ID: 1132579289

View in Genome Browser
Species Human (GRCh38)
Location 16:677754-677776
Sequence AGAGGGACGCGGCAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 438}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132579289_1132579298 -3 Left 1132579289 16:677754-677776 CCTCCCACCTGCCGCGTCCCTCT 0: 1
1: 0
2: 2
3: 43
4: 438
Right 1132579298 16:677774-677796 TCTGCAGTGAGCTCCGAGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 168
1132579289_1132579302 10 Left 1132579289 16:677754-677776 CCTCCCACCTGCCGCGTCCCTCT 0: 1
1: 0
2: 2
3: 43
4: 438
Right 1132579302 16:677787-677809 CCGAGGTGGGCCGGGCCGTGTGG 0: 1
1: 0
2: 1
3: 28
4: 287
1132579289_1132579294 -7 Left 1132579289 16:677754-677776 CCTCCCACCTGCCGCGTCCCTCT 0: 1
1: 0
2: 2
3: 43
4: 438
Right 1132579294 16:677770-677792 TCCCTCTGCAGTGAGCTCCGAGG 0: 1
1: 0
2: 1
3: 14
4: 177
1132579289_1132579297 -4 Left 1132579289 16:677754-677776 CCTCCCACCTGCCGCGTCCCTCT 0: 1
1: 0
2: 2
3: 43
4: 438
Right 1132579297 16:677773-677795 CTCTGCAGTGAGCTCCGAGGTGG 0: 1
1: 1
2: 2
3: 20
4: 174
1132579289_1132579299 1 Left 1132579289 16:677754-677776 CCTCCCACCTGCCGCGTCCCTCT 0: 1
1: 0
2: 2
3: 43
4: 438
Right 1132579299 16:677778-677800 CAGTGAGCTCCGAGGTGGGCCGG 0: 1
1: 1
2: 0
3: 19
4: 212
1132579289_1132579300 2 Left 1132579289 16:677754-677776 CCTCCCACCTGCCGCGTCCCTCT 0: 1
1: 0
2: 2
3: 43
4: 438
Right 1132579300 16:677779-677801 AGTGAGCTCCGAGGTGGGCCGGG 0: 1
1: 1
2: 3
3: 19
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132579289 Original CRISPR AGAGGGACGCGGCAGGTGGG AGG (reversed) Intronic
900087993 1:907828-907850 AGAAGGACCGGGCAGGAGGGAGG - Intergenic
900316508 1:2059855-2059877 GGAGGGAGGGGCCAGGTGGGAGG + Intronic
900990030 1:6094365-6094387 AAAGGGAAACCGCAGGTGGGGGG - Intronic
901066632 1:6497428-6497450 AGGCGGGCGGGGCAGGTGGGCGG + Intronic
901628396 1:10636218-10636240 CGAGGGAGGAGGCAGGAGGGTGG + Intergenic
901629877 1:10642851-10642873 AGAGCACCGCGGCAGGTGAGCGG - Exonic
901637793 1:10678399-10678421 AGGGAGAGGCAGCAGGTGGGTGG + Intronic
901922703 1:12548157-12548179 AGAGGAAGGCGGCAGGAGGCCGG + Intergenic
902043980 1:13512149-13512171 AGAGTGAGGAGGCAGGTGGCAGG - Intronic
902611888 1:17602566-17602588 AGAGGGAGGCAGCAGGGGTGGGG + Intronic
902690967 1:18109915-18109937 AGAGAGACGCGGCAGGGTGAAGG + Intronic
902714024 1:18260238-18260260 CGAGGGAAGGGGCAGGTGGCTGG + Intronic
902770305 1:18641958-18641980 AGGGGGCCGCGGGAGTTGGGGGG - Intronic
902795459 1:18798109-18798131 AGAGGCGAGGGGCAGGTGGGGGG - Intergenic
903222233 1:21875380-21875402 AGAGGGACGCAGGAGGGGGGAGG - Intronic
903365758 1:22804724-22804746 GGAGAGAAGAGGCAGGTGGGAGG - Intronic
903792837 1:25906321-25906343 AGAGGGACGCGGTCGGCGGGAGG - Intronic
904284186 1:29443505-29443527 AGAAGGAGGTGGGAGGTGGGAGG + Intergenic
905281141 1:36850194-36850216 AGATGGAGGCTGCAGGTAGGTGG - Intronic
906306864 1:44725045-44725067 AGAGGGATGTTGCAGGTGGGGGG - Intronic
907014970 1:51003792-51003814 AGAGGGACAAGGCAGATGGGTGG + Intergenic
907906020 1:58784276-58784298 AGAGGCGTGCGGCAGGGGGGAGG - Exonic
909494326 1:76261518-76261540 AGAGGCACGTGGCAGGTAAGTGG - Intronic
910095704 1:83519394-83519416 AGAGGGACAAGCCAGGTGGCTGG + Intergenic
911036396 1:93553821-93553843 AGGGAGATGGGGCAGGTGGGGGG + Exonic
911285017 1:95979882-95979904 AGAGGGTTGTGGCAGGAGGGGGG - Intergenic
912587260 1:110778365-110778387 AGAGGTAGGCAGGAGGTGGGGGG + Intergenic
913994218 1:143638871-143638893 GGAGGGAGGCGGCGGGGGGGGGG + Intergenic
914934974 1:151970779-151970801 AGATGGGCGGGGCAGGTGGGGGG + Intergenic
915322421 1:155063090-155063112 AGGGGGAGGAGGCAGGTGCGCGG - Intergenic
915586347 1:156845870-156845892 GCAGGGCCCCGGCAGGTGGGGGG - Intronic
918282833 1:183023170-183023192 GGAGGGGCGCGCGAGGTGGGCGG - Intergenic
918445074 1:184609226-184609248 AGAGGGTCTCAGCAGGTGTGAGG + Intronic
918809381 1:189095461-189095483 AAAGGGAAAAGGCAGGTGGGAGG + Intergenic
920038464 1:203080802-203080824 AGAGGGAGGCGGCAGAGGGATGG - Intergenic
921334480 1:214072633-214072655 AGAGGGAGGCAGCAGGGGGGAGG - Intergenic
923420977 1:233814632-233814654 AGAGGGAAGCTGGAGGTGGCTGG + Intergenic
924056882 1:240132779-240132801 AGAGGGTCGCGGTATGAGGGAGG + Intronic
1062836462 10:639232-639254 ATGGGGACGCGTCAGGTCGGGGG + Intronic
1064524498 10:16240001-16240023 AGTGGGAGGAGCCAGGTGGGAGG + Intergenic
1066107996 10:32172318-32172340 GGTGGGACGCGGCAGGTCAGAGG - Intergenic
