ID: 1132580088

View in Genome Browser
Species Human (GRCh38)
Location 16:680706-680728
Sequence GGGCGGCGGCGGTGGCACCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1037
Summary {0: 1, 1: 0, 2: 11, 3: 144, 4: 881}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132580074_1132580088 8 Left 1132580074 16:680675-680697 CCGCGCGATCGTGAGTGCGCCCG 0: 1
1: 0
2: 0
3: 2
4: 18
Right 1132580088 16:680706-680728 GGGCGGCGGCGGTGGCACCGGGG 0: 1
1: 0
2: 11
3: 144
4: 881
1132580073_1132580088 18 Left 1132580073 16:680665-680687 CCTGCTACGGCCGCGCGATCGTG 0: 1
1: 0
2: 0
3: 1
4: 10
Right 1132580088 16:680706-680728 GGGCGGCGGCGGTGGCACCGGGG 0: 1
1: 0
2: 11
3: 144
4: 881

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132580088 Original CRISPR GGGCGGCGGCGGTGGCACCG GGG Intronic
900100899 1:961567-961589 GGGCGGCGCTGGGGGCTCCGTGG + Intronic
900138260 1:1127938-1127960 GGGCGGTGGCGATGACACCCAGG - Intergenic
900171994 1:1273798-1273820 AGGCGGCGGCGGCGGCGCTGCGG - Exonic
900245323 1:1633695-1633717 GGGCGGCGGGGCTGGGCCCGGGG + Intronic
900256554 1:1700854-1700876 GGGCGGCGGGGCTGGGCCCGGGG + Intronic
900283915 1:1890503-1890525 TGGCGGCGGCCGGGGCCCCGGGG - Intronic
900284254 1:1891485-1891507 GGGCGGGGGCGGTCCCTCCGGGG + Intergenic
900298554 1:1965108-1965130 GGGCGGCGCCGGTGGCAGCTCGG + Intronic
900349396 1:2227661-2227683 CGGAGGCGGCGGTGGCGCCCGGG - Intergenic
900349671 1:2228502-2228524 GGGCGGCGGCGGGCGCGGCGCGG + Intergenic
900349752 1:2228697-2228719 GGGCGGCGGCGGGGGCCGGGGGG + Exonic
900349814 1:2228939-2228961 GGGCACCGGCGCCGGCACCGCGG - Exonic
900417284 1:2540929-2540951 GGGCGGCGGCGGGGGGCGCGGGG - Intergenic
900667402 1:3824825-3824847 GGAAGGGGGCAGTGGCACCGTGG + Intronic
900667416 1:3824871-3824893 GAAGGGCGGCAGTGGCACCGTGG + Intronic
901007492 1:6179169-6179191 GGGCAGGGGCGGTGGCCCTGGGG + Intronic
901022175 1:6261032-6261054 CGGCGGCGGCGGCGGCGCCTAGG - Intergenic
901060890 1:6471451-6471473 GGGCGCAGGCGGGGGCACTGAGG - Intronic
901078616 1:6571167-6571189 GGGCGGCTGTGGTGGCAGCACGG - Exonic
901115024 1:6836644-6836666 GGGCGTCTGCGGTAGCACCGAGG + Intronic
901272248 1:7961582-7961604 CTGAGGCGGGGGTGGCACCGGGG - Intronic
901403768 1:9032296-9032318 GGGTGGCTGCAGTGGCACCCGGG + Intergenic
901433992 1:9235076-9235098 GGGCGGCGGCGGGGCCGGCGGGG - Intronic
901443430 1:9293044-9293066 CAGCGGCGGCGGCGGCACCCCGG + Exonic
901641334 1:10694583-10694605 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
902067606 1:13700643-13700665 GGGCGGCGGTGGGGCCACCTGGG + Intronic
902286200 1:15410066-15410088 GGGCAGCGGCGGCGGCGGCGGGG + Exonic
902476743 1:16692483-16692505 TGGCGGCGGCTGCGGCACAGGGG + Intergenic
902950984 1:19882642-19882664 TGGCGGCGGCGGCGGCTGCGAGG + Exonic
903132731 1:21290232-21290254 GCGCGGCGGCGGCGGCGCCAGGG - Intronic
903413958 1:23168730-23168752 AGGCGGCGGCGGCGGGAGCGCGG - Intronic
903822117 1:26111183-26111205 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
903828649 1:26161963-26161985 GGGCGGCGGCGGCGGCTCGGAGG + Exonic
904125138 1:28232947-28232969 AGGCGGCGGAGGCAGCACCGAGG - Exonic
904237800 1:29125319-29125341 GGGAGGCGGAGGTGCGACCGCGG - Intergenic
904822955 1:33256831-33256853 CGGCGGCGGCGGCGGCAGCGGGG + Intronic
905137076 1:35808176-35808198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905137124 1:35808343-35808365 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905414378 1:37794379-37794401 CGGCGGCGGCGGGGGCGGCGCGG - Exonic
905648289 1:39639713-39639735 GGGCGGTGGCGGCGCCCCCGAGG - Exonic
905947767 1:41918106-41918128 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
906480943 1:46198454-46198476 CGGCGGCGGCGGCGGAAGCGGGG - Intronic
906637078 1:47416845-47416867 GAGCGGCGGCCCTGGCGCCGCGG - Exonic
906640564 1:47438398-47438420 GGGGGGCGGCGGCCGCAGCGGGG + Exonic
907278105 1:53328015-53328037 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
907429960 1:54406034-54406056 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
907440399 1:54475014-54475036 GGGAGGCGGCGGAGGAGCCGGGG - Intergenic
907689179 1:56645328-56645350 CGGCGGCGGCGGCGGCTACGCGG + Exonic
908401219 1:63774378-63774400 CGGCGGCGGCGGCGGCTCCCAGG - Exonic
908780544 1:67685960-67685982 GGGGGGCGGCGATGGCCCCGAGG + Intronic
909001429 1:70221714-70221736 CGGCGGAGGCGGCGGCACCGAGG + Exonic
910449083 1:87328819-87328841 GGGCGGGGGCGGGGGCCCCCGGG + Exonic
911017242 1:93346184-93346206 CGGCGGCGGCAGCGGCAGCGGGG + Exonic
911633989 1:100213393-100213415 GGGCGGCTGCGGGGGCGCGGCGG - Intronic
911696427 1:100895184-100895206 GAGCGGCGGCCGTTGCCCCGGGG + Exonic
912132391 1:106619302-106619324 GGGTGGCTGCAGTGGCACCAAGG - Intergenic
912625742 1:111203839-111203861 GGGCAGGGGCGCTGGCTCCGAGG + Intronic
912625866 1:111204248-111204270 GGGGGACGGCGTGGGCACCGGGG - Intronic
912716922 1:111989722-111989744 TGGCGGCGGCAGTGGCGGCGGGG - Intergenic
912993490 1:114511122-114511144 GGGCGGCGGCGGCGGCGACGCGG - Exonic
913300713 1:117366873-117366895 GGGCGGGGGCGATGGGACCCGGG - Intergenic
915200116 1:154221009-154221031 CGGCGGCGGCAGCGGCAGCGCGG + Intronic
915309592 1:155000629-155000651 GGGCGGGGGGGGTGGGAACGTGG - Intergenic
915325324 1:155078919-155078941 CGGCGGCGGCGGCGGCTCCGGGG + Exonic
915458067 1:156053695-156053717 GGGTGGCGGCGGCGGCATGGCGG - Exonic
916651668 1:166839617-166839639 GGGCGGGGGCGGCGGCGGCGCGG + Intronic
916890259 1:169106618-169106640 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
917291616 1:173477260-173477282 GGGCGGCGGGGGCGGGGCCGCGG - Exonic
917933361 1:179839552-179839574 GGGAGGCGGAGGTTGCAGCGAGG + Intergenic
918365654 1:183805140-183805162 CGGCGGCGGCGGGGGCAGCGCGG + Intronic
920528483 1:206685276-206685298 GGGCTGCGGCGGCGGGGCCGGGG - Exonic
920528505 1:206685321-206685343 CGGCGGCGGCGGCTGCGCCGGGG - Exonic
921039578 1:211416768-211416790 GGGAGGCGGCGGGGGCCGCGGGG + Intergenic
921217705 1:212951363-212951385 GAGCGGCGGCGGGAGCTCCGCGG - Exonic
921603991 1:217135550-217135572 TGGCGGCGGCGGCGGCAGGGCGG + Intronic
922287546 1:224183250-224183272 CGGCGGCGGCGGCGGCTCCCCGG - Exonic
922730728 1:227947738-227947760 GGGCGGGGGCGGCGGGGCCGGGG - Intronic
922958619 1:229626014-229626036 GAGCGGCGGCGGGGGCGGCGGGG - Exonic
923400783 1:233614081-233614103 GGGCGGGGGCGGGGGCGGCGGGG + Exonic
923744305 1:236686411-236686433 GGCCGGGGGCGGTGGCGGCGGGG + Intergenic
924052389 1:240092160-240092182 CGAAGGCGGCGGTGGCGCCGAGG + Exonic
924527244 1:244863629-244863651 CGGAGGCGGCGGTCGCCCCGGGG - Exonic
924754779 1:246931477-246931499 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1063418239 10:5890304-5890326 GCCCGGCGGCGGCGGCAGCGGGG + Intronic
1063450067 10:6145126-6145148 GGGCTGCGGCGGTGCCGCCCGGG + Intronic
1064167798 10:13001594-13001616 GGGCGGCGGCGGGGAGCCCGGGG + Exonic
1064179184 10:13100175-13100197 GGGCGGCGGCGGTGGCGGAGGGG - Exonic
1064208973 10:13347779-13347801 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1064209080 10:13348113-13348135 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1064231050 10:13529226-13529248 GGGCGGCGGCGTCGTCCCCGGGG - Intergenic
1064244270 10:13656918-13656940 GCGCGGCGGCGGCGGCGACGAGG - Exonic
1065058828 10:21875850-21875872 GGGAGGCGGAGGTTGCAGCGAGG + Intronic
1065140529 10:22714650-22714672 GGGAGGCGGCTGCGGCGCCGCGG + Intergenic
1065214874 10:23439502-23439524 GGGCGGCGGCCGTGGGACCCGGG - Exonic
1065520569 10:26567283-26567305 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1065589776 10:27252564-27252586 CGGCGGCGGCGGGGGCGGCGGGG - Intergenic
1065660282 10:27998925-27998947 AGGCGGCGGCGGCGGCGCCCGGG - Intronic
1066012751 10:31209614-31209636 GGGCGGGGGCGGGGGCAGGGCGG - Intergenic
1066080710 10:31928530-31928552 CGGCGGCGGCGGCGGCGCCGCGG - Intronic
1066094075 10:32056206-32056228 CGGCAGCGGCGGCGGCACCGGGG + Exonic
1066126576 10:32347607-32347629 TGGGGGCGGCCGTGGCCCCGGGG - Intronic
1067111871 10:43407220-43407242 GGGCGGCGGCGGCGGCTTCCCGG - Intronic
1067147194 10:43702398-43702420 TGGCAGCGCCGGTGGCAGCGTGG - Intergenic
1067336958 10:45374122-45374144 GGGCGGGGGCGGGGGCAGCCGGG + Intergenic
1068669674 10:59710099-59710121 GGTGGGCGGCGGGGGCACAGCGG - Intronic
1068690161 10:59906310-59906332 GGGCGGCGGCGGTGGCGGCGGGG - Exonic
1069386174 10:67884927-67884949 GTGCGGCGGCGGCGGCGCTGTGG + Exonic
1069583360 10:69579894-69579916 GGGCGTCGGAGGAGGCACCAGGG - Intergenic
1069698350 10:70404342-70404364 AGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1069761725 10:70815992-70816014 CGGCGGCGGCGGCGGCAACAGGG + Exonic
1070257631 10:74825525-74825547 AGGCGGCGGCGGTGGGTCCCGGG + Intergenic
1070721571 10:78760799-78760821 GGGTGGCGGGGGTGGCCCCATGG - Intergenic
1070768624 10:79070070-79070092 CTCCGGCGGCGGTGGCCCCGGGG + Intronic
1070800831 10:79243557-79243579 CGGCGGCGGCGGCGGCGCGGGGG - Intronic
1070895809 10:79982252-79982274 GGGCGGCGGCGGGGGCGCTCGGG + Intronic
1072409090 10:95183933-95183955 GGGCGGCGGCCGGGGCCCCACGG - Intergenic
1072594197 10:96856141-96856163 GGGAGGCGGAGGTTGCAGCGAGG - Intronic
1073110916 10:101062591-101062613 GGGCCGCGGCGGCGGCAGCATGG - Exonic
1073196435 10:101695142-101695164 GGGCGGCGGCGGTGGCGGCTCGG - Exonic
1074843284 10:117375437-117375459 GTGTGGCGGCGGCGGCAGCGGGG + Exonic
1075697479 10:124447611-124447633 CGGCGGCGGCGGCGGCTCGGGGG - Exonic
1075697482 10:124447614-124447636 GGGCGGCGGCGGCGGCGGCTCGG - Exonic
