ID: 1132578694

View in Genome Browser
Species Human (GRCh38)
Location 16:675502-675524
Sequence CTGGAGCTGCGCCAGAGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 168}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132578688_1132578694 -2 Left 1132578688 16:675481-675503 CCGTGGAGGTAGTCCAGTGTGCT 0: 1
1: 1
2: 0
3: 10
4: 116
Right 1132578694 16:675502-675524 CTGGAGCTGCGCCAGAGCGGGGG 0: 1
1: 0
2: 0
3: 20
4: 168
1132578687_1132578694 8 Left 1132578687 16:675471-675493 CCAGCGGCTGCCGTGGAGGTAGT 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1132578694 16:675502-675524 CTGGAGCTGCGCCAGAGCGGGGG 0: 1
1: 0
2: 0
3: 20
4: 168
1132578679_1132578694 29 Left 1132578679 16:675450-675472 CCATCCCCGTGACTCCATTTACC 0: 1
1: 0
2: 0
3: 10
4: 162
Right 1132578694 16:675502-675524 CTGGAGCTGCGCCAGAGCGGGGG 0: 1
1: 0
2: 0
3: 20
4: 168
1132578681_1132578694 24 Left 1132578681 16:675455-675477 CCCGTGACTCCATTTACCAGCGG 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1132578694 16:675502-675524 CTGGAGCTGCGCCAGAGCGGGGG 0: 1
1: 0
2: 0
3: 20
4: 168
1132578680_1132578694 25 Left 1132578680 16:675454-675476 CCCCGTGACTCCATTTACCAGCG 0: 1
1: 0
2: 1
3: 5
4: 42
Right 1132578694 16:675502-675524 CTGGAGCTGCGCCAGAGCGGGGG 0: 1
1: 0
2: 0
3: 20
4: 168
1132578678_1132578694 30 Left 1132578678 16:675449-675471 CCCATCCCCGTGACTCCATTTAC 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1132578694 16:675502-675524 CTGGAGCTGCGCCAGAGCGGGGG 0: 1
1: 0
2: 0
3: 20
4: 168
1132578684_1132578694 15 Left 1132578684 16:675464-675486 CCATTTACCAGCGGCTGCCGTGG 0: 1
1: 0
2: 1
3: 6
4: 86
Right 1132578694 16:675502-675524 CTGGAGCTGCGCCAGAGCGGGGG 0: 1
1: 0
2: 0
3: 20
4: 168
1132578683_1132578694 23 Left 1132578683 16:675456-675478 CCGTGACTCCATTTACCAGCGGC 0: 1
1: 0
2: 1
3: 2
4: 73
Right 1132578694 16:675502-675524 CTGGAGCTGCGCCAGAGCGGGGG 0: 1
1: 0
2: 0
3: 20
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132578694 Original CRISPR CTGGAGCTGCGCCAGAGCGG GGG Intronic
900364926 1:2307444-2307466 CAGGAGCTGCCCCGGAGCTGAGG + Exonic
901122646 1:6907846-6907868 CTGGAACTGCGCCAGGTCTGAGG - Intronic
902385552 1:16073568-16073590 CTGGAGCTGAGGCCGAGCTGAGG - Exonic
903460281 1:23516139-23516161 CTGGTGCTGCTCCAGGGCAGAGG - Intronic
903858169 1:26349418-26349440 CTGGACATGCCCCAGAGCTGTGG - Intronic
904541166 1:31234306-31234328 CTGCAGCTGCTCCAGAGTGCAGG + Intronic
906448372 1:45922697-45922719 CTGAAGCTGCAGCAGGGCGGTGG + Intronic
909931337 1:81503039-81503061 CCGCAGCTGCTCCAGTGCGGCGG - Intronic