1067717266 10:48699144-48699166 AGAGGGAAGTGGGAGGTGGAGGG + Intronic
1068768168 10:60788458-60788480 AGAGGGACATGGCAGGAGGAAGG + Intronic
1070773625 10:79097248-79097270 AGATGGAGGTGGCCGGTGGGAGG - Intronic
1070811776 10:79301704-79301726 AGAGTGAGGCGGCTGATGGGTGG + Intronic
1073120907 10:101122137-101122159 AGAGGGCAGCAGCAGGTGGGAGG + Intronic
1073791211 10:106942288-106942310 AAAGGGAAGCCGGAGGTGGGAGG - Intronic
1074528806 10:114282687-114282709 AGAGGGATGGGGCACTTGGGGGG + Intronic
1075054534 10:119207630-119207652 AGAGACACGCGGAGGGTGGGGGG + Exonic
1075054837 10:119209615-119209637 AGAGGGGCGGGGGAGGTGGAGGG - Intronic
1075212411 10:120502379-120502401 AGAGAGACACAGCAGATGGGTGG + Intronic
1075602219 10:123778061-123778083 AGTGGGAAGCTGCAGGTGGTTGG - Intronic
1076637750 10:131893367-131893389 AGAGGGACCTGGCCGGCGGGTGG - Intergenic
1076722675 10:132399513-132399535 AGAGGGGCTTGGCAGGTGGGTGG + Intronic
1076843575 10:133058197-133058219 TGAGGGACCGGGCAGGTGAGGGG + Intergenic
1076843621 10:133058371-133058393 TGAGGGACCAGGCAGGTGAGGGG + Intergenic
1076986176 11:237188-237210 AGACGGAGGGGGCAGGCGGGCGG + Intronic
1077094215 11:792527-792549 GGAGGCACAGGGCAGGTGGGGGG - Intronic
1077248952 11:1552177-1552199 AGAGGGATGCGTGGGGTGGGTGG - Intergenic
1078098684 11:8315950-8315972 AGAGGGACGGGGCAGCGGGTGGG - Intergenic
1081873168 11:46392234-46392256 AGCGGGAGGCTGCGGGTGGGTGG + Intergenic
1081977041 11:47242310-47242332 AGAGGGAAGAGGCTGGTGGCTGG + Intronic
1082001773 11:47397133-47397155 AGAGGGGGGCGACAGGTGGGTGG - Intergenic
1082667510 11:55991859-55991881 AGGGGGAGGGGGGAGGTGGGAGG + Intergenic
1082791345 11:57348431-57348453 AGGAGGAGGAGGCAGGTGGGTGG - Intronic
1082807486 11:57460187-57460209 CGAGGGACGCGGCTGGGGGCGGG + Intergenic
1083366099 11:62142266-62142288 TGAGGGCCTCGGCAGGTGAGAGG + Intronic
1083726323 11:64630394-64630416 AGCGGTACCCGGCAGGTAGGCGG - Exonic
1083827246 11:65210722-65210744 AGAGGGACCAGGCAGGAAGGGGG + Intronic
1083932362 11:65852993-65853015 GGAGGGAGGTGGGAGGTGGGAGG - Intronic
1083951687 11:65960016-65960038 AGTTGGAGGTGGCAGGTGGGTGG + Intergenic
1084448485 11:69218199-69218221 AGAGGGAAGGGGCAGGTCAGAGG + Intergenic
1084582474 11:70032520-70032542 AGAGGGAGGCGGGAGAGGGGGGG + Intergenic
1084787644 11:71452927-71452949 AGAGGGGTGCTGCAGCTGGGCGG + Intergenic
1084965824 11:72743944-72743966 AGAGGGGAGGGGCAGGTGGCAGG - Intronic
1085251281 11:75145446-75145468 ATGGGGACTCTGCAGGTGGGCGG - Intronic
1086616300 11:88824510-88824532 AGTGGGGCGGGGCAGGGGGGTGG + Intronic
1087601981 11:100328558-100328580 AGAAGGAAGAGACAGGTGGGAGG + Intronic
1088613617 11:111602368-111602390 AGGGGGCCGGGGCAGGGGGGCGG - Intergenic
1088939101 11:114435719-114435741 AGAGGGACCAGGGAAGTGGGTGG + Intronic
1089103170 11:115981277-115981299 GGAGGGAGGCGGCAGGAGAGGGG - Intergenic
1089147858 11:116343424-116343446 AAAGGGACCTGGCAGGTGTGGGG - Intergenic
1089687985 11:120169134-120169156 AGAGGAACGCGGAAGGTACGCGG + Exonic
1090213496 11:124939996-124940018 AGAGGAACAGGCCAGGTGGGTGG - Intergenic
1090238237 11:125164964-125164986 AGAGGGAGGCAGCAGGGAGGAGG + Intronic
1090662274 11:128890866-128890888 AGAGGGATGGAGCAGATGGGGGG - Intergenic
1090775555 11:129962017-129962039 AGAGGAAGGCGGCAAGTGGAGGG + Intronic
1091596989 12:1884928-1884950 GGAGGAAGGCGGCAGGTGGAGGG - Intronic
1091710522 12:2737150-2737172 AGAGGGAGGGGGCAGGAGTGAGG - Intergenic
1092291187 12:7160275-7160297 AGAGGTGGGAGGCAGGTGGGAGG - Intergenic
1093412816 12:18886807-18886829 AGTGGGAGGGGGCCGGTGGGAGG + Intergenic
1093464914 12:19439649-19439671 AGAGGGAGGCGGCGGTGGGGAGG + Intronic
1095349039 12:41188326-41188348 GGAGGGAGGTGGCGGGTGGGAGG - Intergenic
1095938376 12:47709495-47709517 ATAGTGAGGCGGCCGGTGGGGGG - Intergenic
1096259332 12:50081232-50081254 ACGGGGACGGGGCAGGTGGGCGG - Intronic
1096311414 12:50524555-50524577 AGAGGGAAGCGGGAGGATGGAGG - Intronic
1096518943 12:52173444-52173466 ACAGGGACGGGGCGGGCGGGGGG - Intronic
1097191513 12:57221630-57221652 GGAGGTGCGCGGCAGCTGGGGGG - Intronic
1098878123 12:75888205-75888227 AGTGGGACTGGGCATGTGGGTGG - Intergenic
1101000967 12:100356943-100356965 AGGGGGACGCGGCTGGCTGGAGG + Intergenic
1102555721 12:113725261-113725283 AGAGGGAGGAGACAGGAGGGAGG + Intergenic
1102874495 12:116439155-116439177 AGAGTGATGCTGCAGGTGGTTGG + Intergenic
1104012092 12:124939116-124939138 AGAAGGACTCGGGTGGTGGGTGG - Intergenic
1104092265 12:125526797-125526819 AGAGGGAGGCGGCTGTGGGGAGG + Intronic