1075748422 10:124743970-124743992 CGGCGGCGGCGGTGGCCGGGGGG - Intronic
1075753372 10:124791797-124791819 TGACGGCGGCGGTGGCGCTGCGG - Exonic
1075768899 10:124917083-124917105 GGGCGGAGGCGGCAGCAGCGGGG + Intergenic
1076020203 10:127066203-127066225 TGGGGGCGGCGGGGGCACCTGGG - Intronic
1076146481 10:128126280-128126302 AGGCGGCGGCGGGAGCAGCGGGG - Exonic
1076372495 10:129964388-129964410 GCGCGGCGGCGGCGGCGGCGAGG - Intergenic
1076722093 10:132397176-132397198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1076765491 10:132630791-132630813 GGGAGGCGGCGGGGGCGGCGGGG + Intronic
1076792883 10:132786114-132786136 CGGCGGCGGCGGCGGCTCCGGGG + Intergenic
1076998510 11:310907-310929 GGGCGGCCGCGGTGGGAGCTGGG + Intronic
1077000233 11:318852-318874 GGGCGGCCGCGGTGGGAGCTGGG - Intergenic
1077311209 11:1889829-1889851 GGGTGGCGGCCGTGGTACAGGGG + Exonic
1077923104 11:6655883-6655905 GGGCGGGGGCGGGGGCTCCGCGG - Intergenic
1078190834 11:9091567-9091589 GGGCGGTGGCGGCGGCGGCGCGG + Exonic
1078334088 11:10450603-10450625 GGGCTGCGGCGCGGGCCCCGCGG + Intronic
1078492749 11:11784620-11784642 GGGAGGCCGCAGTGGCACAGTGG - Intergenic
1079689401 11:23403531-23403553 CGGCGGCGGCGGCGGCGCGGGGG - Intergenic
1080333835 11:31174144-31174166 GGGCGGCTGCAGTTGCACCTGGG - Intronic
1080588337 11:33700507-33700529 TGGCGGGGGCGGGGGCGCCGGGG + Exonic
1081863618 11:46347831-46347853 CGGCGGCGGGGCAGGCACCGAGG + Intronic
1082280613 11:50267858-50267880 GGGCGGCGGTGGCGGCTCCCGGG + Intergenic
1082952330 11:58830847-58830869 GGGCGGCTGCAGGGGCACCCAGG - Intergenic
1083063386 11:59898144-59898166 CGGTGGCGGCGCTGGCAGCGCGG + Intergenic
1083267868 11:61555287-61555309 GGGGGGCGACGGTGGGCCCGGGG - Intronic
1083272978 11:61581261-61581283 GGGCGGCGGCCGTGCCCTCGGGG - Intergenic
1083342433 11:61967448-61967470 CGGCGGCGGCGGTGGCTGCGCGG + Exonic
1083428308 11:62601081-62601103 GGGCGACGGCTTTGCCACCGCGG - Intronic
1083560738 11:63671241-63671263 AGGCGGCGGGGGTGGCCGCGGGG + Intronic
1083659810 11:64246791-64246813 GGGCGGCGGCGGGGGCGCCCGGG + Exonic
1083828749 11:65217740-65217762 GGGCGGGGGCGGGGGGACAGGGG + Intergenic
1084146146 11:67266409-67266431 CGGAGGCGGCGGCGGCTCCGGGG + Exonic
1084151355 11:67289317-67289339 CGGCGGCGGCGGCGGCAGCGCGG - Exonic
1084165268 11:67372561-67372583 GGGCGGGGCCGGGGGCGCCGAGG - Intronic
1084247945 11:67873090-67873112 GGGAGGCTGAGGTGGCTCCGGGG - Intergenic
1084973031 11:72781697-72781719 CGGCGGCGGCGCTGGCACCCCGG - Intronic
1085396889 11:76210862-76210884 GGGCGGGGGCGGGGTCCCCGCGG + Intergenic
1087014623 11:93543239-93543261 GCGCGGCGGCGGCGGCGGCGGGG - Intronic
1087118002 11:94544548-94544570 GGGCGGCGCGGGTGGCGCCGAGG + Exonic
1087761811 11:102110659-102110681 GGGCGGGGGCGGAGGCGCCGGGG + Exonic
1088259121 11:107928342-107928364 GGGCGGGGGCGGTGGCGCGTGGG - Intergenic
1088400883 11:109422148-109422170 CGGCGGCGGCGGCAGCAGCGCGG + Exonic
1089432691 11:118436647-118436669 GGTCGGCGGTGGCGGCCCCGGGG + Exonic
1089499908 11:118925785-118925807 GGGCGGCGGCGGTGGTGCAGCGG + Intronic
1089993429 11:122882901-122882923 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1090238208 11:125164816-125164838 AGGCGGCGGCGGCGGCGCGGCGG + Intronic
1090238280 11:125165145-125165167 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1090645549 11:128764438-128764460 GGGAGGTGGCGGTGGCCCCAAGG - Intronic
1090817787 11:130314447-130314469 CGGCGGCGGCGGCGGCCCGGGGG + Exonic
1091550286 12:1530981-1531003 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1091792506 12:3280018-3280040 GGGGGGCGGGGGTGGCAGAGTGG + Intronic
1091823258 12:3491752-3491774 GAGCGGCGGCGGCGGCGCGGTGG - Intronic
1091915343 12:4269228-4269250 GGGTCGCGGCGCTGGCTCCGGGG + Intergenic
1092335408 12:7628703-7628725 GGGCGGCGGCGGCGGCGGCAGGG - Intergenic
1092507965 12:9124320-9124342 GGGCAGCTGCAGCGGCACCGGGG - Intergenic
1096159858 12:49367400-49367422 GGGAGGCGGCGGTGGGGGCGGGG + Intronic
1096241301 12:49961686-49961708 GGGGGGCGGGGGTCGCGCCGGGG + Intergenic
1096265337 12:50118117-50118139 GGGAGGCGGAGGTTGCAGCGAGG - Intronic
1096461141 12:51821862-51821884 CGGGGGCGGCGGGGGCAGCGCGG + Intergenic
1096461190 12:51822032-51822054 GGGCGGTGGCGGCGGTTCCGGGG - Intergenic
1096695326 12:53345004-53345026 GGGCGGCGGCGGGGGAACTCCGG + Intronic
1097057431 12:56258309-56258331 CGGCGGCGGCGGCTCCACCGGGG + Exonic
1097196823 12:57247009-57247031 GGGTGGCGGTGGGGGCGCCGCGG + Intronic
1097222649 12:57460077-57460099 GGGGGGTGGGGGTGGCATCGAGG + Intergenic
1097981743 12:65742540-65742562 CCGCGGCGGGGGTGGCCCCGCGG - Intergenic
1098550372 12:71755138-71755160 GGCCGGCGGCGGCGGCGGCGGGG + Exonic
1100391733 12:94150073-94150095 CGGCGGCGGCGGCGGCTCCCCGG - Intronic
1101340879 12:103841121-103841143 CGGCGGCGGTGGTGGCACGCGGG - Exonic
1102184229 12:110935092-110935114 GGGCGGGGGTGGTGGCAGTGGGG + Intergenic
1102197156 12:111033973-111033995 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1102197157 12:111033976-111033998 CGGCGGCGGCGGCGGCGCGGCGG + Intergenic
1102197409 12:111034854-111034876 CGGCGGCGGCGGCGGCCCCCGGG - Intronic
1102457137 12:113077853-113077875 TGGCGGCGGCGGCGGCAGCGGGG - Exonic
1102853952 12:116277494-116277516 AGGCGGCGGCGGCGGCTCCGGGG - Intergenic
1102853960 12:116277514-116277536 CCGCGGCGGCGGCGGCTCCGAGG - Intergenic
1102962007 12:117099190-117099212 GGGGGGCGGCGCGGGGACCGGGG - Intronic
1103336589 12:120194650-120194672 GGGCGGCTGCGGGGCCAACGCGG - Intronic
1103424730 12:120823227-120823249 GGGCGGCGGCGGTGGCGGGGAGG + Intronic
1103433068 12:120904248-120904270 GGGCGGCGGCGGCGGCGGCCGGG + Exonic
1103534779 12:121626869-121626891 GGACGGCGGCGGTGGCGGGGCGG - Exonic
1103561241 12:121794178-121794200 AGGTAGCGGCGGTGGCACCAGGG + Exonic
1103567281 12:121823072-121823094 GGGCAGCAGGGGTGGCAGCGGGG - Exonic
1103749870 12:123151158-123151180 GAGCGGCGGCGGCGGCGGCGGGG + Intergenic
1103764669 12:123271665-123271687 GGGCGGCGGCGGCGGCGGCGAGG + Exonic
1103800356 12:123533735-123533757 CGGCGGCGGCGGCGGCAGCGGGG + Intergenic
1104748353 12:131223512-131223534 TGGCGGTGGCGGTGGCAGTGGGG + Intergenic
1104841458 12:131828041-131828063 GCGCTGCGGCGGCGGCTCCGGGG + Intergenic
1104958049 12:132475371-132475393 GGGAGGGGGCGGGGTCACCGCGG - Intergenic
1105041718 12:132966539-132966561 GGGCAGCTGCAGTGGCACCTGGG - Intergenic
1105678069 13:22696600-22696622 TGGCGGCGGCGGTGGCTGCGCGG + Intergenic
1105678079 13:22696628-22696650 GAGCGGCGGCGGGGGCCCTGGGG + Intergenic
1106087652 13:26557793-26557815 CGGCGCCGGCGGCGGGACCGCGG + Exonic
1106322966 13:28659278-28659300 TGGCGGCGGCGGCGGCAGCGTGG + Intronic
1106478031 13:30114805-30114827 GGGAGGCGGCGGCGGCGGCGGGG + Intergenic
1106776646 13:33016257-33016279 GGGCGGGGGCAGGGGCGCCGAGG - Intergenic
1107851413 13:44576560-44576582 TGGCGGCGGCGGCGGCCCCGGGG - Exonic
1108063205 13:46553208-46553230 GGGAGGCGGCCGTGGCAGCTCGG - Intronic
1108063314 13:46553534-46553556 TGGTGGCGGCGGTGGCAGCGGGG + Exonic
1108227465 13:48303971-48303993 GGGCGGCGGCGGCGGTGCCGGGG - Exonic
1109699670 13:66009389-66009411 GCGCGGCGGGGGGGGAACCGGGG + Intergenic
1110450853 13:75636272-75636294 GGGCCGGGGCGGGGCCACCGCGG + Intronic
1110558511 13:76886257-76886279 TGGCGGCGGCGGCGGCGGCGGGG - Exonic
1110596585 13:77326776-77326798 CGGCGGCGGCGGCGGCGGCGAGG - Intronic
1110705930 13:78602161-78602183 GGGAGGCGGCGGTGGCGGCCCGG - Exonic
1111672578 13:91348413-91348435 CGGCGGCGGCGGCGGCACATGGG + Intergenic
1112091797 13:96090809-96090831 CGGCGGCGGCGGCGGCAGGGCGG - Intergenic
1112505042 13:99970434-99970456 CGGCGGCGGCGGCGGCAGCCCGG + Exonic
1112505083 13:99970584-99970606 CGGCGGCGGCGGCGGCGCCGGGG + Exonic
1112733692 13:102394694-102394716 GGGCAGCGGCGGCGGGACCGGGG + Intronic
1113312032 13:109140990-109141012 GGGCGGGGGCGGGGGCGGCGTGG - Exonic
1113493996 13:110713864-110713886 AGGCGGCGGGGCTGGCGCCGGGG - Intronic
1113541867 13:111115434-111115456 AGGCGGCGGCGGCGGCGGCGGGG + Exonic
1113602999 13:111584323-111584345 GGACTGGGGCGGTGGCAGCGGGG - Intergenic
1113607885 13:111623285-111623307 GGGCAGCAGAGGTGGCACTGCGG - Intronic
1113655930 13:112067772-112067794 CGGCGGCGGCGGGGGCGCCAAGG + Exonic
1114269215 14:21091001-21091023 GGAAGGAGGCGGTGGCTCCGGGG + Exonic
1115235793 14:31207670-31207692 GGGCGACGGCGGCGGCGGCGCGG + Intronic
1115399144 14:32938833-32938855 GGGAGGCGGCGGCGGCGGCGGGG - Intronic
1115474569 14:33800608-33800630 GGGCGGGGGCGGCGGCGCGGGGG + Exonic
1115654426 14:35429785-35429807 GGGCGGCGGAGGCGGCACAGAGG + Intergenic
1115754275 14:36517673-36517695 CGGCGGCGGCGGGGGCGGCGGGG - Exonic
1115761310 14:36581054-36581076 CGGCGGCGGCGGTGGCGAGGTGG - Exonic
1115851784 14:37595141-37595163 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1115851785 14:37595144-37595166 CGGCGGCGGCGGCGGCGCGGCGG + Intronic
1116436180 14:44897479-44897501 CGGCGGCGGCGGCGGCAGCCCGG + Exonic
1116817920 14:49599937-49599959 GGGCCGGGGCGGGGGCTCCGGGG + Intronic
1116950151 14:50872079-50872101 GGGCGGGCGCGGTGCCGCCGGGG + Intronic
1117176685 14:53153026-53153048 AGGCGGCGGCGGCGGCGCCTGGG - Exonic
1117251858 14:53946862-53946884 CGGCGGCGGCGGGGGCACCAGGG - Intergenic
1117315109 14:54565988-54566010 GGGCGGCGGCGACGGCACGCGGG - Intergenic
1117417782 14:55513688-55513710 GGGTGGCGGCGGTGGTACTGAGG - Intergenic
1117424424 14:55580264-55580286 CGGCGGCGGCGGCGGCGCCTCGG + Intronic