910670035 1:89763256-89763278 CTGGAGCGGCTCGAGAGCGACGG - Intronic
911117910 1:94265360-94265382 CTGGAGCAGGGCCAGAGCCAAGG - Intronic
912156268 1:106924465-106924487 CTGGAGCTGGGACAGAGTAGTGG - Intergenic
913593904 1:120354953-120354975 ATGGAGCTGTGGCAGGGCGGAGG + Intergenic
914004485 1:143720656-143720678 ATGGAGCTGTGGCAGGGCGGAGG - Intergenic
914093352 1:144524033-144524055 ATGGAGCTGTGGCAGGGCGGAGG - Intergenic
914305177 1:146409869-146409891 ATGGAGCTGTGGCAGGGCGGAGG + Intergenic
914514486 1:148362545-148362567 ATGGAGCTGTGGCAGGGCGGAGG - Intergenic
914596881 1:149162956-149162978 ATGGAGCTGTGGCAGGGCGGAGG - Intergenic
915552556 1:156643807-156643829 CTGGAGCTGAAACAGAGAGGGGG + Intronic
917188523 1:172388678-172388700 CTGGAGGAGCCCCAGAGTGGGGG - Exonic
919770891 1:201157850-201157872 CTTGGGCTGGGCCAGAGTGGTGG + Intronic
920850159 1:209623163-209623185 CTGGAGTTGCCACAGAGCTGTGG + Exonic
923366016 1:233262085-233262107 CTGGAGCTGCAGCGGAGGGGAGG + Exonic
923506559 1:234610054-234610076 CAGGAGCTGTGAGAGAGCGGCGG - Intergenic
1066080907 10:31929201-31929223 CTGGAGCTGCGGCCGGGCGTGGG + Intergenic
1067015752 10:42755355-42755377 CTGGGACAGCGCCTGAGCGGTGG - Intergenic
1067045558 10:42983311-42983333 CTGCAGCTGGGCCAGAGGGAGGG - Intergenic
1068461675 10:57337182-57337204 CTGGAGCGTGGCCAGAGCAGAGG + Intergenic
1069751589 10:70748570-70748592 TTGGAGCTGGGCCAGAGCCCAGG - Intronic
1070195366 10:74151533-74151555 CCGGAGCTGCACCAGACAGGCGG - Intronic
1071370254 10:84944088-84944110 CTGGAGCTGCACTAGAGCTTGGG + Intergenic
1071690992 10:87819137-87819159 CTGCAGCTTGGCCAGCGCGGTGG + Intronic
1075407794 10:122206110-122206132 ATGGAGAGGCGCCAGTGCGGGGG + Intronic
1077011043 11:379494-379516 CTGGAGCTGCAGGAGCGCGGGGG + Exonic
1077066524 11:643443-643465 CTGGAGCTGAGCCCGAGAGGTGG - Intergenic
1077230775 11:1457360-1457382 CTTGAGCCCAGCCAGAGCGGGGG + Intronic
1077352617 11:2099925-2099947 CTGGAGCTGCGGCTGAGAGCGGG - Intergenic
1078631635 11:13009309-13009331 CTTGGGCAGAGCCAGAGCGGCGG + Intergenic
1080792082 11:35530340-35530362 ATGGAGCTGAGCCAGACCTGAGG - Intergenic
1083618133 11:64036277-64036299 CTGGCTTTGCCCCAGAGCGGCGG + Intronic
1083833891 11:65251760-65251782 TTGGAGTTGCTCCACAGCGGCGG + Intergenic
1084112559 11:67023420-67023442 CTGGAGCCCAGCCGGAGCGGCGG + Intronic
1084182536 11:67454103-67454125 CTGGAGCTGCTAAAGAGAGGGGG + Intronic
1084322301 11:68380374-68380396 CTACAGCTGCGGCAGAGCTGAGG + Intronic
1084470724 11:69357552-69357574 CTGGAGCTCCAGCAGAGCAGAGG + Intronic