1104134095 12:125921224-125921246 TGAGGGACGGAGCAGGTGGATGG - Intergenic
1104673698 12:130698114-130698136 AGAAGGACAGGGAAGGTGGGAGG + Intronic
1104842398 12:131831350-131831372 GGTGGGGCGGGGCAGGTGGGGGG + Intronic
1104971503 12:132532840-132532862 ACAGGGAGGCTGGAGGTGGGTGG + Intronic
1105874625 13:24541147-24541169 AGAGGGAGGCTGGAGGTGTGGGG + Intergenic
1107654131 13:42574420-42574442 AGCGGGAGGCGGCAGGGGGCTGG - Exonic
1110632113 13:77721104-77721126 AGAGGGAGGCACCTGGTGGGAGG + Intronic
1112365028 13:98749201-98749223 GGAGGGACGCACCAGGTGTGAGG + Intronic
1112626787 13:101113988-101114010 GGAGGGTAGCGGCAGGTGCGTGG + Intronic
1113669430 13:112165706-112165728 AGAGGGGAGGGGCAGGTGAGAGG - Intergenic
1113923308 13:113926857-113926879 AAAGGGACGTGGGAGGTAGGTGG - Intergenic
1113994183 14:16053274-16053296 AGAGAGAGGCGGCAGGCCGGGGG - Intergenic
1117341451 14:54795676-54795698 AGAGGGACGCATCAGGTCAGAGG + Intergenic
1117898581 14:60511002-60511024 GGAGGGACGCAGGAGGTGGTGGG + Intronic
1118212444 14:63778100-63778122 TGAGGGAGGAGGCTGGTGGGCGG + Intergenic
1118308993 14:64678834-64678856 AGAGGGATGAGGTAGGTAGGGGG + Intergenic
1118858442 14:69642650-69642672 GGAGGGACCCAGCAGGGGGGCGG - Intronic
1118994288 14:70822540-70822562 AGAGGGACGGGGCAGGGGAGGGG - Intergenic
1119210396 14:72827257-72827279 AGAGGGCCATGGCAGGAGGGAGG - Intronic
1119424709 14:74528025-74528047 AGAGGCACGGGGCTGGAGGGAGG - Intronic
1120234751 14:81877013-81877035 TGAGGGAGGAGCCAGGTGGGAGG + Intergenic
1120269782 14:82296655-82296677 GGAGGGAGGGGCCAGGTGGGAGG - Intergenic
1121847563 14:97186707-97186729 AGAGGGGAGGGGCAGATGGGAGG - Intergenic
1122030456 14:98908092-98908114 GGAAGGAAGGGGCAGGTGGGGGG - Intergenic
1122604226 14:102937815-102937837 AGAGGAAAGAGGCAGGTTGGCGG + Intronic
1122902937 14:104789245-104789267 AGAGGGCCGAGGCGGGTGGCCGG - Intronic
1123061967 14:105598507-105598529 AGAGGGACCAGGCTGGTGGGCGG - Intergenic
1123086711 14:105720238-105720260 AGAGGGACCAGGCTGGTGGGCGG - Intergenic
1202871633 14_GL000225v1_random:170414-170436 GGAGGGAGGAGGCAGGAGGGTGG + Intergenic
1123472709 15:20566848-20566870 CAGGGGACGCGGCAGGTGGTTGG - Intergenic
1124440317 15:29681258-29681280 GGAGGGGAGCAGCAGGTGGGTGG - Intergenic
1127068279 15:55262792-55262814 AGAAGGCTGAGGCAGGTGGGTGG - Intronic
1128504121 15:68254343-68254365 AGAGTGAAGCTGCAAGTGGGTGG - Intronic
1128608738 15:69057477-69057499 TGAGGGACGCGCCAGGAGAGAGG - Intronic
1128745273 15:70110071-70110093 AGAGGGAGGCTGCAGGCAGGTGG - Intergenic
1129183064 15:73889046-73889068 CTAGGGAGGAGGCAGGTGGGAGG - Intronic
1129412194 15:75356224-75356246 AGAGGAACACGTCTGGTGGGAGG + Exonic
1129872878 15:78952304-78952326 AGAGGCAGGTGGCGGGTGGGTGG - Intergenic
1130661368 15:85833756-85833778 ATGGGGAAGGGGCAGGTGGGCGG + Intergenic
1130959074 15:88647928-88647950 AGAGGGACCTGCCAGGTGGCAGG - Intronic
1130997474 15:88912024-88912046 AGAGGGCCGGTGCAGTTGGGAGG - Intronic
1131562305 15:93455158-93455180 AGAGGGAGGCGGAGGGAGGGAGG + Intergenic
1131720559 15:95163797-95163819 AGAGGGACGTGCAAGGTTGGTGG + Intergenic
1132314871 15:100882047-100882069 CGAGTGGCCCGGCAGGTGGGTGG + Intronic
1132382079 15:101373031-101373053 AGAGTGGCGGGGCAGGTGAGAGG - Intronic
1132579289 16:677754-677776 AGAGGGACGCGGCAGGTGGGAGG - Intronic
1132722790 16:1325189-1325211 AGAGAGGAGCGGCAGGAGGGAGG - Exonic
1132830635 16:1926432-1926454 AGAGGGGCGAGGCAGGGGTGGGG - Intergenic
1132865608 16:2091372-2091394 GGCGGGACGCTGCCGGTGGGAGG + Intronic
1133023577 16:2977715-2977737 AGAGGGGTGCTGGAGGTGGGAGG - Intronic
1134135260 16:11673084-11673106 AGAGGGAGGTGGGAGGTGGGAGG + Intronic
1134207839 16:12252341-12252363 AGAGGTAGCCGCCAGGTGGGAGG - Intronic
1134743163 16:16566472-16566494 GGAGGGAGGGGGGAGGTGGGAGG - Intergenic
1134924397 16:18145988-18146010 GGAGGGAGGGGGGAGGTGGGAGG + Intergenic
1138428314 16:56951231-56951253 AGAGCGAGGAGGCATGTGGGAGG + Intergenic
1139938839 16:70590533-70590555 AGAGGGAGGGGGCAGCCGGGTGG + Intronic
1140237435 16:73172083-73172105 TGAAGGACCCGGCAGGCGGGTGG - Intergenic
1141665304 16:85462704-85462726 GGAGGGAGGCGGGAGGCGGGAGG + Intergenic
1141777669 16:86135024-86135046 GCAGGGAGGAGGCAGGTGGGGGG - Intergenic
1141913143 16:87074773-87074795 AGAGGGACGAGGCAGGAGTGGGG - Intergenic
1142124753 16:88404674-88404696 AGAGGGATGCTGCAGGAAGGAGG + Intergenic
1142227737 16:88885711-88885733 ACAGGGAGGAGGCTGGTGGGAGG - Intronic