1117875891 14:60249617-60249639 AGGCGGCGGCGGCGGCAGCCGGG - Intronic
1117898241 14:60509249-60509271 GGGTGGCGGCGGTGGCTCAACGG - Exonic
1117920792 14:60723768-60723790 GCGCGGCGGCGGCGGCGGCGTGG + Exonic
1117978537 14:61321162-61321184 GGCCGGAGGCGGGGGCACGGCGG - Intronic
1118339102 14:64879833-64879855 TGGCGGCGGCGGCGGCGCAGGGG + Exonic
1118350999 14:64972366-64972388 GGGCGGCGGCGGCGGCGCAGGGG - Intronic
1118849484 14:69573097-69573119 CGGCGGCGGCGGCGGCCGCGGGG + Exonic
1118992426 14:70809034-70809056 CGGCGGCGGCGGTGGGCCCCGGG - Exonic
1119392821 14:74302783-74302805 GGGCGGCGGACGAGGCACGGAGG + Intronic
1119410308 14:74426150-74426172 GCGCGGCGGCGGCGGCGGCGGGG - Intergenic
1119539259 14:75428096-75428118 CGGCGGCGGGGCTGGCGCCGCGG + Intronic
1119759656 14:77141544-77141566 GTGCGGCGGCGGCGGCGCGGGGG - Intronic
1120167902 14:81220357-81220379 CGGCGGCGGCGGCGGCCGCGCGG + Intronic
1120993574 14:90398189-90398211 GGGAGGAGGCGGCGGCGCCGCGG + Intronic
1121342786 14:93115391-93115413 GGGCGTGGGCGGTGGCAGCTTGG - Intronic
1121415907 14:93779210-93779232 TGGGGGCGGCGGGGGCAGCGGGG + Exonic
1122162301 14:99793310-99793332 CGGCGGCGGCGGCGGGCCCGGGG + Intronic
1122183495 14:99971987-99972009 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1122221233 14:100240054-100240076 GTGCGGCGGCGGGGGCGCGGCGG + Intronic
1122445019 14:101761787-101761809 CGGCGGCGGCGGCGGCCGCGGGG + Exonic
1122581987 14:102777136-102777158 GCGCGGCGGCGGGGGCGCGGCGG + Intergenic
1122635378 14:103127269-103127291 AGGCGGCGGCGGCGGGGCCGGGG + Exonic
1122947838 14:105021281-105021303 GGGCGGGGGCGGGGCAACCGAGG - Intergenic
1122975332 14:105168543-105168565 AGGCGGCGGCGGCGGCGGCGCGG + Exonic
1122993298 14:105248980-105249002 CGGCGGCGGCGCTGGCGCGGGGG - Exonic
1123024891 14:105419899-105419921 CGGCGGCGGCGGCAGCAGCGCGG + Exonic
1202848394 14_GL000225v1_random:886-908 GGCCGGCGACGGTGGCGCAGAGG + Intergenic
1202918374 14_KI270723v1_random:6028-6050 GGGCGCCGGCGGAGCCACAGGGG - Intergenic
1124469271 15:29968790-29968812 CGGCGGCGGCGGAGGCGGCGGGG - Intronic
1124500381 15:30223111-30223133 CGGCTGCGGCGCTGGCCCCGCGG - Intergenic
1124743192 15:32315555-32315577 CGGCTGCGGCGCTGGCCCCGCGG + Intergenic
1124971126 15:34490500-34490522 GGGCGGCGGGGGCGGCGGCGGGG - Intergenic
1125051173 15:35299485-35299507 GGGCCGCGGTGGCGGCAGCGCGG + Intronic
1125329050 15:38564688-38564710 AGGCGGCGGCGGTGGTGGCGGGG - Exonic
1126034959 15:44537199-44537221 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1126113200 15:45187496-45187518 AGGCGGCGCCGGGGGCCCCGGGG + Intronic
1126852399 15:52805379-52805401 AGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1127144088 15:56007201-56007223 CGGCGGCGGCGGTGGCGATGGGG + Intergenic
1127165765 15:56243783-56243805 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1128056469 15:64703223-64703245 CGGCGGCGGCGGTGGCGGCCGGG - Exonic
1128078302 15:64841806-64841828 GGGAGGGGGCGGTGGGGCCGGGG - Intergenic
1128344127 15:66842819-66842841 GGGCGGCGGCGGCGCCGGCGCGG + Intergenic
1128455074 15:67827555-67827577 CGGGGGCGGCGGGGGCAACGGGG - Intronic
1128471688 15:67959261-67959283 GGGAGGCGGAGGTTGCAGCGAGG - Intergenic
1128841472 15:70854235-70854257 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
1129189136 15:73927407-73927429 GGGCGGCGGCGTGGGCGCGGGGG + Exonic
1129189176 15:73927556-73927578 CGGCGGCGGCGGCGGCACGTAGG - Exonic
1129334294 15:74843192-74843214 GGGCGGCGCTGGGGGCAGCGTGG - Exonic
1129339052 15:74873139-74873161 GGGCGGCGGCCGTGGGCCCTAGG + Intronic
1129796634 15:78382378-78382400 AGGCGGCAGCAGTGGCACCTGGG - Intergenic
1129893783 15:79089485-79089507 CGGCGGCGGCGGCGGCGCAGGGG + Intronic
1130305402 15:82709652-82709674 GGGCGGCTCCGCTGGCCCCGGGG - Exonic
1130348052 15:83067065-83067087 GGGCGGCGGCGGCGGCCCCGCGG + Exonic
1130352998 15:83107785-83107807 GCGCGGCGGGGGTCGCGCCGAGG + Intronic
1130362959 15:83207681-83207703 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1130564426 15:84981697-84981719 CGGCGGCGGCGGCGGGAGCGGGG + Intronic
1131144431 15:90002021-90002043 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1131367664 15:91853715-91853737 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1131367719 15:91853881-91853903 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1131827015 15:96330404-96330426 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1132286802 15:100669387-100669409 GGGCGGCTGCTGGAGCACCGAGG + Intergenic
1132523399 16:401773-401795 GGGCGGGGGCGGGGCCTCCGGGG + Intronic
1132558696 16:583858-583880 GGGAGGGGGCCGTGGCACTGAGG + Exonic
1132580088 16:680706-680728 GGGCGGCGGCGGTGGCACCGGGG + Intronic
1132588173 16:715201-715223 GGGCGGCGGCGGGAGCAGCCGGG - Exonic
1132810131 16:1793387-1793409 GGGCGCTGGCGGCGGCACAGGGG - Intronic
1132839488 16:1972146-1972168 GAGCGGCGGCGGCGGCAACATGG + Exonic
1132845653 16:1999728-1999750 GGGCGGGGGCTGTGGCAATGTGG + Exonic
1132887781 16:2190023-2190045 GGGCAGGGGCGGGGGCAGCGAGG - Intronic
1133049123 16:3106667-3106689 GGGCGGGGGCGGGGCCACTGAGG + Intergenic
1133156571 16:3880476-3880498 CGGCGGCGGCGGCGGAACGGGGG - Exonic
1133212873 16:4272868-4272890 TGGCGGCGGCGGCGGCGGCGAGG + Exonic
1133268571 16:4599528-4599550 GGGCACCGGGGATGGCACCGGGG - Intronic
1133784357 16:8963367-8963389 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1133802027 16:9092003-9092025 ACGCGGCGGCGGTGGCGGCGAGG + Exonic
1134143578 16:11742646-11742668 AGGGGGCGGCGGCGGCCCCGCGG - Exonic
1134527789 16:14957760-14957782 GGGAGGCGGCGGCGGCGCAGGGG - Intergenic
1135821870 16:25692319-25692341 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1135822009 16:25692804-25692826 GAGCGGCGGCGGAGGCGCCCAGG + Exonic
1136110894 16:28063205-28063227 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1136129680 16:28211854-28211876 GGGCGGCGGCAGTGGCCGTGTGG - Exonic
1136226987 16:28866141-28866163 GGGCGGGGGTGGGGGCAGCGGGG - Exonic
1136364874 16:29805403-29805425 GGGCTGCGGGGGCGGGACCGGGG + Intergenic
1136408520 16:30063738-30063760 GGGCAGCAGCGGGGGCAGCGAGG - Exonic
1136419535 16:30123186-30123208 TGGCGGCGGCGGCGGCTCAGGGG - Exonic
1136453962 16:30370109-30370131 GGGCGGCGGCGAGGGGGCCGCGG + Exonic
1136498834 16:30659685-30659707 GGGCGGCGGCGGCGACGACGAGG - Exonic
1136511007 16:30738333-30738355 CGGCGGCGGCGGCAGCAGCGGGG + Exonic
1137268054 16:46884723-46884745 GGGCGGCGGCGCTGGTCCGGCGG + Exonic
1137334500 16:47534046-47534068 GGGCGGCTGCAGTGGCATCTGGG + Intronic
1137522353 16:49205217-49205239 GGGAGGCGGAGGTTGCACTGAGG + Intergenic
1137655259 16:50153560-50153582 CGGCGGCGGCGGCGGCCCTGCGG + Intronic
1138105629 16:54285960-54285982 TGGCGGCAGCGGCGGCAGCGCGG - Exonic
1138179320 16:54931408-54931430 CGGCGGCGGCGGCGGCCGCGGGG - Exonic
1138247625 16:55479279-55479301 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1138619100 16:58197772-58197794 GGGTGGCGGCGGCGGCGCGGCGG + Exonic
1138635588 16:58335410-58335432 GGGAGGCGGCGGTTGCAGTGAGG + Intronic
1138651593 16:58464126-58464148 GGGTGGGTGCGGTGACACCGTGG - Exonic
1139390601 16:66604781-66604803 CGGCGGCGGCGGTAGGGCCGGGG - Exonic
1139446311 16:67000802-67000824 GGTGGGCGGCGGTGGGACCGCGG - Intronic
1139451188 16:67029194-67029216 CGGCGGCGGCGGCGGCGGCGTGG + Intronic
1139647050 16:68338926-68338948 GGGCAGCTGAGGGGGCACCGTGG + Intronic
1140927579 16:79599191-79599213 CGGCGGCGGCGGAGGCGGCGGGG - Exonic
1141608579 16:85169249-85169271 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1141665292 16:85462677-85462699 GGAGGGCGGCGGGGGCGCCGCGG + Intergenic
1141700432 16:85639734-85639756 GGGCGGCGGTGGAGGCTCCACGG - Intronic
1141831164 16:86510608-86510630 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1141831313 16:86511244-86511266 GGGCGGCTGCGGCGGCGCGGCGG + Exonic
1142054569 16:87985023-87985045 GGACGGCAGCGGGGGCGCCGGGG + Intronic
1142173821 16:88635844-88635866 GGGCGGCGGCAGTGGGGCAGGGG - Intergenic
1142336096 16:89490350-89490372 AGGCGGCGGCGGCGGCGGCGCGG + Exonic
1142379022 16:89721429-89721451 GAGCGGGGGCGCTGGCACCGCGG + Intronic
1142395346 16:89828562-89828584 GGGCAGCTGCGGCGGCGCCGCGG + Exonic
1142631441 17:1229008-1229030 GGGGGGCGGCGGCCGCAGCGGGG - Intronic
1142631582 17:1229414-1229436 GGGCGGCGGCGGAGACTCCGGGG - Intergenic
1142638096 17:1270321-1270343 GGTCGGCGGGGGAGGAACCGAGG - Intergenic
1142755856 17:2015964-2015986 GGGCGGCCAGGGTGGCACCGAGG + Intronic
1142764295 17:2056974-2056996 CGGCCGCGGCCGTGGCCCCGGGG + Exonic
1142836798 17:2593599-2593621 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1143021987 17:3921624-3921646 GGGCGGGGGTGGAGGCAGCGTGG + Intergenic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1143223654 17:5282376-5282398 GGGCGGCGGCGGCGGCGGCTCGG + Exonic
1143527220 17:7479595-7479617 CGGCGGCGGCGGCGGCAGCGGGG - Intronic
1143527257 17:7479684-7479706 CGGCGGCGGCGGCGGCGCTGGGG - Intronic
1143590877 17:7885306-7885328 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1143830300 17:9645678-9645700 GAGCGGCGGCGGCGGGGCCGGGG - Exonic
1143901948 17:10181072-10181094 GGGTGGCGGTGGGGGCACGGTGG + Intronic
1144021030 17:11240630-11240652 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1144021161 17:11241057-11241079 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1144109808 17:12020904-12020926 GAGCGGCGGCGGCGGCTCCGGGG + Exonic