1084729104 11:71061854-71061876 CTGCAGCTGGGGCAGAGCGGGGG - Intronic
1089644744 11:119871367-119871389 CTGGACCTGGGCCACAGCAGTGG + Intergenic
1090365920 11:126205478-126205500 CTGGAGCTCCACGAGGGCGGAGG + Exonic
1097261991 12:57725540-57725562 CTGGAGCTGCTCCAGTGGGAGGG + Intronic
1102521051 12:113477589-113477611 CTGGAGCTGCAGCAGGGCGTGGG + Intergenic
1102784439 12:115592757-115592779 CTGGTGCTGCGCCTGTGAGGTGG - Intergenic
1102973579 12:117190248-117190270 CGCGAGCTGTGCCAGAGCAGCGG - Exonic
1104527779 12:129540296-129540318 CAGGAGCTGTGCCAGTGCGATGG + Intronic
1110733530 13:78908826-78908848 CTGGAGCTAAGTCAGAGCTGAGG - Intergenic
1113973679 13:114210736-114210758 CTGGAGCTGGGCTTGAGCTGGGG - Intergenic
1114483290 14:23048208-23048230 CAGGAGCTGCGCCACGTCGGCGG + Exonic
1117548585 14:56812166-56812188 CTGGAGCTGCTGCAGAGGGCCGG - Intergenic
1117674455 14:58141484-58141506 CTGGTGCTGCGCCTGCGAGGTGG + Intronic
1118610163 14:67533432-67533454 CTGGGGCTGCGCCGCGGCGGAGG + Intronic
1123036846 14:105475078-105475100 GTGGGGCTGCGCGAAAGCGGGGG + Intronic
1123057318 14:105577517-105577539 CGGGTGCTGGGCCAGAGCCGGGG - Intergenic
1123074593 14:105661639-105661661 CTGGAGCTGCACCAGAGTTGGGG - Intergenic
1125500037 15:40233949-40233971 CTGGAGCAGGGCCACAGGGGAGG + Intergenic
1126300020 15:47184685-47184707 CCGGAGCTGTGCCAGGCCGGGGG + Intronic
1126386619 15:48100059-48100081 CTGGAGCTGCTGCAGAGGGGAGG + Intergenic
1126851824 15:52801748-52801770 CTGGAGCTGCCCCACAGCAGGGG - Intergenic
1128214935 15:65927952-65927974 ATGCAGCTGGGCAAGAGCGGAGG + Intronic
1129294331 15:74591647-74591669 CCGCAGCTGCTCCAGTGCGGCGG - Exonic
1131266192 15:90916702-90916724 GTGTAGCTGCGCCAGAGCCCAGG + Intronic
1132548294 16:543662-543684 CTAGAGATGGGCGAGAGCGGTGG + Intronic
1132578694 16:675502-675524 CTGGAGCTGCGCCAGAGCGGGGG + Intronic
1136460596 16:30407865-30407887 CCGGGGCTGTGCCAGAGCGTGGG + Intronic
1142194387 16:88732807-88732829 GTGGACCTGCCCCAGAGCTGTGG - Intronic
1142207420 16:88790777-88790799 CTGGGGCTGCGAAAGAGCGGGGG - Intergenic
1143614530 17:8042067-8042089 TTGGGGCTGAGCCAGAGAGGTGG - Intronic
1144568901 17:16382568-16382590 CTGGTCCTGCGCCTGAGGGGTGG + Exonic
1145360129 17:22204980-22205002 CTGGTCCTGCGCCTGAGGGGTGG + Exonic
1147000397 17:37358663-37358685 CTGGAGCTGGGCAAGAGGGGTGG + Intronic
1147672406 17:42184234-42184256 CTGGCTCTGCGCCTGCGCGGCGG + Exonic
1151748354 17:76023473-76023495 GTGGAGCTGCGGCAGGGCTGGGG - Intronic
1152718713 17:81911997-81912019 CTGGATGTGCGGCAGAGGGGTGG - Exonic