1142252660 16:88999740-88999762 AGAGGGAGGAGGGAGGAGGGCGG + Intergenic
1142252678 16:88999779-88999801 AGAGGGAGGAGGGAGGAGGGAGG + Intergenic
1142253517 16:89003097-89003119 GGAGGGACGCAGGAGCTGGGGGG + Intergenic
1142409123 16:89907501-89907523 GGAGGGAGGTGGGAGGTGGGAGG - Intronic
1142409160 16:89907613-89907635 TGAGGGAGGCGGGAGCTGGGAGG - Intronic
1142409178 16:89907669-89907691 GGAGGGAGGTGGGAGGTGGGAGG - Intronic
1142409188 16:89907697-89907719 GGCGGGAGGTGGCAGGTGGGAGG - Intronic
1142409295 16:89907996-89908018 GGAGGGAGGCGGTAGCTGGGAGG - Intronic
1142409475 16:89908584-89908606 GGAGGGAGGCGGGAGCTGGGAGG - Intronic
1142596390 17:1031887-1031909 GGAGGGACGCGGACGGAGGGAGG - Intronic
1143515881 17:7418972-7418994 CGAGGGATGTGGCAGGTGAGGGG + Exonic
1143673732 17:8415119-8415141 AGAGAGAAGAGGCAGGAGGGAGG - Intronic
1144666900 17:17108090-17108112 TGAGGGACAAGGCAGGAGGGAGG - Intronic
1144806689 17:17972450-17972472 ATAGAGACGCGGCAAGGGGGCGG - Intergenic
1144826239 17:18107259-18107281 AGGGAGACGAGGCAGGTGGGCGG - Exonic
1145011775 17:19372402-19372424 AGAGGGAAGTGGCAGGAGGGAGG - Intronic
1145288243 17:21522352-21522374 TGAGGGAGGCGGGAGCTGGGTGG + Intergenic
1145389398 17:22444091-22444113 TGAGGGAGGCGGGAGCTGGGTGG - Intergenic
1145901539 17:28493540-28493562 AGAGGGACGGGGCAGCTCGTGGG - Intronic
1146463949 17:33071197-33071219 AGAAGTATGGGGCAGGTGGGAGG - Intronic
1146653795 17:34623402-34623424 AGAGGGACGGGGGGGGGGGGGGG - Intronic
1147423511 17:40334296-40334318 AGAGGGAGGGGGCAGGAAGGGGG - Intronic
1147458590 17:40554127-40554149 AGGGCGACGCGGCAAGTGAGGGG + Exonic
1147904342 17:43813165-43813187 AGTGGGAGGCGGCAGGTGAGAGG + Intronic
1147949078 17:44097042-44097064 AGAGGGAGGTGGGAGGTAGGAGG + Intronic
1148088544 17:45008958-45008980 TGAGGGAGGCCGGAGGTGGGAGG + Intergenic
1148437281 17:47694271-47694293 AGGAGGAGGCGGCAGGAGGGCGG + Intronic
1148680308 17:49469984-49470006 GGGTGGACGGGGCAGGTGGGAGG + Intronic
1149575444 17:57708465-57708487 GGAGGGGTGGGGCAGGTGGGAGG - Intergenic
1149608561 17:57942171-57942193 AGAAGGGCCCGGCAGCTGGGAGG + Intronic
1150228730 17:63538364-63538386 AGCGGGACGCGGCCGGGGTGGGG - Intronic
1152256658 17:79243906-79243928 AGAGGTAGGGGGCAGGTGGGAGG + Intronic
1152753891 17:82078960-82078982 CGTGGGAGGCGGCGGGTGGGTGG + Exonic
1152821600 17:82440320-82440342 ACGGGGACGCGGCCGGTGAGAGG + Intronic
1152913088 17:83016642-83016664 GGAGGGAGGAGGCAGGTGGAGGG + Intronic
1153534355 18:6084871-6084893 AGAGGGCCACTGCAGGTGGAGGG + Intronic
1154041421 18:10859829-10859851 AGAGGGAGGCAGCAGCGGGGAGG + Intronic
1154076768 18:11211009-11211031 AAAGGGAAGGGACAGGTGGGAGG + Intergenic
1155332117 18:24729005-24729027 AGAGTGAGGCTGCAGTTGGGAGG - Intergenic
1158681237 18:59568925-59568947 AGGTGGAGGTGGCAGGTGGGAGG - Intronic
1159131161 18:64281592-64281614 AGAGGTTTGCTGCAGGTGGGAGG + Intergenic
1160429898 18:78804109-78804131 AGGGGGACGCAGCTTGTGGGTGG + Intergenic
1160430031 18:78804659-78804681 AGAGGGAGGCTGCAGGGGGCTGG + Intergenic
1160557665 18:79736491-79736513 AGAGGAGCGCGGCAGGGGGCCGG + Exonic
1160603811 18:80034184-80034206 CGAGGGGGGCGGTAGGTGGGCGG - Intergenic
1161108322 19:2455444-2455466 TGAGGGACGAGGCATATGGGGGG + Intronic
1161242173 19:3228599-3228621 TGGGGGACGGTGCAGGTGGGGGG + Intronic
1162017517 19:7853471-7853493 TGAAGGACGGCGCAGGTGGGCGG - Intronic
1162026300 19:7895774-7895796 AGAGGGGCGGGGCAGGTGTCTGG + Intronic
1162059560 19:8086334-8086356 GGAGGGGTGAGGCAGGTGGGCGG + Intronic
1162081459 19:8220287-8220309 AGAGGGAGGCTGAAGGTGGAGGG - Intronic
1162802495 19:13118854-13118876 AGAGCGGCGCGGCCGGAGGGGGG + Intronic
1163315121 19:16536154-16536176 AGAAGGACAAGGCAGGTGTGGGG - Intronic
1163455575 19:17404082-17404104 AGAGGAATGTGGCAGGTGGAGGG + Intronic
1163524767 19:17814036-17814058 AGAGGGAGGCTGCTGGTGGCTGG - Intergenic
1163545978 19:17941803-17941825 AGGGGGACACTGCAGGTGTGGGG + Intronic
1165135604 19:33666500-33666522 AGAAGGAACCGGAAGGTGGGAGG + Intronic
1165949503 19:39466195-39466217 AGTGGGAGGCGGCAGGTTTGGGG + Intronic
1166737303 19:45093561-45093583 AGAGGGACCCGGGAGTCGGGAGG + Intronic
1167307354 19:48716748-48716770 GGAGGGAGGAGGGAGGTGGGAGG + Intronic
1168323944 19:55528676-55528698 AGAGGGTGGTGCCAGGTGGGAGG + Intergenic
925422813 2:3725891-3725913 AGAGTGACGAGGCTGCTGGGTGG + Intronic
925587002 2:5474724-5474746 GGTGGGGCGAGGCAGGTGGGTGG - Intergenic
925587024 2:5474789-5474811 GGTGGGGCGAGGCAGGTGGGTGG - Intergenic
