431-63444453 CAGGGCTGGGACTCTGGATCAGG - Intergenic
975620468 4:76291311-76291333 CTGGGCATGGATGCTGCTGCTGG - Intronic
978954755 4:114599396-114599418 CAGGGCAGGGATGGAGGTGGGGG + Intronic
982129191 4:152212139-152212161 CATGGCAGTGAGGATGGTGCTGG + Intergenic
983285034 4:165728487-165728509 GAGGGCAGGGCTGCTGGTGGTGG - Intergenic
983693162 4:170497293-170497315 GAGGGTAGGGAAGCTGGAGCGGG - Intergenic
984702328 4:182826170-182826192 CAGGGGAGGGAGGCCGGAGCAGG + Intergenic
984947627 4:184982471-184982493 CAGGGCAGGAGCTCTGGAGCAGG - Intergenic
985430639 4:189876478-189876500 CAGGGCAAGGAGCCTGGTGTGGG + Intergenic
985542412 5:493007-493029 CCTGGCAGGGGCGATGGTGCTGG - Intronic
985553839 5:546573-546595 TAGGGCAGGGCAGCTGGTGTTGG - Intergenic
985570852 5:643969-643991 CTGGGCAGGGCAGCTGGTGGCGG - Intronic
985830783 5:2227773-2227795 CAGGACAGAGACGCTGGAGGTGG + Intergenic
986132361 5:4943075-4943097 CTGGGCAGCCACTCTGGTGCTGG - Intergenic
987708687 5:21483999-21484021 CAGGGCAGGGATGCCTGAGCAGG - Intergenic
988499975 5:31776361-31776383 CAGGGCAGGGAGGCAGTTGGAGG - Intronic
988750922 5:34190146-34190168 CAGGGCAGGGATGCCTGAGCAGG + Intergenic
991815518 5:70508186-70508208 CAGGGCAGGGATGCCTGAGCAGG + Intergenic
992904560 5:81333800-81333822 AAGGGCAGGGTCCCTGGTGAGGG + Intronic
996214990 5:120855849-120855871 AAGGGCAGGAACCCTGGTGAGGG + Intergenic
997818433 5:137040079-137040101 CAGAGCAGGGAAGCAAGTGCAGG - Intronic
998020692 5:138767454-138767476 GAGGGCAGGGAGGCTGTTTCAGG - Intronic
998130312 5:139648473-139648495 CAGGGCTGGGACGCGGGGCCCGG - Exonic
999285639 5:150392721-150392743 CAGGACAGAGACCCTGGTGGAGG + Exonic
1000335285 5:160237548-160237570 CATGGCAGGGGTGCTGGTGGCGG - Intronic
1001045556 5:168368833-168368855 CAGGGCATGGAGGGTGGTGGCGG + Intronic
1001216210 5:169858390-169858412 CTGGGCAGGGAGGGTGGTGTAGG + Intronic
1001479934 5:172081735-172081757 CAGGGCAGGAACGCCAGTCCAGG - Intronic
1001516158 5:172356614-172356636 CAGAGCAGGGAGGCTCATGCAGG + Intronic
1002021202 5:176365536-176365558 CGGGCGAGGGACGCAGGTGCGGG - Exonic
1002133186 5:177093568-177093590 GGGGGCAGGGACGCGGGCGCCGG + Intronic
1002448729 5:179307190-179307212 CAGGGCAGGGGCGCGTGGGCCGG - Intronic
1002586702 5:180253131-180253153 CCGGGCAGGGATGCTGAGGCAGG + Intronic
1002821570 6:730224-730246 CAGGTCAGGGAAGGTGGGGCTGG - Intergenic
1004828691 6:19452717-19452739 CAGGGCATTGCTGCTGGTGCTGG - Intergenic
1006256003 6:32832770-32832792 CAGGGCGGGGCAGGTGGTGCGGG - Exonic
1007530355 6:42536464-42536486 CTGGGCAGCCACTCTGGTGCCGG + Intergenic
1008815681 6:55562501-55562523 CAGGGCAGGGCAACTGGTGGTGG - Intronic