1144185134 17:12789721-12789743 GGGCGACGGCGGCGGCACTGCGG - Exonic
1144781215 17:17809586-17809608 GGACGGCGGCGGGGGCTCCTGGG - Intronic
1144910054 17:18673029-18673051 CGGCGGCGGCGGCGGCGCCCGGG - Exonic
1144971285 17:19111263-19111285 CGGCGGTGGCGGCGGCTCCGCGG + Intergenic
1144991590 17:19237434-19237456 CGGCGGTGGCGGCGGCTCCGCGG + Exonic
1145694205 17:26774511-26774533 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1146132634 17:30291961-30291983 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1146339604 17:32007668-32007690 CGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1146356923 17:32142450-32142472 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1146371097 17:32266015-32266037 CGGCGGCGGCGCGGGGACCGGGG + Intergenic
1146398559 17:32487001-32487023 CGGCGGCGGCGGCGGCAGCTAGG - Exonic
1146716202 17:35089076-35089098 AGGCGGCGGCGGCGGCGCTGGGG - Intronic
1146896592 17:36545664-36545686 CGGCGGCGGCGGCGGCAGCTGGG + Exonic
1147121033 17:38335194-38335216 GGGCGGCTGCTGCGGCACCTGGG - Exonic
1147162973 17:38578693-38578715 CGGGGGCGGCGGGGGCAGCGGGG - Exonic
1147393417 17:40123095-40123117 GGTCCGAGGCGGTGGCAGCGGGG - Intronic
1147431101 17:40371334-40371356 GGGCTGTGGCGGGGGCAGCGAGG - Intergenic
1147476976 17:40721593-40721615 GGGAGGTGGTGGTGGCAACGGGG - Intergenic
1147486364 17:40818905-40818927 CGGCGGCGGCGGCGGCTACGGGG - Exonic
1147909586 17:43847404-43847426 GGGAGGTGGGGGTGGCGCCGGGG + Intronic
1147994707 17:44354407-44354429 GGGCGGCGGGGGCGGCGGCGAGG - Exonic
1148551068 17:48551101-48551123 GGGCGGTGGCGGCGGCGGCGGGG - Exonic
1148555834 17:48578059-48578081 GGGCGGTGGCGGGGGCGGCGGGG + Exonic
1148804914 17:50259173-50259195 GGGGGGCGGCGGGGGCTCAGGGG + Intergenic
1149614754 17:57988310-57988332 GGGCGGCGGCGGCCGGGCCGGGG - Intergenic
1149858097 17:60102715-60102737 GGCCGGCGGCGGCGGCAAAGGGG + Intergenic
1150060586 17:62065372-62065394 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1150239982 17:63623023-63623045 GGGAAGCGGCGGCGGGACCGAGG + Intronic
1150250090 17:63700230-63700252 GGGGGTCGGCGGCGGCGCCGGGG - Intronic
1150407976 17:64919169-64919191 GGGCGGCGGCGGCGGCGGCGGGG + Intronic
1150407979 17:64919175-64919197 CGGCGGCGGCGGCGGGGCCGGGG + Intronic
1150747244 17:67825792-67825814 CGGCGGCGGCGGTGGCGGCGGGG - Exonic
1150791890 17:68205754-68205776 CGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1150950784 17:69800993-69801015 GGGTGGCTGCAGTGGCACCTGGG - Intergenic
1151224867 17:72640576-72640598 GGGCGCCGGGCGTGGCGCCGGGG - Intergenic
1151565084 17:74893278-74893300 GTGCGGCGGAGGTGGCGGCGCGG - Intronic
1151716898 17:75835604-75835626 GGGCGGCTGCAGGGGCACAGGGG - Intronic
1151780146 17:76240269-76240291 GGAGGGCGGCGCGGGCACCGGGG - Exonic
1152049232 17:77959232-77959254 CGGCGGCGGCGGCGGCTCCGCGG - Intergenic
1152241657 17:79164219-79164241 GGGCGGTGGCGGTAGCGCCTGGG + Intronic
1152345437 17:79748177-79748199 GGGCGGCGGGGGTCGCACCCGGG + Intergenic
1152637301 17:81435390-81435412 GGGCAGTGGGGGTCGCACCGAGG - Intronic
1152729025 17:81960944-81960966 AGGCGGCGGCGGCGGCGGCGGGG + Exonic
1152732146 17:81977658-81977680 GGCAGGCGGCGGAGGCTCCGCGG + Exonic
1152814482 17:82399349-82399371 GGGCAGCGAGGCTGGCACCGGGG - Intronic
1153514450 18:5891253-5891275 CGGGGGCTGCGGTGGCTCCGGGG - Exonic
1153935222 18:9914594-9914616 TGGCGGCGGCGGCGGCGCCAGGG - Intronic
1154172570 18:12061928-12061950 GGGCTGCGGCGGTGGCCAGGTGG + Intergenic
1154174488 18:12076537-12076559 CGGCGGCGGCGGCGGCGCCGCGG - Intergenic
1154202335 18:12308187-12308209 GGGCGGGGGCGGGGGCGCGGAGG + Exonic
1155007466 18:21741415-21741437 GGGCGGCGGCGCGGTCCCCGCGG - Exonic
1155120847 18:22816941-22816963 GGGCAGGGGCAGCGGCACCGAGG + Intronic
1155971938 18:32091816-32091838 GGGAGGCGCAGGTGTCACCGCGG + Intergenic
1157376983 18:47176137-47176159 GGGCGGCGGCGGAGTCCCCGGGG - Intronic
1157383938 18:47247081-47247103 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1157473706 18:48008368-48008390 GGGCGGGGGAGGTGGCCCGGGGG - Intergenic
1157578427 18:48759164-48759186 GGTCGGGGGTGGTGGCACTGGGG - Intronic
1158259108 18:55588155-55588177 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1158436001 18:57435842-57435864 GGGCGGCGGCGGGGGCGGCGGGG + Exonic
1158436007 18:57435854-57435876 GGGCGGCGGGGGCGGCGGCGGGG + Exonic
1158954139 18:62523552-62523574 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1158954193 18:62523670-62523692 GGGCGGCGGCGGGGGGCCCTCGG + Exonic
1159040576 18:63320037-63320059 CAGCGGCGGCGGCGGCAGCGCGG + Exonic
1159186574 18:64983600-64983622 GGGCGGCTGCAGCGGCACCTTGG - Intergenic
1159798237 18:72868237-72868259 GGGCCGCGGCGGCGGCAGCAAGG + Intergenic
1160025389 18:75211660-75211682 AGGCGGCGGCGGCGGCCGCGCGG - Intronic
1160450771 18:78964984-78965006 GGGAGCCGTCGGTGGCACCCAGG + Intergenic
1160453596 18:78980668-78980690 GCGCGGCGGCGGAGGCACCGTGG - Intronic
1160603720 18:80033815-80033837 GGGCGGGGGGGGCGGCAACGGGG - Intronic
1160706217 19:531497-531519 GGGCGACGGCGGCGGCCTCGGGG + Intergenic
1160706308 19:531787-531809 GGGCGGCGGCGGCGGCGCAGAGG + Exonic
1160790349 19:920139-920161 GGGCGGGCGGGGAGGCACCGTGG + Intronic
1160794973 19:941044-941066 CCGCGGCGGCGGTGACCCCGCGG - Intronic
1160831073 19:1105082-1105104 GGTCGGTGGCGGGGACACCGAGG - Intronic
1160853546 19:1206044-1206066 GCGCGGCGGCGGGGGCTCCACGG - Intronic
1160878791 19:1310309-1310331 GGGGGGCAGCGGGGGAACCGCGG + Intergenic
1160891493 19:1380972-1380994 GGGCGGCTGCTGTGGCTCCTGGG - Intergenic
1160904715 19:1446676-1446698 GGGCGGCGGGGGCGGCTGCGGGG + Intronic
1160910009 19:1469943-1469965 GGCCGCCGGCGGGGGCCCCGGGG - Exonic
1160930588 19:1567995-1568017 GGGCGGCGGCGGCGGCGGCGTGG - Exonic
1160967703 19:1753839-1753861 CGGCGGCGGTGGGGGCGCCGGGG + Exonic
1160967821 19:1754300-1754322 TGGCGGCGGCGGGGGCTGCGGGG - Exonic
1160975092 19:1789233-1789255 TGGAGGCGGCGGTGGGACTGGGG - Intronic
1160982746 19:1823741-1823763 GGGCCGGGCCGGGGGCACCGCGG + Exonic
1160991838 19:1863312-1863334 GGGCGGCGGGGGTGGCCCCGGGG + Exonic
1161029495 19:2051118-2051140 GTGGGGCGGCGGCGGCACTGCGG - Exonic
1161057930 19:2199990-2200012 GGGCGGTGGCCATGGCACCGGGG + Intronic
1161069657 19:2253726-2253748 GGGCGGCGGCGGCGGCTGCAGGG + Exonic
1161333825 19:3700430-3700452 CGGCGGCGGCGGTCGCAGCTCGG - Exonic
1161337520 19:3722381-3722403 GGGCGCCCGCGGTGGCACGGTGG + Intronic
1161384826 19:3985326-3985348 GAGCGGCGGCGGGGCCTCCGCGG - Intronic
1161450703 19:4343856-4343878 AGGCGGCGGCGGCGGGGCCGGGG + Exonic
1161477444 19:4494343-4494365 GGGCAGCGGCGGCAGCAGCGGGG + Exonic
1161487631 19:4544245-4544267 AGGCGGTGGCGGTGGCGCCGGGG - Exonic
1161607374 19:5222496-5222518 GGGGGGCGGTGGTGCCACCGAGG + Intronic
1161698649 19:5783683-5783705 GGGGGGTGGGGGTGGCAGCGGGG + Exonic
1161806478 19:6446288-6446310 GGGAGGCGGAGGTTGCAGCGAGG + Intronic
1162019603 19:7862650-7862672 GGGCGGGGGCGGGAGGACCGCGG - Intronic
1162021362 19:7869926-7869948 GGGCGGCGGCGGCGGGCCGGGGG + Exonic
1162027709 19:7903919-7903941 GCGCGGCGGCGGTGGCGGCGGGG + Exonic
1162372932 19:10289868-10289890 GGGCGGCGGCAGAGGCGGCGGGG - Intergenic
1162374461 19:10296502-10296524 GGGCGGCGGCGCTGGCGGGGCGG + Exonic
1162412283 19:10513847-10513869 GGGCGGCTGTGGGTGCACCGGGG + Exonic
1162535837 19:11262472-11262494 CGGCGGCGGCGGCGGGGCCGGGG - Intronic
1162535840 19:11262478-11262500 GGGAGGCGGCGGCGGCGGCGGGG - Intronic
1162752683 19:12838505-12838527 AGGCGGCGGCGGCGGCGGCGCGG - Intronic
1162914075 19:13865181-13865203 GGGAGGGGGCGGCGGCAGCGGGG + Intronic
1162929879 19:13952554-13952576 GAGCGGCGGCGGCGGCCCCGGGG + Exonic
1162954500 19:14090779-14090801 GTGCGGCGGCGGCGGCGGCGGGG - Intronic
1163154497 19:15432543-15432565 GGGCGGCGGCGGCGGCGCGGGGG + Intronic
1163156515 19:15442692-15442714 GGGTGGCGGAGGTGACACGGGGG + Intronic
1163282312 19:16325322-16325344 GGGCGGCGGCGGCGGCTCCGGGG - Exonic
1163442457 19:17328770-17328792 GGGCGGGGGCGGCGGCAGCGGGG - Exonic
1163508030 19:17719707-17719729 CGGCGGCGGCGGCGGGACCCGGG + Intronic
1163577283 19:18118135-18118157 GGGCGGCTGCGGCGGCACAAAGG + Intronic
1163606933 19:18280860-18280882 GGGCGGCGCCGGGGGCGCGGGGG - Exonic
1163696843 19:18768552-18768574 GGGCTGCGGCGGTGGCTGCTGGG - Exonic
1163782682 19:19258598-19258620 GGGCGGCGGTGATGCCAACGGGG - Exonic
1164937346 19:32224565-32224587 GGGCGGCGGCGGGGCAACTGCGG + Intergenic
1165065722 19:33226811-33226833 GGGCCGCGTCGGGGCCACCGGGG + Intergenic
1165242805 19:34481548-34481570 GGCGGGCGGCGGAGGCACCGCGG - Intergenic
1165392269 19:35545517-35545539 GGCCGGCAGCGGTGGGACCCAGG + Intergenic
1165493913 19:36141038-36141060 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1165721463 19:38082321-38082343 GGGCGGCGGCGGAGCCAAGGGGG + Exonic
1165738802 19:38193734-38193756 CGGCGGCAGGGGTGGCACCGGGG - Exonic
1165848073 19:38831761-38831783 AGGCGGCGGCGATGGCGGCGGGG - Exonic
1165854188 19:38870112-38870134 GGGCGGGGGCGGGGCCTCCGGGG - Exonic
1166100858 19:40570632-40570654 GGGCGGTGGCGGAGGCGCGGGGG - Exonic
1166304253 19:41928592-41928614 AGGCGGCGGCGGCGGCGCGGGGG + Intronic
1166367303 19:42284195-42284217 GGGCGGCGGCGCCGGCAGCCGGG + Intronic
1166375315 19:42324306-42324328 TGGCGGCGGCGGTGGCCCCGAGG + Intronic
1166546994 19:43639787-43639809 CGGCGGCGGCGGCGGCACCATGG - Exonic
1166682616 19:44778123-44778145 GGCCGGCGGAGGCGGCCCCGGGG + Exonic