926337382 2:11874990-11875012 AGAGGGGAGCGGACGGTGGGGGG - Intergenic
927486389 2:23491250-23491272 AGAGGCCCTCTGCAGGTGGGTGG + Intronic
927847187 2:26477620-26477642 AGGGAGGGGCGGCAGGTGGGGGG - Intronic
927868196 2:26606488-26606510 TGAGGGGCGCGGGAGGAGGGGGG - Intronic
930750354 2:54928520-54928542 GGAGGCATGTGGCAGGTGGGGGG - Intronic
931487143 2:62705420-62705442 AGAGGGAAGCGATAGGCGGGAGG - Intronic
931653374 2:64488660-64488682 AGGCTGACCCGGCAGGTGGGAGG + Intergenic
933354397 2:81195481-81195503 AGAGGGATGCGGCAGGGGGTAGG + Intergenic
933698498 2:85237772-85237794 GGAGGGAGGGGGCTGGTGGGGGG + Intronic
934763465 2:96868583-96868605 AGAGGGAGGCAGGAAGTGGGTGG + Intronic
935148611 2:100413787-100413809 AGTGGGGCCTGGCAGGTGGGAGG - Intronic
935157628 2:100497268-100497290 AGAGGGAGGCGGTGGGAGGGTGG - Intergenic
938250612 2:129812969-129812991 AGAGGGCACTGGCAGGTGGGGGG - Intergenic
938297201 2:130185676-130185698 GGCGGGAGGAGGCAGGTGGGGGG + Intronic
939739467 2:145887477-145887499 AGAGGGGTCAGGCAGGTGGGAGG - Intergenic
940159549 2:150696828-150696850 AGAGAGAGGGGGCAGGAGGGAGG + Intergenic
940326315 2:152429022-152429044 GGAGGGAGGAGGCAGGTGGGAGG + Intronic
941916534 2:170817233-170817255 AGAGTGACGAGGGAGGCGGGGGG - Intronic
943226161 2:185180867-185180889 AGAGGGACCTCACAGGTGGGAGG - Intergenic
945556834 2:211287319-211287341 TGAGGGAGGGGGAAGGTGGGAGG + Intergenic
946112458 2:217431898-217431920 GGAGTGAGGAGGCAGGTGGGTGG - Intronic
946751038 2:222896199-222896221 GGAGGGAGGCGGCGGGGGGGGGG - Intronic
947166646 2:227268690-227268712 TGAGGGAAGGGGCAGGGGGGAGG + Intronic
948479572 2:238241074-238241096 AGAGGAACCCAGCAGATGGGCGG - Intergenic
948577695 2:238965135-238965157 AGAGGGAAGAGGGAGGAGGGAGG - Intergenic
948577705 2:238965177-238965199 GGAGGGAGGAGGCAGGAGGGAGG - Intergenic
948577710 2:238965191-238965213 GGAGGGAGGAGGCAGGAGGGAGG - Intergenic
948577738 2:238965285-238965307 AGAGGGAAGAGGGAGGAGGGAGG - Intergenic
948577749 2:238965331-238965353 GGAGGGAGGAGGCAGGAGGGAGG - Intergenic
1169465406 20:5833802-5833824 AGAGAGAGGGGGCAGGTGAGGGG + Intronic
1169673555 20:8131290-8131312 AGACACACGCGGGAGGTGGGGGG - Intergenic
1169851231 20:10053719-10053741 TGGTGGAGGCGGCAGGTGGGAGG - Intronic
1170092851 20:12610723-12610745 AGAGGGACACTGCAGGAGGTAGG + Intergenic
1171482196 20:25462375-25462397 AGTGGGCAGCAGCAGGTGGGTGG - Exonic
1171810938 20:29743784-29743806 AGAGAGAGGCGGCAGGCGGGGGG + Intergenic
1172767614 20:37359115-37359137 AGATGGACCAGGCAGGTGGCAGG + Intronic
1172841059 20:37903055-37903077 GGAGGGAGGCGGGAGGAGGGAGG + Intergenic
1173443221 20:43096046-43096068 GGAGAGAGGAGGCAGGTGGGAGG - Intronic
1174339292 20:49886090-49886112 AGGGGGACGGGGCAGGTGCAGGG - Intronic
1175050789 20:56153327-56153349 AGAGGGAGGCACCTGGTGGGAGG - Intergenic
1175073984 20:56358734-56358756 AAAGGGGCGGGGCTGGTGGGCGG + Intergenic
1175570175 20:60012248-60012270 AGAGGGTGGGAGCAGGTGGGAGG + Intronic
1175781918 20:61688306-61688328 GGAGGGAGGAGGAAGGTGGGAGG - Intronic
1175862775 20:62159110-62159132 TGAGGGAGGCGGAAAGTGGGAGG + Intronic
1175909362 20:62397304-62397326 GGAGGCAGACGGCAGGTGGGTGG - Intronic
1175978468 20:62725386-62725408 AGTGGGAAGCGGGAGGCGGGAGG + Intronic
1176057088 20:63154683-63154705 AGAGGGAGGAAGCAGGAGGGAGG - Intergenic
1176057152 20:63154859-63154881 AGAGGGAGTCGGGAGGAGGGAGG - Intergenic
1176069687 20:63219642-63219664 AGAGGGACGAGGTGGGTGGACGG - Intergenic
1178999924 21:37447730-37447752 TGATGGACATGGCAGGTGGGTGG + Intronic
1179529583 21:42009749-42009771 GGCGGGTCGCGGCAGGTGCGGGG + Intronic
1179911071 21:44449160-44449182 AGAGAGACGCGCCTGCTGGGTGG - Intergenic
1180065673 21:45411052-45411074 AGGTGGACGCTGCAGCTGGGCGG + Intronic
1180190951 21:46162168-46162190 GGGGGGTGGCGGCAGGTGGGAGG - Intronic
1180201841 21:46229080-46229102 TGAGGGGCGGGGCTGGTGGGTGG + Intergenic
1180286456 22:10749020-10749042 GGAGGGAGGAGGCAGGAGGGTGG - Intergenic
1180313086 22:11254241-11254263 AGAGAGAGGCGGCAGGCCGGGGG + Intergenic
1180722213 22:17917823-17917845 AGAGTGACGGGGCAGGGGCGGGG - Intronic
1180968845 22:19804332-19804354 AGAGGGACACAGCAGGTCAGGGG + Intronic
1181094411 22:20495796-20495818 GGAGGGAGGCGGGAGGCGGGAGG + Exonic
1181147289 22:20858330-20858352 GCAGGGCCGCTGCAGGTGGGTGG - Intronic
1181815882 22:25436515-25436537 AGAGGGAGGCTGCCGGGGGGAGG + Intergenic
1182742003 22:32574608-32574630 AGAGGGAGGGGGCAAGTGGTAGG - Intronic
1184254969 22:43281463-43281485 AGAGGGAGGTGACAGGAGGGTGG - Intronic