1009019812 6:57937885-57937907 CAGGGCAGGGATGCCTGAGCAGG + Intergenic
1012733272 6:102908008-102908030 AAGGGCAGGGTCCCTGGTGAGGG - Intergenic
1014730072 6:125022161-125022183 CAGGCCAGGCATGGTGGTGCAGG - Intronic
1015571921 6:134630704-134630726 AAGGACACAGACGCTGGTGCTGG + Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1016315826 6:142785544-142785566 AAGGGAAGGGAGGTTGGTGCTGG - Intronic
1017192571 6:151669537-151669559 AAGGGCAGGGACTCAGGTGCTGG + Intronic
1017672549 6:156779719-156779741 GAGGGGGGGGACGCGGGTGCGGG - Intronic
1018700056 6:166419322-166419344 GAGGGAAGGGAGGCTGGTACAGG + Intronic
1018700844 6:166424759-166424781 GAGCGCAGGGACGCTGAGGCAGG - Intronic
1018804595 6:167248964-167248986 CAGGGCAGGCAGGGTGGTGCAGG + Intergenic
1019217287 6:170452132-170452154 CAGGGCACAGTGGCTGGTGCGGG - Intergenic
1019279820 7:193908-193930 CCGGGCAGGGAGTGTGGTGCGGG + Intronic
1019621408 7:1994234-1994256 CAGCACAGGGACGATGGTGGCGG + Intronic
1019648652 7:2144476-2144498 CAGGGCTGGGAAGCTCGGGCAGG - Intronic
1020112661 7:5456258-5456280 CAGGGCAGGCTGACTGGTGCAGG - Intronic
1020256713 7:6506492-6506514 CAGGGCAGGGACACTGAGGATGG + Intronic
1020860850 7:13489926-13489948 CTGGGCTGGTACGCTGGTACTGG - Intergenic
1021688804 7:23212664-23212686 GAGGTCAGGGAAGCTGCTGCTGG - Intergenic
1023044986 7:36202986-36203008 CAGGGCAAGGACACAGATGCTGG - Intronic
1023082001 7:36534488-36534510 GAGGGTAGGGACTCTGGGGCTGG + Intronic
1024359544 7:48454497-48454519 CAGAGCAGGGAAGCGGGAGCAGG + Intronic
1024544216 7:50503267-50503289 TAGGGCAGGGACACTGGCTCAGG - Intronic
1024579086 7:50787561-50787583 CTGGGCAGGGACGGTGGGTCAGG + Intronic
1025028521 7:55537167-55537189 CAGGGCAGGGTCAGTGCTGCCGG - Intronic
1026113136 7:67474355-67474377 CATGGCTGGCAAGCTGGTGCTGG + Intergenic
1026944319 7:74306382-74306404 CTTGGCAGGGACACTGCTGCTGG - Intronic
1027112829 7:75454431-75454453 GAGGGCAAGGAGACTGGTGCAGG + Intronic
1027285073 7:76639042-76639064 GAGGGCAAGGAGACTGGTGCAGG + Intergenic
1028121431 7:87059747-87059769 CGGGGCGGGGACGCTGGAGCTGG + Intergenic
1028397423 7:90386546-90386568 CAGGCCAGGCATGGTGGTGCAGG + Exonic
1029254063 7:99257175-99257197 CAGGGCATGGACGCTGGAGTTGG - Intergenic
1029337735 7:99916657-99916679 CAGGGCAGGGATGATGGAGAGGG - Intronic
1029428023 7:100509509-100509531 CACGGCAGGCAAGTTGGTGCTGG + Intergenic
1029597839 7:101547087-101547109 CAGTGCTGGGAGGCTGGTCCGGG - Intronic
1030651056 7:112116483-112116505 TGGGGCAGGGATGCTGGGGCTGG - Intronic
1031986762 7:128168510-128168532 CAGGGAAGAGACCCTGGAGCAGG - Intergenic
1032695131 7:134329240-134329262 CAGGGCAGAGACGCTGGGGCAGG - Intergenic