1152856724 17:82668767-82668789 CTAGAGCTGCCCCAGGGCAGCGG + Intronic
1156505179 18:37586140-37586162 CTGGAGTAGCGCCAGTGCTGGGG - Intergenic
1160861112 19:1237570-1237592 CTGGGGCGGGGCCTGAGCGGGGG + Intronic
1161314462 19:3611396-3611418 CTGGAGCTGCCCCACAGCCGCGG + Exonic
1161482547 19:4518163-4518185 CTGGAGATGCCCCAGAGCCGGGG - Intergenic
1161736169 19:5993389-5993411 CTGGGCCTGCGCCAGAGTGAGGG - Exonic
1161931842 19:7345769-7345791 CTGGAGCTCCTGCAGGGCGGGGG + Intergenic
1163488606 19:17604369-17604391 CTGGAGCTGAGCCAGCAAGGGGG - Exonic
1165349525 19:35268531-35268553 CTTGAGCTGCGCGCGCGCGGCGG - Intergenic
1166181647 19:41113101-41113123 CTGGAGCTGGGCCAGGGCTCTGG - Intergenic
1166528373 19:43527125-43527147 CGGCAGCTGAGCCAGCGCGGCGG - Exonic
1167738665 19:51311661-51311683 CTGGAGCTGCTGCAGACCCGGGG - Intergenic
925385872 2:3461345-3461367 CTGGGGCTGCGCTAAAGCCGGGG - Intronic
927582854 2:24269900-24269922 CCGGAGCTGTGCCCGAGCAGGGG - Intronic
929604395 2:43225530-43225552 CAGCAGCTGCGGCAGCGCGGCGG - Exonic
932757876 2:74421504-74421526 CTGGGGATGCGCCAGAGCCAGGG - Intronic
935192997 2:100793356-100793378 CTGGTGCGGAGCCAGAGCCGGGG - Intergenic
941922213 2:170862640-170862662 CTGAAGCAGTGCCAGATCGGGGG - Intergenic
943980105 2:194539068-194539090 TGGGAGCTGGCCCAGAGCGGTGG - Intergenic
944763369 2:202840275-202840297 CTGCAGCTGCCCCAGAGCTTGGG - Intronic
946705830 2:222457941-222457963 CTGGAGCAGGGTCAGAGCAGGGG + Intronic
947680456 2:232026667-232026689 CTGGAGCAGGGCCAGAGCAGAGG + Intronic
947770755 2:232668397-232668419 CTGGATCTGCCCCAGACCTGAGG + Intronic
948080722 2:235203122-235203144 CTGGGGCTGGGCCAGGGCAGTGG + Intergenic
948694307 2:239725520-239725542 CTGAAGCTGCACCAGGGTGGAGG - Intergenic
1169203674 20:3728612-3728634 CTGGATCTGAGCCTGAGGGGTGG - Intergenic
1169557688 20:6767953-6767975 CCCGGGCTGCGCCAGAGCCGCGG + Exonic
1170802264 20:19600181-19600203 CTGGAGCTGGGGCCGAGGGGAGG - Intronic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1171785326 20:29458633-29458655 CTGCAGCTGTGCCAAAGCTGTGG + Intergenic
1172612910 20:36265065-36265087 CTAGGGCTGGGCCAGAGCGGGGG + Intronic
1175873263 20:62218210-62218232 GTGGACCTGCCCCAGGGCGGGGG + Intronic
1178259854 21:31088679-31088701 TTGGAGCAGGGACAGAGCGGAGG + Intergenic
1179064255 21:38009344-38009366 CTGGAATAGCCCCAGAGCGGAGG + Intronic
1180036702 21:45253958-45253980 CGGGGGCTGCACCAGACCGGGGG - Intergenic
1180843673 22:18970524-18970546 CCGGGGCTGGGCCGGAGCGGCGG + Intergenic