1185400404 22:50612789-50612811 AGAGGGAGGAGGTGGGTGGGTGG - Intronic
950934307 3:16823068-16823090 AGAGGGAGGTGGCAGAAGGGTGG + Intronic
951078751 3:18425964-18425986 AGAGGGACAGGCGAGGTGGGGGG + Intronic
953370752 3:42386400-42386422 AGAGGGAGGCGGGGGGGGGGGGG - Intergenic
953464280 3:43105621-43105643 AGGGAGGCGCGGGAGGTGGGCGG - Intronic
953481226 3:43254165-43254187 AGAGGGAAGCTGCCAGTGGGAGG - Intergenic
953886589 3:46717673-46717695 CGAGGGCCGCGTCAGGCGGGTGG + Intronic
954409538 3:50364476-50364498 AGCGGGACGCCGCAGGTGTTTGG - Intronic
955332403 3:58058264-58058286 AGAGTGAAGCGGCAGTTGGCTGG + Intronic
955659165 3:61278082-61278104 AGAGGAAGGAAGCAGGTGGGTGG + Intergenic
955712780 3:61797593-61797615 AAAGGAAGGCGGGAGGTGGGGGG - Intronic
955725485 3:61927931-61927953 AGAGGGATGGGGCAGGAAGGTGG + Intronic
958064736 3:88528830-88528852 AGAGGGAGGCCATAGGTGGGTGG + Intergenic
958436128 3:94098093-94098115 AGGGGGAAGAGGCAGGTTGGTGG - Intronic
960140052 3:114142916-114142938 AGAGTGACACTGGAGGTGGGTGG + Intronic
960823392 3:121757908-121757930 AGACGGAAGGGGCAGGTGGCGGG + Intergenic
960836683 3:121913944-121913966 AGAGAGTGGCGGGAGGTGGGGGG - Intronic
961343906 3:126248607-126248629 AGAGTGAAGGGACAGGTGGGAGG - Intergenic
961363147 3:126380579-126380601 AGAAGCACCCGGCAGGTGAGAGG + Intergenic
961659651 3:128461979-128462001 AGAAGGCCGGGGCAGGTGGGTGG + Intergenic
961807943 3:129502684-129502706 AGAGGGAAGGGGCAGGTAGGAGG - Intronic
962073678 3:132057987-132058009 AGAGGGAAGAGACAGGAGGGAGG + Intronic
962134986 3:132722860-132722882 AGTGGGGCGGGGCATGTGGGCGG + Intergenic
963051266 3:141146080-141146102 AGAGGGTGGGGGCAGGTAGGGGG - Intronic
966301055 3:178480143-178480165 AGAGGGACCTGGAAGATGGGTGG + Intronic
966784229 3:183608959-183608981 GGAGGGAGGCGGCGGGGGGGGGG + Intergenic
968862117 4:3180806-3180828 GGAGGGAGGCGGGGGGTGGGGGG + Intronic
968928172 4:3560873-3560895 GGAGGGACGAGGCGGGTGGGTGG - Intergenic
968976675 4:3825716-3825738 GGTGGTACTCGGCAGGTGGGTGG - Intergenic
969584365 4:8083537-8083559 AGGGGGCCGAGGCAGGTGTGAGG - Intronic
969694972 4:8729288-8729310 AGAGGGGAGCCTCAGGTGGGGGG + Intergenic
969870840 4:10103783-10103805 AGTGGGAGGAGGGAGGTGGGGGG - Intronic
970512874 4:16798599-16798621 TGAGGGAAGAGGGAGGTGGGGGG - Intronic
970710843 4:18860145-18860167 AAAGGGGGGGGGCAGGTGGGGGG + Intergenic
971730335 4:30370672-30370694 AGAGGGAGCAGGCAGGTGAGCGG - Intergenic
972794023 4:42398451-42398473 AGGGGGACGCGGCCGGGTGGGGG + Intronic
973246642 4:48016905-48016927 CGAGGGACCTGGCAGCTGGGTGG + Intronic
974354701 4:60797258-60797280 AGAGGGACATGGCAGATGGTTGG - Intergenic
975711896 4:77169239-77169261 TGAGGGAGGAGGGAGGTGGGAGG - Exonic
976709367 4:88052787-88052809 AGAGGGAAGGAGCAGGTGGAGGG + Intronic
977575541 4:98670460-98670482 AGAGTAAAGCGGCAGGTAGGAGG - Intergenic
977716638 4:100190523-100190545 GGAGGGGCGGTGCAGGTGGGCGG - Intronic
978070325 4:104459647-104459669 ACAAGGACGCAGCAGGAGGGAGG - Intergenic
979876570 4:125898879-125898901 AGAGGGAGGCGGGGGGAGGGAGG - Intergenic
980309091 4:131102466-131102488 AGGGGGCCACGGCAGGAGGGAGG + Intergenic
981528786 4:145733149-145733171 AGGGGCAGGCGGCGGGTGGGCGG - Intronic
981646380 4:147003619-147003641 AGAGGGAACCTGAAGGTGGGAGG - Intergenic
981724677 4:147834736-147834758 TGAGGGTGGGGGCAGGTGGGTGG - Intronic
981779305 4:148408044-148408066 AGCCGGAGGAGGCAGGTGGGAGG - Intronic
982437140 4:155392804-155392826 AGAGGAAGGCGGCAGGCAGGTGG + Intergenic
982712167 4:158768851-158768873 GGCGGGAGGCGGGAGGTGGGAGG - Intergenic
983833677 4:172363335-172363357 AGCCTGACGTGGCAGGTGGGAGG - Intronic
984774123 4:183465999-183466021 AGAGGGACCCGGCGGAGGGGGGG + Intergenic
984916860 4:184733239-184733261 AGCAGGACACCGCAGGTGGGTGG - Intronic
985095755 4:186411488-186411510 AGAGGGACGTTGGCGGTGGGAGG + Intergenic
985572153 5:652801-652823 GGAAGGAGGAGGCAGGTGGGCGG + Intronic
985705635 5:1400029-1400051 AGAGGGAAGAGGCAGGTCCGAGG + Intronic
985962945 5:3316747-3316769 AGAGGGATGGGGCTGCTGGGGGG - Intergenic
986303247 5:6495184-6495206 ATAGGGACTCTGCAGGTGAGAGG - Intergenic
986856642 5:11876201-11876223 GGAGGGAGGAGGCAGGAGGGAGG + Intronic
986861444 5:11931591-11931613 GGTGGGAGGCGGCGGGTGGGTGG - Intergenic
988482045 5:31639202-31639224 AGCGGGACGCGGCGGGGCGGCGG + Intergenic
988728007 5:33942703-33942725 AGAGGGTGGAGGCAGGTGGGAGG + Intergenic
989146830 5:38258161-38258183 AGAGGGGCGCGGCAGGAGGAGGG + Intergenic