1167013029 19:46821573-46821595 GGGCGGCTGCAGTGGCATCTGGG - Intergenic
1167019227 19:46861446-46861468 GGGCGGCGGCGGGGACAGCAGGG - Intergenic
1167048741 19:47066562-47066584 GGGTGGCGGTGGTGGCAGCGGGG + Exonic
1167072353 19:47228281-47228303 GGGCGGCGGGGGCGGCAGCCAGG + Exonic
1167115030 19:47484131-47484153 GGGAGGCGGCCGTGGCCGCGGGG - Exonic
1167145538 19:47679434-47679456 GGGCGGCGGCGGGGGCAGTGGGG + Exonic
1167145584 19:47679613-47679635 GGGCAGCGGCCGTGGCTGCGGGG + Exonic
1167258155 19:48443154-48443176 GGGCGGCGCGGGGGGCACGGGGG + Exonic
1167262958 19:48469389-48469411 AGGAGGCGGCGGTGGCTCCCGGG + Exonic
1167299402 19:48670448-48670470 TGGTGGCGGCAGTGGCAGCGGGG + Exonic
1167350204 19:48969561-48969583 CGAGGGCGACGGTGGCACCGAGG + Exonic
1167466268 19:49652374-49652396 GGGCGGCGGGGCGGGCGCCGGGG - Exonic
1167557470 19:50205297-50205319 CGGCGGCGGCGGCGGCGCCAGGG - Intronic
1167605780 19:50480726-50480748 GGGCGGCTGCAGCTGCACCGAGG - Exonic
1167643206 19:50693274-50693296 GGGTGGCGGCTGGAGCACCGAGG - Intronic
1167643702 19:50695085-50695107 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1167797546 19:51719647-51719669 GGGTGGCGGCGGCGGCGCGGGGG - Exonic
1168076326 19:53982549-53982571 CGGCGGCGGCGGCGGCGCCGTGG + Exonic
1168151046 19:54449029-54449051 GGGTGGGGACGGTGGCCCCGAGG - Exonic
1168247004 19:55117487-55117509 GGGCGGCGGCGGCGGCTGCCCGG - Exonic
1168276075 19:55279512-55279534 GGGCGGCGGCGGCGGCTCCTCGG - Exonic
1168315198 19:55482002-55482024 GGGCGGGGGCGGGGGCGGCGGGG - Exonic
1168325432 19:55536495-55536517 GGGTGGCGGCGGCGGCACGCGGG - Intronic
1202710758 1_KI270714v1_random:18307-18329 GGGCGGCGGCTGCGGCACAGGGG + Intergenic
925377638 2:3399802-3399824 GGGCGGTGGCGGGGGGAGCGGGG - Intronic
925406888 2:3611688-3611710 GGGCTGGGGCTGTGGCACGGGGG + Intronic
925609792 2:5693150-5693172 CGGCGGCGGCGGCGGGAGCGCGG + Exonic
925922591 2:8647328-8647350 GGGTGGCTGCAGTGGCACCTGGG - Intergenic
925928181 2:8685383-8685405 GGGCGGGGGCCGTGGAGCCGCGG + Intergenic
925991464 2:9258551-9258573 GTGTGGCGGCGGGGGCACCATGG - Intronic
926090026 2:10043615-10043637 CGGCGGCGGCGGCGGCAACCCGG - Exonic
926422954 2:12716888-12716910 GGGGGGGGGCGGAGGCTCCGTGG + Exonic
927472215 2:23385242-23385264 GGACGGCGGCGGCGGCGCGGGGG - Exonic
927652345 2:24920203-24920225 GCGCGGCGCCGGCGGCTCCGGGG + Intergenic
928303503 2:30147241-30147263 GGGCCCCGGCGCTGGGACCGCGG + Intronic
928303685 2:30147842-30147864 CGGCGGCGGCGGTGGCGGCGGGG - Intronic
929218116 2:39437111-39437133 CGGCGGCGGCGGCCGCAGCGTGG - Exonic
929604187 2:43224565-43224587 GGGCGGCGCCGGCGGCTGCGCGG + Exonic
929778359 2:44942296-44942318 CGGCGGCGGCGGCGGCTCCAGGG + Exonic
929966913 2:46542993-46543015 GGGCCGGGGCGGGGGCTCCGGGG + Exonic
930358216 2:50346865-50346887 CGGCGGCGGCGGCGGCGCAGGGG - Intronic
931106961 2:59067028-59067050 GGCCGGCGCCGCTGGCCCCGGGG + Intergenic
931253509 2:60552425-60552447 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
931517832 2:63059941-63059963 GGGCAGCGGCGGCGGGAACGCGG + Intergenic
931728043 2:65129948-65129970 GGGCGGCGGCTGCGGCAGCAAGG - Exonic
933279957 2:80322562-80322584 GCGCGGCGGCGGAGGCCGCGGGG + Intronic
933666856 2:84971277-84971299 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
933684717 2:85133711-85133733 CGGCGGCGGCGGCGGCAGCGGGG + Exonic
933772774 2:85754554-85754576 AGGCGGCGGCGGCGGCGGCGTGG - Exonic
934248189 2:90324702-90324724 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248362 2:90325312-90325334 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248373 2:90325350-90325372 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248405 2:90325467-90325489 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934261189 2:91478099-91478121 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
934296816 2:91749019-91749041 GGGCCGCGGCGGCGGCGGCGAGG - Intergenic
934566976 2:95346595-95346617 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
934781053 2:96969947-96969969 GGGCGGGGGCGATGCCACCCTGG - Intronic
934954789 2:98608526-98608548 GGGCCGCGGCGGTAGGGCCGAGG + Intergenic
935196265 2:100818879-100818901 GGGCGGCGGCGTTCACAGCGGGG - Intergenic
935301591 2:101697834-101697856 GGGCGGCGGCGCTCACACCATGG - Intronic
935592444 2:104855295-104855317 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
935592558 2:104855612-104855634 TGGCGGCGGCGGCGGCGGCGGGG + Exonic
935592610 2:104855816-104855838 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
935592737 2:104856230-104856252 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
935592783 2:104856392-104856414 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
936122700 2:109760441-109760463 GGGCGGCGGCGGCGGCGGCGCGG + Intergenic
936126703 2:109794590-109794612 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
936221993 2:110611032-110611054 GGGCGGTGGCGGCGGCGGCGCGG - Intergenic
936939640 2:117871067-117871089 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
937111139 2:119367690-119367712 GGGCTCCGGCGCTGACACCGCGG + Intronic
938081536 2:128372973-128372995 GGGACCCTGCGGTGGCACCGCGG + Intergenic
938397908 2:130964167-130964189 TGGCGGCCGCGGAGGCAACGGGG + Intronic
938455670 2:131460945-131460967 GGGCCGGGGCGGGGGCTCCGGGG + Intergenic
938460233 2:131492096-131492118 GGACGGGGGCGGGGGCAGCGGGG + Intronic
939153799 2:138501739-138501761 CGGCGGCGGCGGCGGCTCCTGGG - Intergenic
939629759 2:144517166-144517188 CGGCGGCGGCGGCGGCGCCCAGG - Intronic
940830035 2:158456928-158456950 GGGCGGCGGCGGCGGCCTCTGGG + Intergenic
940971970 2:159904793-159904815 GGGCGGCGGGGGCGGGGCCGGGG - Intergenic
941951452 2:171160697-171160719 GCGCGGCGGCGGAGGCGTCGAGG + Exonic
942278053 2:174336793-174336815 CGGCGGCGGCGGAGGAGCCGAGG - Exonic
942346219 2:175005266-175005288 CGGCGGCGGCGGCGGCGACGGGG + Intronic
942446143 2:176080247-176080269 CGGCGGCGGCGGGGGCGCCGGGG - Exonic
942450900 2:176107586-176107608 CGGCGGCGGCGGCGGCAGCGCGG + Exonic
942458177 2:176151929-176151951 GGGCGCCGGCGGAGGCGCCGGGG - Exonic
942797909 2:179842988-179843010 GGGTGGGGGCGGTGACACCTAGG - Intronic
943526170 2:189020445-189020467 GGGCAGCTGCAGTGGCACCTGGG - Intergenic
944383692 2:199141248-199141270 GGGCGACTGCAGTGGCACCCAGG - Intergenic
944632761 2:201643422-201643444 GGCCGCCGGCGGTTGCGCCGGGG - Exonic
945033022 2:205682632-205682654 GTGCGGCGGCGGTGGCGGCTGGG - Exonic
945225869 2:207530472-207530494 CGGCGGCGGCGGCGGGAACGCGG - Intronic
945241550 2:207681450-207681472 GGGCGGCGGCGGGGGCACCCGGG - Intergenic
946019842 2:216633546-216633568 CGGCGGCGGCAGCGGCAGCGCGG - Exonic
946197562 2:218044160-218044182 GGGCAGCTGCTGTGGCACCCAGG + Intronic
946325287 2:218981765-218981787 CGGCGGCAGCGGTGGCGGCGGGG + Exonic
946692418 2:222319502-222319524 GGGCGGCGGTGGCGGGGCCGGGG + Intergenic
946692489 2:222319771-222319793 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
947743701 2:232496910-232496932 GGGCGGGTGAGGTGGCCCCGTGG - Intergenic
948046854 2:234951937-234951959 GGGCGGGGGCGGGGGCGCGGGGG - Intergenic
948255870 2:236567777-236567799 GGGCGAGGGCGGTGACCCCGGGG + Intronic
948449635 2:238061056-238061078 TGGAGGCGGCCGTGGCGCCGGGG + Exonic
948476211 2:238221422-238221444 GGGCAGCTGCAGCGGCACCGGGG + Intergenic
948487238 2:238288710-238288732 GGGCGGCGGCGGCGGGCGCGGGG - Intronic
948645369 2:239400852-239400874 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
948825914 2:240573401-240573423 GGGCCCTGGCGGTGGCACCAAGG - Intronic
948985680 2:241521549-241521571 GTGGGGCGTGGGTGGCACCGTGG - Intergenic
949028405 2:241776886-241776908 GGGCCGAGGCGGTGGGACCTCGG + Exonic
1168795882 20:610033-610055 CGGCGGCGGCGCGGGCCCCGTGG - Exonic
1168883566 20:1226624-1226646 GGGTGGCGGCGGTGGCGGGGAGG - Intronic
1169065595 20:2692870-2692892 GGGCGGCGGCGGCCGCGGCGGGG + Exonic
1169207791 20:3749769-3749791 CGACTGCGGCGGAGGCACCGTGG + Exonic
1169278453 20:4248786-4248808 GGGCGGCGGCGGCGGCGTGGTGG - Exonic
1169278484 20:4248861-4248883 GGGCGGCGGCGGGGGCAGCGCGG - Exonic
1169557618 20:6767679-6767701 CGACGGCGGCGGCGGCGCCGTGG - Exonic
1169863051 20:10172240-10172262 GGGGGGCGGGGGGGGCACCCAGG + Intergenic
1170150501 20:13221712-13221734 CGGCGGCGGCGGTGACGCCGGGG - Intergenic
1170163956 20:13343575-13343597 GGGCGGGGGCGGGGGCGGCGGGG - Intergenic
1170570529 20:17629796-17629818 GGGCGGCGGCAGTGGGGCCGGGG - Intronic
1170924745 20:20712594-20712616 CGGCGGCGGCGGCAGCAGCGGGG - Intergenic
1171309530 20:24135178-24135200 GTGCGGAGGTGGTGGCGCCGGGG + Intergenic
1172037311 20:32019127-32019149 GGGAGGCGGCGGCGGCAGCTTGG + Exonic
1172037337 20:32019235-32019257 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1172073657 20:32277705-32277727 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG + Intronic
1172474532 20:35226890-35226912 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1173734274 20:45348372-45348394 GGGCGGGGGCCATGGCACCGCGG + Exonic
1174386697 20:50191612-50191634 GGGCGGCGGCGCAGGCATGGCGG + Exonic
1175429121 20:58890300-58890322 GGGCGCCGTCGGGGGCGCCGAGG + Intronic
1175429534 20:58891705-58891727 TGGCGGCGGCGGCGGCGGCGGGG - Intronic
1176068922 20:63216016-63216038 GGGCGGCGGCGGCGGCTGCTGGG + Exonic
1176131680 20:63499021-63499043 GGGCGGGGGCGGAGGCCCGGGGG + Intronic