1180961341 22:19763707-19763729 CTGGAGCTGGGCCGGAAAGGTGG + Intronic
1183258184 22:36776513-36776535 CTGGAGCGGCGCCTGCGCAGTGG + Intergenic
1183606126 22:38867589-38867611 CTGGATCTGCCACAGAGCAGGGG - Intronic
1184409946 22:44320673-44320695 CTGGAGCTGGGCCAAAGAGGGGG - Intergenic
1184510047 22:44928127-44928149 CTGGAGCTCTGCCAGGGCAGAGG + Intronic
1184549465 22:45196829-45196851 CCAGAGCGGGGCCAGAGCGGCGG - Exonic
1184627952 22:45752589-45752611 CTGGGGCTGTGCCAGAGAGCTGG + Intronic
1184924490 22:47627337-47627359 CTGGAGCTGTGCCTCAGCTGGGG - Intergenic
1185221192 22:49629999-49630021 CTGGAGCTGGGCCAGGGAGAAGG - Intronic
949718805 3:6964992-6965014 ATGGATCTGGGCCAGAGTGGTGG - Intronic
950453850 3:13080765-13080787 CTGGAACAGCGGCAGGGCGGGGG - Intergenic
952611458 3:35215646-35215668 CTGCAGCTGCCCCAGAGTGCAGG - Intergenic
953793399 3:45965427-45965449 GTGGAGCTGCCTCAGAGAGGAGG + Intronic
954200776 3:49021953-49021975 CTGGAGCTGCGCCGGAGGTCGGG + Exonic
954805637 3:53218350-53218372 GAGGAGCTGGGCCAGAGCTGGGG + Intergenic
956462435 3:69485375-69485397 CTGGAGCTGCACCAGGGTGGGGG + Intronic
966958546 3:184909968-184909990 CTGGAGCTGCACAAGAGAGAGGG - Intronic
967527544 3:190512834-190512856 CTGAAGCTCCGCCAGGGCAGGGG + Intergenic
968478747 4:824949-824971 CTGGAGCGGCGCCTCCGCGGTGG + Intronic
973696698 4:53497435-53497457 CTGGAGCTGCACCAGAGAACAGG - Intronic
973784381 4:54321380-54321402 CTGTGGCTGGGCCAGAGCGAAGG - Intergenic
975220823 4:71810353-71810375 CAGGAGATGCGTCAGAGTGGTGG - Intergenic
977941987 4:102869028-102869050 CGGCAGCTTGGCCAGAGCGGAGG + Exonic
978249289 4:106610708-106610730 CTGGGGCTCAGCCAGAGCAGAGG + Intergenic
981659192 4:147146263-147146285 CTGCAGCTGCGCCTGAGCTCTGG - Intergenic
985462601 4:190121391-190121413 CCGGCGCGGCGCCGGAGCGGGGG - Intergenic
985694110 5:1330365-1330387 CTGAAGCAGCGCCAGAGCACTGG + Exonic
991684189 5:69166918-69166940 CTGCAGCTGCCCGAGAGCGCAGG + Intergenic
992132373 5:73706066-73706088 GTGGAGCTGAGCCAGAGAAGGGG + Intronic
997329478 5:133049066-133049088 CAGAAGCTGCTCCAGAGCGTAGG + Intergenic
1002364555 5:178699960-178699982 CTGAAGCTGCCCCAGAGCCATGG - Intergenic
1002575051 5:180169812-180169834 CTGAGGCTGGGCCAGAGAGGCGG - Intronic
1003507421 6:6751358-6751380 CTGGAGCTGGGCCTGGGAGGAGG + Intergenic
1003824961 6:9942484-9942506 CTGGGGCTGTGCAAGAGCTGGGG - Intronic
1005722463 6:28616508-28616530 CTGGAGCTCCAGCAGAGCCGGGG - Intergenic
1005930612 6:30481404-30481426 CTGCAGCTGAGCGACAGCGGCGG - Intergenic
1007161702 6:39796366-39796388 CTTGAGATGGCCCAGAGCGGGGG + Intronic