990860717 5:60323764-60323786 AGAGAGAGGCTGCGGGTGGGGGG - Intronic
993230075 5:85224662-85224684 AGAAGGGCGCGGGGGGTGGGGGG - Intergenic
993618659 5:90142775-90142797 GGTGGGACTCTGCAGGTGGGTGG - Intergenic
994072706 5:95620390-95620412 AGGCGGACGCGGCGGCTGGGCGG - Exonic
995844697 5:116481130-116481152 AGAGGGACGAGGCAGGCATGTGG + Intronic
996030453 5:118698974-118698996 AGAAGGGGGCGACAGGTGGGAGG + Intergenic
996209077 5:120782536-120782558 AGAGGGAAGCAGCATATGGGAGG - Intergenic
997006866 5:129827419-129827441 AGAGGGAAGAGGCAGGGGGTTGG + Intergenic
997305503 5:132832871-132832893 AGAGGTGAGCGGTAGGTGGGTGG - Intergenic
997577697 5:134995443-134995465 AAAGGGACTCGCCAGGTTGGAGG - Intronic
997882789 5:137605152-137605174 AGAGGCGGGCAGCAGGTGGGGGG + Intergenic
998157448 5:139795111-139795133 TGAGGGAGGCGGGAGGTGAGGGG - Intergenic
999625562 5:153517020-153517042 AGAGAGAGGCAGGAGGTGGGAGG + Intronic
1001031337 5:168265561-168265583 AGAAGGACACAGAAGGTGGGTGG + Intergenic
1001219868 5:169891250-169891272 AGAGGGACACGGAAGGGGAGAGG - Intronic
1001867320 5:175116846-175116868 TGAGGGAGGAGGTAGGTGGGTGG + Intergenic
1001959611 5:175872207-175872229 AGAGGGCGGCGGCAGGGGGGCGG + Intronic
1002083083 5:176748957-176748979 TGGGGGAGACGGCAGGTGGGAGG + Intergenic
1002134057 5:177097406-177097428 AGAGGGAGGTGGTGGGTGGGAGG - Intronic
1002140319 5:177133827-177133849 AGAGAGACGCGGGGGGAGGGGGG + Intronic
1003272915 6:4623230-4623252 AAGGGGAAGCGGCAGGGGGGCGG + Intergenic
1004662803 6:17725293-17725315 AGTGGGAGTCGGCAGGAGGGAGG + Intergenic
1005724571 6:28635919-28635941 AGCGGGGAGCGGCAGGTGGTGGG - Intergenic
1006089586 6:31620653-31620675 GGAGGGAGGTGGGAGGTGGGAGG + Intergenic
1006388262 6:33744297-33744319 AGAGGAAGGCAGCAGGTGTGGGG - Intronic
1006630754 6:35427992-35428014 GCAGGGACGCGGCATGTGGCCGG - Exonic
1007078119 6:39080654-39080676 AGAGGGAGGAAGCAGGAGGGAGG - Intronic
1007094992 6:39207622-39207644 AGAGGAAGCAGGCAGGTGGGTGG + Intronic
1007397647 6:41586727-41586749 GGAGGGAGGCGGGAGGAGGGAGG + Intronic
1008230351 6:48979276-48979298 AGTGGGACACCGCAGGTGTGAGG + Intergenic
1013105753 6:107025498-107025520 AGAGGGAGGAGGAAGGTGGTGGG + Intergenic
1014205573 6:118651772-118651794 AGAGGGATGCGGCGGGAGGGCGG - Intronic
1015031685 6:128602999-128603021 AGTGGGAAGGGGCAGGAGGGAGG - Intergenic
1017306757 6:152927143-152927165 AGAGGGAGGGAGCAGGTGGGAGG + Intergenic
1017891743 6:158644776-158644798 AGAGGGGCGTGGCAGGTCCGGGG - Intergenic
1017941352 6:159055890-159055912 AAAGGGAAGGGGCAGGAGGGTGG + Intergenic
1018985857 6:168636851-168636873 GGAGGGAGGCGGGAGGAGGGAGG - Intronic
1018985863 6:168636865-168636887 GGAGGGAGGCGGGAGGAGGGAGG - Intronic
1018985908 6:168636980-168637002 TGAGGGAGGCGGGAGGAGGGAGG - Intronic
1019292979 7:259258-259280 AGAGGGGCCCGGCAGGAGGATGG - Intronic
1019381795 7:727709-727731 ACAGGGAGCAGGCAGGTGGGGGG - Intronic
1019384247 7:745330-745352 AGAGGGAGGCGGGGGGTCGGGGG + Intronic
1020837545 7:13172523-13172545 AGAGGGAGGAGCCAGGTGGGAGG + Intergenic
1022459971 7:30595380-30595402 AGAGGGACGCAGGAAGTCGGAGG - Intronic
1022661732 7:32374069-32374091 AGAGGGAGGAGGGAGGAGGGAGG + Intergenic
1023372942 7:39530115-39530137 GGAGGGATGTGGCGGGTGGGTGG + Intergenic
1024604507 7:51012967-51012989 AAGGGGACGGGGCAGATGGGAGG - Intergenic
1025007068 7:55363323-55363345 AGAGGAACCCCGGAGGTGGGAGG - Intergenic
1025069802 7:55887900-55887922 GGCGGGAGGCGGCAGGTGGCGGG + Intronic
1025843539 7:65174599-65174621 ACATGGACACTGCAGGTGGGGGG - Intergenic
1025879505 7:65521367-65521389 ACATGGACACTGCAGGTGGGGGG + Intergenic
1025893933 7:65681221-65681243 ACATGGACACTGCAGGTGGGGGG - Intergenic
1027774188 7:82443957-82443979 AGAGGGAGGCGGCTGGGGGTGGG + Intergenic
1029238451 7:99142882-99142904 AAAGCGAGGGGGCAGGTGGGCGG + Intronic
1030152427 7:106420699-106420721 TGAGGGAGGAGCCAGGTGGGAGG - Intergenic
1030421313 7:109309964-109309986 AGAGGGAGGCTGCAGGTGGGTGG - Intergenic
1031011104 7:116525923-116525945 AGAGGGCCGAGGCAGGGTGGGGG + Intronic
1031586331 7:123535096-123535118 AGAGGGACGCGTCAGGGAGAAGG + Intergenic
1031586365 7:123535198-123535220 GGAGGGACGCGGCAGGGAGAAGG + Intergenic
1032846240 7:135754240-135754262 GGAGGGTCCCAGCAGGTGGGTGG + Intergenic
1034411807 7:150945970-150945992 AGAGGGCCGGGGCAGGCGGGAGG + Intronic
1034573238 7:151973855-151973877 CGAGGGAGGGGCCAGGTGGGAGG + Intronic
1034970779 7:155417953-155417975 AAAGAGCCACGGCAGGTGGGAGG - Intergenic