1176548360 21:8211521-8211543 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176556251 21:8255724-8255746 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176567291 21:8394556-8394578 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176575190 21:8438766-8438788 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176576572 21:8443299-8443321 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1177834080 21:26170687-26170709 AGACGGCGGCGGTGGCGGCGCGG - Intronic
1178314453 21:31557686-31557708 GGGCCGCGCGGGTGTCACCGAGG + Intronic
1178487404 21:33027681-33027703 GGGCGGGGGCGGCGGCAGTGGGG + Exonic
1178518476 21:33267586-33267608 GGGAGGCGGAGGTGGCAGTGAGG - Intronic
1178534893 21:33403324-33403346 GCGCGGGGGCGGTGGCCTCGGGG + Exonic
1179213661 21:39348851-39348873 GGGCGCCGGCGGCGGCTCCAGGG + Intronic
1179561585 21:42219221-42219243 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1179951587 21:44711604-44711626 GGGCGGCCGCGGGGCCCCCGGGG + Intergenic
1180095858 21:45555154-45555176 GGGCGGCGGGGGCGGCGCAGGGG + Intergenic
1180095873 21:45555187-45555209 GGGCGGCGGGGGCGGCGCAGGGG + Intergenic
1180183088 21:46126643-46126665 GGGGGGCGGCGGAGCCACTGCGG + Intronic
1180908353 22:19431536-19431558 AAGCGGCGGCGGTGGCTCCATGG - Exonic
1180949414 22:19714469-19714491 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1180949415 22:19714472-19714494 CGGCGGCGGCGGCGGCGCGGAGG + Exonic
1180960629 22:19760819-19760841 GGGCGGCGGCGGCGGCCCGCGGG + Intronic
1180960687 22:19761049-19761071 CGGCGGCGGCGGCGGGCCCGGGG - Exonic
1181478026 22:23180576-23180598 CGGCGGCGGCGGCGGCACGGCGG + Exonic
1181571029 22:23767874-23767896 TGGTGGCGGCGGTGGGACCCGGG + Exonic
1181690183 22:24554965-24554987 GGACGGAGGCGGAGGCAGCGGGG - Intronic
1182296254 22:29312399-29312421 GAGGGGCGGCGGGGGCCCCGAGG - Exonic
1182355360 22:29720295-29720317 GGGCGGCGGCGGCAGCGGCGAGG - Exonic
1182550970 22:31100547-31100569 GGGCGATGGCGTTGGCACCAAGG - Intronic
1182576471 22:31276565-31276587 GGGCGGCGGCGGGGGCGCCCGGG - Intronic
1182604025 22:31489666-31489688 GGTCGGCGGCGGTGGCGGCTGGG - Intronic
1183247220 22:36703249-36703271 CGGCGGCGGCGGCGGCAGGGCGG + Exonic
1183427210 22:37746315-37746337 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1183517106 22:38272965-38272987 CGGCGGCGGCGGAGACTCCGGGG - Exonic
1183702322 22:39457502-39457524 CAGCGGCGGCGGCGGCTCCGCGG - Exonic
1183743165 22:39679388-39679410 GGGCGGCGGGGGCGACACCGAGG + Exonic
1184173770 22:42774618-42774640 GGGTGGCTGCAGTGGCACCCAGG - Intergenic
1184412128 22:44331587-44331609 CGGCGGCGGCAGGGGCATCGCGG - Intergenic
1184465901 22:44668784-44668806 CGGCGGCGGCGCGGGGACCGAGG + Intronic
1184680919 22:46071728-46071750 GGGCGGGGACGGCGGCGCCGCGG + Intronic
1184759601 22:46537150-46537172 GGGCGGCGGCGGCGGCGCCATGG + Exonic
1184767031 22:46577395-46577417 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1185278573 22:49960446-49960468 GGGTGGCGGCCGTGGCGCCTCGG - Intergenic
1185296700 22:50058282-50058304 GTGCAGCGGCGGCGGCCCCGGGG + Intergenic
1185409435 22:50674426-50674448 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1185421030 22:50734510-50734532 GGGTGGGGCCGGTGGCACCGTGG + Intergenic
1203253239 22_KI270733v1_random:127821-127843 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203254622 22_KI270733v1_random:132357-132379 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203261294 22_KI270733v1_random:172902-172924 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203262678 22_KI270733v1_random:177436-177458 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
950124958 3:10505321-10505343 TGGTGGTGGCGGTGGCAGCGTGG - Intronic
950215277 3:11154465-11154487 GGGCGGCGGCGGGGGCGCCGGGG - Intronic
950316347 3:12004745-12004767 GGGCTGCGGCGCGGGCGCCGAGG - Exonic
950729789 3:14947615-14947637 CGGCGGCGGCGGCGGCACCGGGG + Intronic
950821880 3:15768654-15768676 GGGGGGCGGCGGTGGGGCAGGGG + Intronic
952382895 3:32818209-32818231 GGGCGGCGGCGGGGGCCCTGGGG + Exonic
952816631 3:37452591-37452613 GGGCCGGGGCGGTGGCCGCGCGG - Intronic
952889166 3:38029552-38029574 GCGCGGCGGGAGGGGCACCGCGG + Intronic
953163669 3:40445208-40445230 GGGCAGCTGCAGTGGCACCTGGG - Intergenic
953909285 3:46883515-46883537 CGGCGGCGGCGGCTGCCCCGAGG + Exonic
953989879 3:47475828-47475850 CGGCGGCGGCGGCGGCGACGGGG + Exonic
954378547 3:50207385-50207407 GGGAGGCGGCGGTTGCAGTGAGG - Intronic
954409678 3:50364999-50365021 GGACGGCGGCGGCGGCACGGAGG + Intronic
954437423 3:50503467-50503489 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
954615556 3:51967347-51967369 CGGCGGCGGCGGCGGCACGGCGG + Exonic
954778965 3:53045629-53045651 GGGCGGCGGCGGCGGCACGTTGG - Intronic
954778999 3:53045747-53045769 GAGGGGCGGCGGCGGCGCCGGGG - Intronic
954795869 3:53161161-53161183 GGGCGGGGCCGGCGGCACCTGGG + Exonic
955060460 3:55488229-55488251 GGGCGGCGGAGGCGGCTCCGTGG + Intronic
955182281 3:56683275-56683297 GGGAGGGGGCGGGGCCACCGCGG + Intergenic
955387606 3:58492053-58492075 CGGCGGCGGCGGCGGCAGAGGGG - Intergenic
955911570 3:63863949-63863971 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
955997027 3:64688045-64688067 GGGCGGAGGCGGGGGGGCCGCGG + Intergenic
956658976 3:71581620-71581642 GGGCAGCGGCAGCGGCGCCGGGG - Intronic
956813594 3:72888202-72888224 CGGCGGCGGCGGCGGCCCCCAGG - Exonic
956818309 3:72929006-72929028 GAGAGGCGGCGGTGGCTGCGCGG - Intronic
957705011 3:83769963-83769985 GGGCGGCTGCGGCAGCACCTGGG - Intergenic
958026891 3:88059269-88059291 CGGCGGCGGCGGCGGCGCAGGGG + Exonic
958108942 3:89114586-89114608 GGACGGAGGCCGTGGCACCCTGG - Intronic
959539870 3:107525243-107525265 GGGCGCCGGCGGTGCCTCCCTGG + Intronic
959591895 3:108090920-108090942 CGGCGGCGGCGGCGACCCCGCGG - Exonic
960634391 3:119768741-119768763 GGGTGGCTGCAGTGGCACCGGGG + Intergenic
960702482 3:120451319-120451341 GGGCTGCGGCGGTGGCCAGGTGG + Intergenic
960937606 3:122913123-122913145 GGGCGGGGGCGGGAGCCCCGGGG - Intronic
961012910 3:123448125-123448147 GGGCGGCGGCGGCGGCTCGGCGG - Exonic
961446407 3:126983564-126983586 GTGCGGCGGGGCTGGGACCGCGG + Intergenic
961688242 3:128650406-128650428 GGGCGGCGGGCGGGGCACAGGGG - Intronic
961703422 3:128765034-128765056 AGGTGGCGGCGGTGGCTGCGCGG + Intronic
961791287 3:129378498-129378520 GGGCAGCTGCAGTGGCACCTGGG + Intergenic
961827168 3:129605283-129605305 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
962277955 3:134030037-134030059 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
962575526 3:136752164-136752186 GGGCGGCGGCGACGGCGGCGGGG - Intronic
963732636 3:148987660-148987682 GGGTGGCGGCGGCGGCATGGCGG - Intergenic
963870192 3:150408301-150408323 CGGCAGCGGCGGCGGCAGCGGGG + Intergenic
965881762 3:173396063-173396085 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
966182246 3:177197690-177197712 GGGAGGCGGCGGCGGCGCGGCGG + Intergenic
966362829 3:179148527-179148549 GGGCGGCGGCGGCGGCGCCGAGG - Exonic
966473964 3:180323002-180323024 AGGCGGCAGCCGTGGCAGCGGGG + Intergenic
966872436 3:184299569-184299591 GGACGGCGGAGGTGACAGCGCGG - Intronic
967858965 3:194137617-194137639 GGGCGGAGGCAGTGGCCACGGGG + Intronic
967924189 3:194633389-194633411 CGGCGGCGGCGAAGGCGCCGGGG + Exonic
968161569 3:196431822-196431844 GGGCCACGGCGATGGCTCCGAGG + Intronic
968353406 3:198080973-198080995 GCCCGGCGGCGGCTGCACCGGGG - Intergenic
968433964 4:575724-575746 GGGCCGCGGCCGGGGCCCCGGGG - Intergenic
968575795 4:1365532-1365554 GGGAGGCGGGGGTGGCACGAGGG + Intronic
968583014 4:1403615-1403637 GGGAGGCGGCGGCGGCCTCGGGG - Exonic
968626300 4:1628089-1628111 GGGCGGGGAGGGTGGCACGGGGG + Intronic
968626479 4:1628521-1628543 GGGCGGGGAGGGTGGCACGGGGG + Intronic
968674734 4:1871421-1871443 CGGCGGCGGCGGGCGCAGCGCGG - Intronic
968689448 4:1983203-1983225 GGGCGGCGGCCGGGGGACCTCGG + Exonic
968698095 4:2042377-2042399 CGGCGGCGGCGGTGACATCGGGG - Exonic
969715743 4:8867406-8867428 GGGGGGTGGCCGTGGCGCCGGGG + Exonic
970333012 4:15003723-15003745 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
970333032 4:15003782-15003804 GGGCAGCGGCGGCGGCGACGCGG - Exonic
970333129 4:15004157-15004179 CGGCGGCGGAGGGGGCACAGCGG - Exonic
971018946 4:22515673-22515695 CGGCGGCGGCGGCGGCGCCGCGG - Exonic
971279798 4:25233913-25233935 CGGCGGCGGCGGCGGCAGCGGGG - Intronic
971336856 4:25730956-25730978 GGGAGGCGGAGGTTGCAGCGAGG + Intergenic
971406031 4:26321258-26321280 GGGCGGCGGCGGCGGCGGCGAGG + Intronic
972128449 4:35800767-35800789 GGGTGGCTGCAGTGGCACCTGGG - Intergenic
972265338 4:37454004-37454026 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
975444377 4:74445353-74445375 CGGCGCCGGCGGTAGCAGCGGGG - Exonic
975778966 4:77819619-77819641 CGGCGGCGGCGGCGGCGACGGGG + Intergenic
975778985 4:77819675-77819697 CGGCGGCGGCGGTGGCGGCGGGG + Intergenic
975985947 4:80202041-80202063 AGGCGGCGGCGTGGGCACCAAGG + Exonic
979785574 4:124712423-124712445 CGGCGGCGGCGGTGGAAGCGAGG - Intronic
982384113 4:154781530-154781552 GGCTGGCGGCGGTGGCTGCGGGG + Intronic
983577006 4:169271016-169271038 GGGAGGCGGCGGCGGCGGCGTGG - Exonic
984668012 4:182448865-182448887 GGGAGGCGGCGGTGGCGGCCCGG + Intronic
984973477 4:185210062-185210084 GGGAGGCGGCGGGGGCCGCGGGG + Intronic
985629985 5:1009165-1009187 CGGCGGCGGCTGCGGCACGGCGG - Exonic
985720014 5:1484042-1484064 GGGCGGCGGGTGGGGCCCCGAGG - Intronic
985782467 5:1878391-1878413 CGGCGGCGGCGGTGGCTGTGTGG + Exonic