1032885769 7:136136640-136136662 CAGGGCAAGGCCCCTGGTGCAGG + Intergenic
1033253008 7:139777322-139777344 GAGGGCAGGGACGCCGGGGAAGG - Intronic
1034529789 7:151688547-151688569 CAGGGCAGGGACGTTGCAGACGG - Intronic
1034969444 7:155410114-155410136 CAAGGCAGGGAAGCAGGTGGGGG - Intergenic
1034983771 7:155494969-155494991 CAGTGCTGGGAAGCTGGTGACGG - Intronic
1035185954 7:157125890-157125912 CAGGGCAGAGAGCCTGGTGGGGG + Intergenic
1035270620 7:157717760-157717782 CAGGGATGGGGCGCAGGTGCTGG - Intronic
1035589216 8:800429-800451 CAGGGCTGGGCCCCTGGTGTTGG - Intergenic
1035680435 8:1483660-1483682 CAGAGCAGGGAGGCAGGTGCAGG + Intergenic
1035739209 8:1913607-1913629 CAGGGACGGGACGCTGGTATTGG - Intronic
1036397007 8:8378191-8378213 CAGTGCAGGGGCGCTGGGGCCGG + Intronic
1038337001 8:26653431-26653453 CAGGGCCAGCTCGCTGGTGCTGG + Intronic
1038495802 8:28001331-28001353 CAGGCCAGGCACGGTGGTCCAGG - Intergenic
1039469015 8:37802283-37802305 CAGGACAAGGATGCTGGTGGAGG + Intronic
1044251457 8:90007538-90007560 CAGGGCAGGGCAGGTGGTGGGGG + Intronic
1044732236 8:95238698-95238720 CAGGGCAGGGAGGGAGGTGGGGG - Intergenic
1045737201 8:105310083-105310105 CAGGGCAGGGACCTTGCTGCTGG - Intronic
1047493782 8:125395347-125395369 CTGGGCAGGGATGTTGCTGCTGG + Intergenic
1048123568 8:131608125-131608147 AAGGGCAGGGTCCCTGGTGAGGG - Intergenic
1048529345 8:135233603-135233625 CGGGGCAGGGAGGGTGGTGATGG - Intergenic
1049034996 8:140068422-140068444 CAGGGCAAAGACGCTTGGGCAGG + Intronic
1049388056 8:142354200-142354222 CAGGGCCGCGCAGCTGGTGCAGG - Intronic
1049544160 8:143221761-143221783 CAGGGCAGGGCCGGTGGAGGGGG - Intergenic
1049604129 8:143521216-143521238 CAGGGCAGAGGCGCGGGTGGGGG + Intronic
1049625409 8:143617556-143617578 CGGGGCCGGGAGGCTGGGGCGGG + Exonic
1049686161 8:143940136-143940158 CAGGGCAGGCACCATGGGGCAGG - Intronic
1049744612 8:144257947-144257969 CTGGGTGGGGACGCTGGTGCAGG + Intronic
1049750726 8:144282420-144282442 CAAGGCAGGGAGGCTGGAGATGG + Intronic
1050552254 9:6758393-6758415 CAGGGGAGGGATGCGGGGGCCGG + Intronic
1053413246 9:37929108-37929130 CAGGGCAGGGACTCAGATACAGG - Intronic
1054835663 9:69672597-69672619 CGGGGCAGGGGCGCTGCAGCCGG - Intergenic
1055317309 9:75047102-75047124 CATGGCTGGCAAGCTGGTGCTGG + Intergenic
1056725956 9:89117204-89117226 CAGGTCTGCGACGTTGGTGCTGG - Intronic
1056894031 9:90524079-90524101 CAGGAGAGGCACGCTGGGGCTGG + Intergenic
1057035648 9:91810121-91810143 CAGCCCAGGGTTGCTGGTGCTGG - Intronic
1057131749 9:92658816-92658838 CAGGGCAGGGAGGCCAGGGCTGG + Intronic
1057172975 9:92975011-92975033 CAGTGCATGGCTGCTGGTGCAGG + Intronic
1058058465 9:100472976-100472998 CAGGGCAGGGGCGCGGGGGCCGG - Intronic