1035280775 7:157776686-157776708 AGAGGGAGGCAGGAGGAGGGAGG - Intronic
1036135854 8:6160977-6160999 AGAGGGGAGCAGGAGGTGGGAGG - Intergenic
1036588197 8:10144595-10144617 AGAGGGAAGGGGGAGGAGGGGGG - Intronic
1038478306 8:27884395-27884417 AGAGGGACCCGGCCGCTGCGCGG + Intronic
1038490107 8:27964786-27964808 AGAGGGACCAGGCTGGTGGGGGG - Intronic
1038535885 8:28352503-28352525 ACAGGGACTCGGCAGGGTGGAGG + Intronic
1039779078 8:40766069-40766091 AGATGGAGGCCGCAGGAGGGAGG - Intronic
1041713003 8:60910263-60910285 GGAGGGACGCGCCAGCTGCGGGG - Intergenic
1042861087 8:73315160-73315182 AGAGAGAGGAGGCCGGTGGGGGG - Intronic
1042861096 8:73315189-73315211 AGAGAGAGGAGGCCGGTGGGGGG - Intronic
1042861105 8:73315218-73315240 AGAGAGAGGAGGCCGGTGGGGGG - Intronic
1042861114 8:73315247-73315269 AGAGAGAGGAGGCCGGTGGGGGG - Intronic
1043781011 8:84335066-84335088 AGAGGGGAGAGGCAGGAGGGAGG + Intronic
1044018708 8:87077552-87077574 AGAGGGATGGGGGAGGGGGGAGG - Intronic
1045555050 8:103207653-103207675 AGGGGGAGGGGGCAGGTGGGAGG + Intronic
1045632889 8:104147219-104147241 AGAGAGAAGGCGCAGGTGGGTGG - Intronic
1046131527 8:109973898-109973920 GGAGGCACGCGGCGGCTGGGCGG - Intronic
1047432557 8:124805425-124805447 AGAGGGAAGGGGAAGTTGGGAGG + Intergenic
1047523331 8:125612467-125612489 AGAGGGACCTGGCAGATGGGTGG + Intergenic
1049262020 8:141644709-141644731 AGAGGGACGGGACAGGACGGAGG - Intergenic
1049361087 8:142212889-142212911 AGAGGGACCGGGCAGGAGAGAGG - Intronic
1049379250 8:142303826-142303848 AGAGGGACGTGGCATGAGGCTGG + Intronic
1049598289 8:143494607-143494629 GGAGGGAAGCGGCAGGTCGGGGG + Intronic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1052998651 9:34565368-34565390 AGAGAGATGGGGGAGGTGGGGGG - Intronic
1053433466 9:38059245-38059267 AGAGTGACTCGACAGGTGGGTGG - Intronic
1053803049 9:41776019-41776041 GGAGGGACGAGGCGGGTGGGTGG - Intergenic
1054142216 9:61539103-61539125 GGAGGGATGAGGCAGGTGGGTGG + Intergenic
1054191338 9:61987329-61987351 GGAGGGACGAGGCGGGTGGGTGG - Intergenic
1054461972 9:65470286-65470308 GGAGGGACGAGGCAGGTGGGTGG + Intergenic
1054647031 9:67600388-67600410 GGAGGGACGAGGCGGGTGGGTGG + Intergenic
1056322886 9:85452859-85452881 AGAGGAACATGGCAGATGGGAGG - Intergenic
1056464616 9:86841577-86841599 AGAGGGACTCAGGAGATGGGTGG + Intergenic
1057294032 9:93825104-93825126 AGAAGGAGCAGGCAGGTGGGGGG - Intergenic
1060355382 9:122902606-122902628 AGGCGGAGGCGGGAGGTGGGTGG + Intronic
1060820350 9:126658202-126658224 AGTGGGACAGGGCAGGAGGGGGG + Intronic
1060912062 9:127359094-127359116 AGTGGGGGGCGGCGGGTGGGGGG - Intronic
1061391686 9:130320467-130320489 TGAGGGCCGTGGGAGGTGGGAGG + Intronic
1061495400 9:130971059-130971081 GGAGGGAGGAGGCAGGAGGGAGG + Intergenic
1061572604 9:131487084-131487106 AGAGGGGCAGGGGAGGTGGGAGG + Intronic
1061680723 9:132241346-132241368 AGACGGAGCTGGCAGGTGGGCGG + Intronic
1061873943 9:133534758-133534780 AGAGGGAGGCGGCGCGGGGGAGG + Intronic
1061896000 9:133648041-133648063 TGAGGGACGCGGGAGGAGGGAGG - Intronic
1061938809 9:133873095-133873117 AGAGGGAGGGGGCGGGGGGGTGG + Intronic
1062011139 9:134267496-134267518 AGAGGGAGCCAGCAGGTGTGTGG + Intergenic
1062077364 9:134598137-134598159 AGAGGGACCAAGCATGTGGGTGG - Intergenic
1062208165 9:135348628-135348650 AGGGGGGGGCGGGAGGTGGGAGG - Intergenic
1062312755 9:135948118-135948140 AGAGTGAAGCGGTAGGTGAGGGG + Intronic
1062421205 9:136483477-136483499 AGACGGACGCCGGAGGGGGGCGG - Exonic
1062534600 9:137015925-137015947 CGGGGGGCGGGGCAGGTGGGCGG - Intronic
1203732814 Un_GL000216v2:106185-106207 GGAGGGAGGAGGCAGGAGGGTGG - Intergenic
1188757051 X:33975075-33975097 AGGGGGAGGCTGCAGGTGGTTGG + Intergenic
1189277526 X:39797567-39797589 GGAGGGACCCAGCAGGTGGCAGG + Intergenic
1191007513 X:55726018-55726040 AGAGGGAAGCAGGAAGTGGGTGG + Intronic
1192183074 X:68928552-68928574 AGAGGTAAGGGGCCGGTGGGGGG - Intergenic
1193380342 X:80809798-80809820 AGAGAGACGCGGGGGGTGGGGGG + Intergenic
1197069147 X:122272579-122272601 AGAGGTATGCTGCAAGTGGGAGG - Intergenic
1197752483 X:129974980-129975002 TGTGGGAGGGGGCAGGTGGGAGG + Intergenic
1198074225 X:133179498-133179520 AGGGGGACGGGGTAGGGGGGTGG - Intergenic
1199470795 X:148193388-148193410 AGAGGGTCGTGGCAGGGTGGGGG - Intergenic
1199699642 X:150365602-150365624 AGACGGAGGCGGCAGCTCGGAGG + Intronic
1199802889 X:151268922-151268944 AGGGGAATGAGGCAGGTGGGTGG - Intergenic
1201076876 Y:10195857-10195879 AGAGAGAGGCGGCAGGCCGGGGG - Intergenic