1009971343 6:70628169-70628191 CTCGAGCGAGGCCAGAGCGGAGG + Intergenic
1010690988 6:78910793-78910815 CTGGAACTGCGACAGGGCGGAGG - Intronic
1012258393 6:97060441-97060463 GTGGAGCTGGGACTGAGCGGTGG - Intronic
1016982164 6:149863770-149863792 CTGGAGCTGCGCGCGGGCGGCGG - Exonic
1019314776 7:379394-379416 CTGAAGCTGCCCCGGAGGGGAGG + Intergenic
1019411187 7:907468-907490 CTGGAGCTCTGCCAGAGCTGTGG + Intronic
1019422441 7:957341-957363 CTGGAGCTGCCCCACGGAGGAGG - Intronic
1019429634 7:992703-992725 CTGGGGCTCCCTCAGAGCGGGGG + Intergenic
1019757960 7:2787426-2787448 CGGGAGGTGGGCCAGAGCGGTGG - Intronic
1019779120 7:2929395-2929417 CTGGAGCCGCCGCAGAGCTGAGG - Intronic
1023289738 7:38656647-38656669 CTGTGGCTGCCCCAGAGCCGGGG + Intergenic
1026817136 7:73521919-73521941 CAGGAGCGGCGCCATCGCGGCGG + Exonic
1027874367 7:83749811-83749833 CTGGAGCTGAGGCTGAGCGCCGG + Intergenic
1034470335 7:151251502-151251524 CTGGGGCGGCGCCAGTGTGGGGG + Intronic
1034983616 7:155494256-155494278 CTGGATCTCCGTCAGAGCCGAGG + Intronic
1035470865 7:159107742-159107764 CTGGAGCTGCTGCAGGGCAGGGG + Intronic
1037990786 8:23320036-23320058 CTGCAGCTGCGCCTGAACGGCGG - Exonic
1040106718 8:43545925-43545947 CAGGTGCTGCGCCAGACAGGGGG - Intergenic
1040496267 8:47968221-47968243 CTGAATCTGCTCCTGAGCGGAGG + Intronic
1040661864 8:49583338-49583360 CTGGGGCTCAGCCAGAGCAGAGG + Intergenic
1045407462 8:101880482-101880504 CTGGAGCATGGCCAGAGCGGAGG + Intronic
1047258732 8:123237038-123237060 CTGGTGCTGCGCCTGCGAGGTGG + Intronic
1049373614 8:142279069-142279091 CTGGGGCTGGGGGAGAGCGGAGG + Intronic
1049612549 8:143562209-143562231 CTGGAGCAGGGCCAGAGCCTTGG + Exonic
1049643831 8:143727419-143727441 CTGGAGCTGCGCTGGACCAGGGG + Exonic
1050898209 9:10910835-10910857 CTGGAGCGCAGCCAGAGCAGAGG - Intergenic
1052904143 9:33818307-33818329 CTGGAACTGCCCCAGAGGGCAGG + Intronic
1059769799 9:117414671-117414693 CTGGAGCGGCGCCCGCGCCGGGG - Exonic
1061232440 9:129322497-129322519 GTGGAGCTGCCGCTGAGCGGTGG + Intergenic
1062058839 9:134483696-134483718 CTGGACCTGCCACAGCGCGGTGG + Intergenic
1062073559 9:134572257-134572279 CTGGTGCTGCGGCAGAGTGGGGG - Intergenic
1062305970 9:135907350-135907372 CGGGCGCTGAGCCCGAGCGGAGG + Intergenic
1203446105 Un_GL000219v1:57864-57886 CTGCAGCTGTGCCAAAGCTGTGG + Intergenic
1190497474 X:51040513-51040535 CTGGAGCTGGGCCAGGAAGGAGG - Intergenic
1192597156 X:72422943-72422965 CTGTTGCTGAGCCAGAGCAGGGG + Intronic
1199984257 X:152939026-152939048 CTGGAGCTTGGCCAGTGAGGAGG + Intronic