986721747 5:10564935-10564957 GGGCGGCGGCTGAGTGACCGAGG - Intronic
986813632 5:11385050-11385072 GCGCGGCGGCGCGGGCAGCGTGG + Exonic
986813662 5:11385167-11385189 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
987050805 5:14144910-14144932 CGGCGGCGGCGGCGGCCTCGGGG + Intronic
987087978 5:14487507-14487529 CGGCGGCGGCGGCGGCAGCGGGG + Exonic
988225188 5:28404410-28404432 GGGTGGCTGCAGTGGCACCTGGG - Intergenic
988564864 5:32312796-32312818 CGGCGGTGGCGGCGGCACCAAGG - Exonic
988796447 5:34656799-34656821 GGGCCGCGGCGGAGGGAGCGCGG + Intronic
988935483 5:36078517-36078539 GGGCAGCTGCAGTGGCACCCAGG + Intergenic
989812570 5:45695868-45695890 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
990955028 5:61332326-61332348 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
992105723 5:73448035-73448057 GGGCGGCGGCGGCGGCGGCGCGG - Exonic
992431597 5:76715993-76716015 GAGCGGCGGCTGAGGGACCGCGG + Intergenic
993726924 5:91380098-91380120 GAGCGGCGGCGGCCGCGCCGTGG + Intronic
994107322 5:95961732-95961754 CGGCGGCGGCGGCGGCACCCCGG - Exonic
994353873 5:98774015-98774037 GGGCGGCGGCGCGGGCGCCGTGG - Exonic
994871887 5:105362239-105362261 GGGCGGTGGTGGTTGCACTGTGG - Intergenic
995530475 5:113087060-113087082 TGGCGGCAGGGCTGGCACCGGGG - Intronic
996978414 5:129461181-129461203 TGGCGGCAGCGGGGGCAGCGCGG + Exonic
998119097 5:139561538-139561560 CGGCGGCGGCGGTGGCGGCTAGG + Exonic
1001065061 5:168529552-168529574 GGGCGGCGGCTGGGGCAGCTGGG + Exonic
1001070308 5:168579568-168579590 CGGCGGTGGCGGCGGCTCCGGGG - Exonic
1001226106 5:169945989-169946011 GGGAGGAGGGGATGGCACCGGGG - Intronic
1002184223 5:177446854-177446876 GGGAGGCGGCGGCGGCCCGGGGG - Exonic
1002591068 5:180291969-180291991 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1002638523 5:180619683-180619705 GGGCAGCAGCTGTGACACCGTGG - Exonic
1002927244 6:1611567-1611589 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1002927247 6:1611570-1611592 CGGCGGCGGCGGCGGCGCGGGGG + Exonic
1002927308 6:1611786-1611808 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1003049439 6:2766129-2766151 GGGCGACGGCGATGGCGACGGGG + Exonic
1003995811 6:11538216-11538238 GGGCGGCGGCGGCGGCTGCGAGG - Intergenic
1004044686 6:12012442-12012464 CGGCGGCGGCGGCGGCGCCTGGG - Exonic
1004216779 6:13711242-13711264 GGGCGGCGGCGGGGGCGGCGGGG + Exonic
1004304333 6:14487038-14487060 GGGTGGCTGCAGTGGCACCTAGG - Intergenic
1005008998 6:21318013-21318035 GGTTGGCGGCGGGGGCACCGTGG + Intergenic
1005225226 6:23634679-23634701 GGGAAGCGGCTGTGGCGCCGTGG - Intergenic
1005267359 6:24126158-24126180 CGGCGGCGGCGGCGGCTGCGCGG + Intronic
1006458503 6:34145004-34145026 GGGCTGCGGCGGGGACATCGGGG - Intronic
1006558564 6:34889504-34889526 CGGCGGCGGCGGTGGCTCTGGGG + Exonic
1006725580 6:36196999-36197021 GAGCGGGGGCGGGGGCATCGGGG + Intronic
1006797581 6:36741474-36741496 GGGCAGAGGCGTGGGCACCGAGG + Exonic
1007387226 6:41528157-41528179 CAGCGGCAGCGGTGGCAGCGAGG + Intergenic
1007643578 6:43363466-43363488 GGGCGGGGGCAGAGGCCCCGGGG + Intronic
1007660282 6:43480585-43480607 GGGAGGCGGCGGTTGCAGTGAGG - Intronic
1007784207 6:44270790-44270812 CGGCGGCGGTGGCGGCCCCGGGG + Exonic
1008387741 6:50913279-50913301 CTGCGGCGGCGGTGGCTGCGTGG + Intergenic
1008629402 6:53348860-53348882 CGGCGGCGGCGGAGGGAGCGCGG + Exonic
1009437591 6:63635917-63635939 GGGCGGCGGCGGCTGCAACGAGG + Exonic
1009905639 6:69867381-69867403 CGGCGGCGGCGGTGGCTGCAGGG - Intronic
1010002017 6:70957251-70957273 GGGAGGCGGCCGCTGCACCGCGG + Intergenic
1010703303 6:79077772-79077794 AGGCGGCGGCGGCGGGGCCGCGG - Intronic
1011042519 6:83046676-83046698 GGGGGTGGGCGGTGGCACCGGGG + Intronic
1011226613 6:85114981-85115003 GGGCGGGGGCGGGGGCGCCGGGG + Intergenic
1013099478 6:106974865-106974887 CGGCGGCGGCGGGGGCGCTGGGG - Intronic
1013273258 6:108561084-108561106 AGGCGGCGGCGGCGGCGCCCGGG + Exonic
1013709522 6:112880361-112880383 GGGCGGCTGCAGTGGCACCCGGG + Intergenic
1013836605 6:114342429-114342451 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1014001236 6:116368926-116368948 GGGCGGGGGCGGGGGGACGGGGG + Intronic
1014137535 6:117907171-117907193 CGGCGGCGGCGGCGGCAGAGCGG - Intergenic
1014137625 6:117907484-117907506 GGGCGGCGGCGGCGGCGGCACGG + Intergenic
1014246896 6:119078799-119078821 CGGCGGCGGCGGCGGCTGCGCGG - Intronic
1014272312 6:119348978-119349000 CGGCGGCGGCGGTGGCAGGAAGG - Exonic
1014289199 6:119539362-119539384 GGGTGGCTGCTGTGGCACCTGGG - Intergenic
1014778160 6:125533950-125533972 GGCCGGCGCCTGTGGCACCTCGG - Intergenic
1015149271 6:130019994-130020016 CGGCGGCGGCGGCCGCGCCGGGG + Intronic
1017103159 6:150865933-150865955 AGGCGGCGGCGGTGGCCGGGAGG + Exonic
1017164162 6:151391559-151391581 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1017671968 6:156777703-156777725 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1018613394 6:165663259-165663281 CGGCGGCGGCGGCGGCGGCGTGG - Intronic
1019298498 7:291162-291184 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1019337901 7:493955-493977 GGGCGGCGGCTGTGGCAGCCCGG - Intergenic
1019474364 7:1236791-1236813 GGGCGGCGGCGGGGACTGCGCGG + Exonic
1019562209 7:1664719-1664741 GGGGCGCGGCGCTGGCAGCGGGG + Intergenic
1019578002 7:1746749-1746771 AGGCGGCGGCGGTGGCCCGGGGG - Exonic
1019711490 7:2520034-2520056 GGGCGGCGGCGGCGGCGCCCGGG + Exonic
1020086419 7:5313096-5313118 GGACGGGGGCTGCGGCACCGGGG - Exonic
1021451050 7:20784418-20784440 CGGCGGCGGCGGCGGCTCGGCGG - Exonic
1021451251 7:20785336-20785358 GGGCAGCGGCGGCGGCGGCGGGG - Exonic
1021668645 7:23013558-23013580 GGGCCGAGGCGGCGGCACCCGGG + Intronic
1021828053 7:24573757-24573779 AGGCGGCGGCGGCGGCGCCGCGG + Intronic
1022310902 7:29194886-29194908 CGGCGGCGGCGTCCGCACCGGGG + Exonic
1022427928 7:30285462-30285484 GGGCGGCGGCGGGGGCGCTCGGG + Exonic
1022715147 7:32891883-32891905 GGGCGGGGGCGGGGGCGGCGGGG - Exonic
1022923420 7:35037699-35037721 GGGCGGCGGGGGCGGGGCCGCGG - Intronic
1023016372 7:35971685-35971707 GGGCAGCGGCGGGGGCACCCGGG + Intergenic
1023594688 7:41816406-41816428 GGGGGGTGGCGGTGGCAGAGAGG + Intergenic
1024043821 7:45574463-45574485 GGGCGCGGGCGGCGGCGCCGGGG - Intronic
1024043863 7:45574567-45574589 AGGCGGCGGCGGAGGCGGCGCGG + Exonic
1024254659 7:47531799-47531821 GGGCAGCTGCAGTGGCACCCAGG - Intronic
1025664047 7:63572857-63572879 GGACGGGGGCTGTGGCGCCGGGG - Intergenic
1026360604 7:69598638-69598660 CGGCGGCGGCGGCGGCACACCGG + Intergenic
1026363492 7:69624921-69624943 GGTGGGGGGCGGGGGCACCGAGG - Intronic
1026525048 7:71146221-71146243 GGGCTGCGGTGGTGGCACCCGGG - Intronic
1027138199 7:75639204-75639226 CGGCGGCGGCGGCGGCACCAAGG + Intronic
1027185121 7:75966489-75966511 GGGTGGCGGCTGAGGCACAGAGG - Intronic
1028556899 7:92134620-92134642 GGGCTGCGCCTGTGGCACAGTGG + Intronic
1028567277 7:92246452-92246474 GGGCGGCGGAGGCGGAACTGCGG + Exonic
1029080724 7:97972086-97972108 GGGCGGCGTCGGTGCCCCCCAGG - Intergenic
1029123245 7:98281896-98281918 GGGCGGCGGCGGGGGCGCGGCGG - Exonic
1029238727 7:99143802-99143824 GGGCGGTGGCGCTGGATCCGCGG - Exonic
1029281563 7:99438956-99438978 CGGCGGCGGCGGCGGCGGCGAGG + Intronic
1029332372 7:99869553-99869575 GGGCGGTGGGGGTGGCAGTGAGG - Intergenic
1029456207 7:100673813-100673835 CGGCGGCGGCGGCGGCGGCGCGG - Exonic
1029456737 7:100675538-100675560 GGGCGGGGGCGATGGGGCCGGGG + Intronic
1029640539 7:101816757-101816779 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1029849304 7:103445985-103446007 GGGCAGAGGCGGTGACAGCGAGG + Intronic
1029899159 7:104021850-104021872 GGGCAGCTGCAGTGGCACCCAGG - Intergenic
1030138701 7:106284564-106284586 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
1031317496 7:120274634-120274656 TGGCGGCGGGGGTGGCAGCGTGG + Exonic
1033299973 7:140176830-140176852 CGGGGGCGGCGGAGGCGCCGAGG + Exonic
1033369757 7:140697211-140697233 GGGCGGCGGCGGTGAGGCCTAGG + Intronic
1034251266 7:149692729-149692751 GGGCGGCGGCGGGAGCGCCCAGG - Intergenic
1034306280 7:150047662-150047684 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1034439673 7:151080354-151080376 AGGAGGCGGCGGCGGCACAGAGG + Intronic
1034440376 7:151083032-151083054 GGGCGGGGGTGGGGGCACAGAGG - Exonic
1034800566 7:154052988-154053010 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1034977862 7:155458467-155458489 CGGCGGCGGCGGTAGCAGCCCGG + Exonic
1035047854 7:155980984-155981006 GGGCTGCAGCGGGGGCACTGTGG + Intergenic
1035169564 7:157010032-157010054 GGGCGGCGGCGGCGGCGGCACGG - Exonic
1035274258 7:157737878-157737900 GGGCGGGGGAGGAGGCTCCGAGG + Intronic
1035453774 7:158996367-158996389 GGGCTGCGGGGGTGGCTCTGGGG + Intergenic
1035477602 7:159154415-159154437 AGGCAGCGGAGGTGGCATCGTGG - Intergenic
1035602130 8:902914-902936 GGGCGGGGGCGGTGGAACGTGGG + Intergenic
1036809490 8:11857772-11857794 GGCTGGCAGCGGTGGCCCCGGGG - Intronic
1037769203 8:21789118-21789140 TGGCGGCGGCGGCGGCGCCGGGG + Intronic
1037901764 8:22692952-22692974 TGGCGGCGGCGGCGGCAGCTCGG - Exonic
1039075797 8:33689587-33689609 GGGCGGGGGAGGGGGCACAGTGG - Intergenic
1039467911 8:37797107-37797129 GCGCGGCGGCGGGGACCCCGGGG + Intronic
1039595450 8:38787122-38787144 CGGGGGCGGCGGCGGCGCCGGGG - Intronic
1039618236 8:38974159-38974181 GGCCGGCGGAGGCGGCGCCGTGG + Exonic
1039837224 8:41266194-41266216 GGGCGGAGGCGGTGGCAGAATGG - Intronic