1058632199 9:107000755-107000777 CAGTGAAGGGATGATGGTGCTGG + Intronic
1059064299 9:111066420-111066442 CAGGGCAGGGGTGGTGGTGCAGG - Intergenic
1059348223 9:113646680-113646702 CAGGGCAGGGAAACCAGTGCAGG - Intergenic
1059494679 9:114699812-114699834 GAGGGCAGGGTCCCTGGTGAGGG + Intergenic
1059811365 9:117858974-117858996 TAGGGCAGGGATGCTGAAGCAGG + Intergenic
1060044079 9:120326224-120326246 TGGGGCAGGGACGCTGGTTGGGG - Intergenic
1060156137 9:121321073-121321095 CAGGGCTGGGACTCTGGGTCAGG - Intronic
1060292638 9:122318507-122318529 GAAGGCAGGGAGGCTGGTCCAGG + Intronic
1060344316 9:122803267-122803289 TAGGGCAGGGCTGGTGGTGCAGG - Intronic
1060453781 9:123769927-123769949 CCTGGCAGGGCCGCTGTTGCTGG + Intronic
1060526792 9:124325422-124325444 CAGGGCAGCTGCTCTGGTGCTGG - Intronic
1060807591 9:126587464-126587486 CGGGCCAGGGTCGCTGGAGCAGG - Intergenic
1060987763 9:127829584-127829606 CAGGGCTGGGCCGCTGGGGTGGG + Intronic
1061067645 9:128288565-128288587 CAGGGCAGTGACACTGGCTCGGG + Intronic
1061129934 9:128703037-128703059 CAGGGAAGGGGCGCGGGTGAGGG - Intronic
1061322776 9:129841702-129841724 CAGGACAGGGAAGCTGTTGAAGG + Intronic
1061485802 9:130919965-130919987 CAGGGCAGGGAGGCTGGGTGGGG + Intronic
1061538726 9:131265938-131265960 CAGGACAGGGACGCTGCGGGAGG - Intronic
1061646799 9:132009578-132009600 CATGGCAGGCAAGTTGGTGCTGG - Intronic
1061680520 9:132240664-132240686 CAGGGCGGGGAAGGTGGGGCTGG + Intronic
1062161889 9:135085161-135085183 CATGACAGGGAGGGTGGTGCAGG + Intronic
1062430216 9:136523572-136523594 GGGGGCAGGGACCCTGGGGCAGG + Intronic
1062600905 9:137318252-137318274 CTGGGCAGGGACCCTGGGGAGGG - Intronic
1186520950 X:10206420-10206442 CAAGACAGTCACGCTGGTGCTGG + Exonic
1188437509 X:30179355-30179377 GAGGGCAGGGTCCCTGGTGAAGG + Intergenic
1189219180 X:39356389-39356411 CAGGGCAGGGACCCTGCATCAGG + Intergenic
1189383348 X:40517490-40517512 CAAGGCAGGGGCACTGGTGATGG - Intergenic
1190054249 X:47172703-47172725 CAGGGCAGGGGCGGGGGTGCGGG + Intronic
1191856161 X:65628505-65628527 CAGCTCAGGGACCCTGGGGCTGG + Intronic
1191974961 X:66861653-66861675 AAGGGCAGGGTCCCTGGTGAAGG - Intergenic
1192201885 X:69071457-69071479 CCGGGCAAGGAGGCTGGTGGAGG - Intergenic
1192240636 X:69324989-69325011 CAGGGGTGGGAGGCTGGGGCTGG - Intergenic
1196271361 X:113716011-113716033 AAGGGCAGGGTCCCTGGTGAGGG + Intergenic
1199069719 X:143462279-143462301 AAGGGCAGGGTCCCTGGTGAAGG + Intergenic
1200084729 X:153598639-153598661 GAGTGCAGGGCCGCGGGTGCCGG + Intronic
1200176998 X:154123847-154123869 CAGGGTAGGGCAGCTGCTGCAGG + Intergenic
1201571521 Y:15420620-15420642 CGGGGCAGAGACTCTGCTGCTGG - Intergenic