1040038839 8:42896759-42896781 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1040038840 8:42896762-42896784 CGGCGGCGGCGGCGGCGCGGCGG + Intronic
1041689925 8:60678793-60678815 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1041689928 8:60678796-60678818 CGGCGGCGGCGGCGGCGCGGGGG + Exonic
1041690398 8:60680417-60680439 CGGCGGCGGCGGCGGCTCCCGGG + Intronic
1042040117 8:64581033-64581055 AGGAGGCGGCGGCGGCAGCGCGG + Exonic
1042040127 8:64581060-64581082 TGGCGGCGGCGGCGGCGGCGGGG + Exonic
1043388405 8:79768903-79768925 GGGCGGGGGGGGGGGCAGCGGGG - Intergenic
1043563483 8:81522270-81522292 GAGCGGCGGCGGGGGGACCTTGG + Intergenic
1043769722 8:84183352-84183374 AGGCGGCGGCGGCGGCGACGGGG - Intronic
1043873783 8:85463665-85463687 CGGCGGCTGCGGTGGCTCCTGGG - Intergenic
1044761157 8:95519047-95519069 GGGGGGCGGCGGTGGGGGCGCGG + Intergenic
1045500187 8:102738799-102738821 GGGAGGCGGCACCGGCACCGTGG + Intergenic
1045516292 8:102863625-102863647 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1046547209 8:115667939-115667961 CGGCGGCGGCGGCGGCCCCTCGG + Intronic
1046659968 8:116938488-116938510 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1048214269 8:132480880-132480902 CGGCGGCGGCGGCGGCACCCAGG + Exonic
1048554002 8:135457700-135457722 AGGCGGCGGCGGCGGCACGGGGG - Exonic
1049145971 8:141001240-141001262 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1049396403 8:142403078-142403100 AGGCGGCGGCGGTGGGGCTGGGG - Intronic
1049405533 8:142450384-142450406 GGGAGGAGGCGGCGGCGCCGAGG - Intronic
1049585299 8:143430160-143430182 CGGCGGCGGCGGCGGCGCGGGGG - Exonic
1049615024 8:143572322-143572344 GGGGGGCGGTGCTGGCCCCGGGG - Intronic
1049668389 8:143858958-143858980 GGGCGGCGGCGGCGGCCTCCTGG + Exonic
1049669635 8:143863761-143863783 GGGCGGCGGCGGCGGCCTCCTGG + Exonic
1049689786 8:143953447-143953469 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1049746454 8:144265253-144265275 GGGCGGGGGTGGGGGCAGCGTGG - Intronic
1049761369 8:144333223-144333245 GGGCGGCGCCGGAGGCCCCGCGG - Exonic
1049793128 8:144482069-144482091 CGGCGGCGGCGGCGGCAGCCGGG - Intronic
1049798073 8:144505569-144505591 GGGCGGCGGGGAACGCACCGTGG - Intronic
1049798091 8:144505611-144505633 GGGCGGCGGGGAACGCACCGTGG - Intronic
1049798109 8:144505653-144505675 GGGCGGCGGGGAACGCACCGTGG - Intronic
1049798125 8:144505695-144505717 GGGCGGCGGGGAACGCACCGTGG - Intronic
1050437927 9:5629190-5629212 CGGCGGCGGCGGCGGCAGCTCGG - Exonic
1050483855 9:6114113-6114135 GGGCAGCTGCAGTGGCACCCAGG - Intergenic
1050874042 9:10613177-10613199 CGGCGGCGGCGGCGGCGCTGCGG + Intergenic
1052872730 9:33523963-33523985 GCCCGGCGGCGGCTGCACCGGGG + Intergenic
1053016452 9:34665060-34665082 GGGCAGCGGCGGTGGGGCTGCGG + Exonic
1053034108 9:34810010-34810032 GGGCGGCGGCGGCGGCGCGTGGG - Intergenic
1053575841 9:39357141-39357163 GGGCGGAGGCGGAGGCCCAGAGG + Exonic
1053690490 9:40584409-40584431 GGGCGGCGGCGGCGGCGCGGCGG - Intergenic
1053697505 9:40651092-40651114 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1053752683 9:41273148-41273170 GCTCGGCGGCGGCTGCACCGGGG - Intergenic
1053840357 9:42185078-42185100 GGGCGGAGGCGGAGGCCCAGAGG + Exonic
1054097409 9:60915832-60915854 GGGCGGAGGCGGAGGCCCAGAGG + Intergenic
1054118814 9:61191462-61191484 GGGCGGAGGCGGAGGCCCAGAGG + Exonic
1054258211 9:62837500-62837522 GCTCGGCGGCGGCTGCACCGGGG - Intergenic
1054308797 9:63450501-63450523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1054588940 9:66991100-66991122 GGGCGGAGGCGGAGGCCCAGAGG - Intergenic
1055090981 9:72364787-72364809 GGCCCGCGGCGGCGGCACCAGGG - Intronic
1055091119 9:72365284-72365306 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1055266313 9:74498826-74498848 CGGCGGCGGCGGCGGGACCCCGG + Intronic
1055315245 9:75028163-75028185 GGGAGGAGGCGGTGGCAGCGAGG - Exonic
1055514158 9:77020142-77020164 GGGCGGCGGCGGCGGCGGCTGGG - Exonic
1055611776 9:78031582-78031604 CGGCGGCGGCGGCGGCTCGGGGG - Intergenic
1056376722 9:86021428-86021450 GGCCAGCCGCGGAGGCACCGTGG + Intronic
1057024310 9:91724043-91724065 GAGCTGCGGCGGGGGCACCATGG + Exonic
1057122272 9:92586999-92587021 GGGCGGGGGCGGGGGCACATGGG + Intronic
1057152722 9:92809013-92809035 GCCCGGCGGCGGCTGCACCGTGG + Intergenic
1057259570 9:93576371-93576393 GGGCGGAGGCGGCGCCACCCGGG + Intergenic
1057489142 9:95508358-95508380 CGGCGGCGGCGGCGGCAACATGG - Exonic
1057758552 9:97854847-97854869 GGGCGGCAGCAGTGGCGGCGTGG + Exonic
1057786002 9:98087739-98087761 GGGCGGCGGCCGAGGCCCCGCGG + Exonic
1058504757 9:105656219-105656241 AGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1058866650 9:109167171-109167193 GGGCCGCAGCGGGGGCGCCGCGG + Exonic
1059061442 9:111038349-111038371 GGGCGGCGGGGAGGGCTCCGCGG + Intronic
1059104678 9:111501330-111501352 GGGCGGTGGCAGAGGCACCTGGG - Intergenic
1059483716 9:114611539-114611561 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1059633936 9:116154342-116154364 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
1060468739 9:123930174-123930196 GGGCAGCGGCGGCGGCAGCGCGG - Intergenic
1060583363 9:124771024-124771046 GCGCGGCGGCGGAGGGAGCGCGG + Exonic
1060583371 9:124771065-124771087 GGGAGGCGGCGGGGGCTCGGCGG - Exonic
1060700751 9:125747379-125747401 CGGCGGCGGCGGCGGCGACGAGG - Intronic
1060832023 9:126722943-126722965 GGGCGGGGGCGGGCGCCCCGGGG - Intergenic
1060849196 9:126860686-126860708 CGGCGGCGGAGGGGGCGCCGCGG + Intronic
1061129847 9:128702745-128702767 GGGAGGCGGCGCTGGTCCCGCGG + Exonic
1061208312 9:129176910-129176932 GAGCGGCGGCGGCTGCTCCGAGG + Exonic
1061299661 9:129697386-129697408 CGGCGGCGGCGCGGGCAGCGCGG + Intronic
1061483632 9:130909250-130909272 GGGCGGCGGAGGGGGCGCCTTGG - Intronic
1061486639 9:130923701-130923723 GGGCGGCAGGGCAGGCACCGGGG - Intronic
1061941054 9:133884060-133884082 GGGAGGCGGAGGTTGCAGCGAGG + Intronic
1061961633 9:133991844-133991866 GGGCGGCGGCGGCGCGACCCAGG + Intronic
1062277232 9:135736746-135736768 GGCCCGCGGCGGGGGCTCCGTGG + Intronic
1062284179 9:135765773-135765795 GGGCGGAGGGGGTGGCATGGGGG + Intronic
1062560406 9:137139191-137139213 CGGCGGCGGCGGCGGCTCCGCGG - Intronic
1062574565 9:137200220-137200242 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1062659100 9:137619089-137619111 GGGCAGCGGCGGAGGCGGCGCGG + Intronic
1062659126 9:137619163-137619185 CGGCGGCGGCGGGGGGACCCGGG - Intronic
1202779853 9_KI270717v1_random:24389-24411 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1202800563 9_KI270719v1_random:170876-170898 GCCCGGCGGCGGCTGCACCGGGG + Intergenic
1203782390 EBV:107926-107948 GAGCGGCGGCGGTTGCGCCCGGG - Intergenic
1203469641 Un_GL000220v1:110968-110990 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203471023 Un_GL000220v1:115501-115523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203477462 Un_GL000220v1:154940-154962 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203478844 Un_GL000220v1:159473-159495 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1186496379 X:10015322-10015344 CGGCGGCGGCGGCGGCTCCCGGG + Intergenic
1187154720 X:16712337-16712359 GCGCGGTGGTGGTAGCACCGGGG + Intronic
1187419545 X:19122534-19122556 GAGCGGCGGGGGCGGCGCCGAGG - Exonic
1187518142 X:19990921-19990943 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1188003525 X:25002645-25002667 GGCCGGCGGCGGCGGCGGCGTGG + Intergenic
1190234212 X:48603573-48603595 GGGAGGCGGAGGTTGCAGCGAGG + Intronic
1190245604 X:48688654-48688676 GGGCGGCGGAAGTGGCTCTGTGG - Exonic
1190261652 X:48801525-48801547 GGGCGGCGGCTATGGCATCCGGG + Intronic
1190337241 X:49269952-49269974 TCGAGGCGGCGGTGGCCCCGCGG + Exonic
1190542911 X:51496641-51496663 AGGCGGAGGCGGGGGCAGCGAGG + Intergenic
1190712929 X:53082575-53082597 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1190712969 X:53082701-53082723 GGGAGGCGGCGGGGGCAGCGCGG - Exonic
1191184096 X:57592096-57592118 CGGCGGCGGCGGTATCCCCGCGG + Exonic
1191213294 X:57910351-57910373 CGGCGGCGGCGGTATCCCCGCGG - Exonic
1191675120 X:63785237-63785259 GGGCGGCGGAGGGGGCGCTGGGG - Intronic
1192034375 X:67546547-67546569 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1192705550 X:73526116-73526138 GAGCGGCGGCTGCGGCTCCGGGG - Intergenic
1194380147 X:93181243-93181265 GGGTGGCTGCAGTGGCACCCAGG - Intergenic
1195697575 X:107678208-107678230 GGGTGGAGGCTGTGGCCCCGGGG + Intergenic
1195923156 X:110002572-110002594 AGGCAGTGGCGGTGGCAGCGGGG + Intergenic
1195954792 X:110317828-110317850 GGGCTGCGGCGGCGGCGGCGGGG - Exonic
1196393450 X:115233903-115233925 CGGCGGCGGCGGCGGGACCCTGG - Exonic
1196819567 X:119692457-119692479 GGCGGGCGGCGGCGGCGCCGGGG - Intronic
1196909229 X:120468964-120468986 GGGCGGCGGCGGTTGGCCCGGGG - Intronic
1197415264 X:126165966-126165988 CGGCGGCGGCGGCGGCCCGGCGG + Intergenic
1197501255 X:127244529-127244551 GGGCAGCTGCAGTGGCACCTGGG + Intergenic
1197635347 X:128908622-128908644 GGGCAGCAGTGGTGGCACAGAGG - Intergenic
1198533581 X:137566823-137566845 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
1199458071 X:148052173-148052195 AGGCGGCGGCGGTGGCTGCGCGG - Intergenic
1199772734 X:150984361-150984383 GGGCGGCGGCGGCGGGGCCCGGG + Intronic
1200047696 X:153411448-153411470 GGGCCGGGGCGGCGGCAGCGTGG - Intergenic
1200100825 X:153688489-153688511 GGGGGGCACCGGCGGCACCGGGG - Exonic
1200310277 X:155071162-155071184 GGGCGGCGGGGGCGGCAGGGAGG - Exonic