ID: 1132580612

View in Genome Browser
Species Human (GRCh38)
Location 16:683118-683140
Sequence TGGGACTCGCTGACCAAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132580612 Original CRISPR TGGGACTCGCTGACCAAAAC GGG (reversed) Intronic
911274153 1:95840542-95840564 TGGGACTTGCTCCCCACAACTGG + Intergenic
918459324 1:184759451-184759473 TGGGACCAGCTGTGCAAAACTGG + Intergenic
1069623554 10:69852783-69852805 TGGACCTCGCTGGGCAAAACTGG + Intronic
1073611269 10:104946349-104946371 TGGGACTCACTGACCCAACTGGG - Intronic
1074450862 10:113558761-113558783 TGGGGCTGACTGACCAAAAAGGG + Intronic
1074544775 10:114394033-114394055 TGTGACTCGCTGACCACCAAGGG - Intronic
1083211686 11:61191729-61191751 TAGAACTCACTGACCAAAGCAGG + Intergenic
1087688377 11:101290830-101290852 TGGGGAACGCTGACCAAAACAGG + Intergenic
1089632790 11:119794043-119794065 TGGGAGTAGCTGCCCAATACTGG - Intergenic
1091791986 12:3277222-3277244 TGGGAGTCACAGACCCAAACAGG - Intronic
1094759969 12:33521066-33521088 TGGGACCCGCTGAGCCAAGCAGG - Intergenic
1096156490 12:49344286-49344308 GGGGTCTTGCTGAACAAAACAGG - Intergenic
1098676887 12:73300958-73300980 TGGTACTCGGTGACCACAAAGGG + Intergenic
1101632832 12:106512230-106512252 TGGGACTAGCTTACCAAATCTGG - Intronic
1104625908 12:130354570-130354592 TTGGGCTGGCTGACCAAGACAGG - Exonic
1118705990 14:68480685-68480707 TGTGACTCTCTGACTAAATCTGG + Intronic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1128649123 15:69397655-69397677 TGGGAACCGCAGAACAAAACAGG + Intronic
1132580612 16:683118-683140 TGGGACTCGCTGACCAAAACGGG - Intronic
1137247133 16:46714848-46714870 TGGGAGTCGCTGATCTAGACTGG - Intronic
1138115918 16:54360519-54360541 GCGGCCTCGCTGACCAAAGCTGG + Intergenic
1143470798 17:7174005-7174027 TGGGCCTCCACGACCAAAACGGG - Exonic
1146061763 17:29611606-29611628 TGGGAATCGCTGAGCAGCACGGG + Exonic
1150127677 17:62648887-62648909 TTGAGCTCGCTGCCCAAAACTGG + Intronic
1155802655 18:30128411-30128433 TGGGTCCCTCTGACCAAACCTGG - Intergenic
1165305278 19:34999773-34999795 TTGGCCTGGCTGACCAAAACTGG + Intronic
1167695401 19:51012804-51012826 CGGGACTGGATGACCAAAAGTGG + Exonic
1168663743 19:58186733-58186755 TGTGTCTGGCTGACCAGAACTGG + Intronic
926540017 2:14164393-14164415 TTGGACTCGCTGAATGAAACTGG - Intergenic
926691673 2:15739096-15739118 TGGGACTGGATGAACAAAGCAGG - Intronic
931651318 2:64471417-64471439 TGAGACAAGCTAACCAAAACAGG - Intergenic
943652045 2:190467659-190467681 TGTGGCTCACTGACCAAATCTGG + Intronic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1175816120 20:61884045-61884067 TGGGACTCGCTGCCTGGAACTGG + Intronic
1176946566 21:14989445-14989467 TAGGAAACGTTGACCAAAACAGG + Intronic
949574977 3:5330473-5330495 TGGGACTCGCTGATGTAAATTGG - Intergenic
953975879 3:47381314-47381336 TGGGACAGGCTGAGGAAAACCGG - Intronic
956455801 3:69419608-69419630 TGGGACTCTCTTACCAGAATGGG + Intronic
984023039 4:174509449-174509471 CAGGTCTCACTGACCAAAACTGG - Intronic
991669131 5:69029909-69029931 TGGGACTTGCTGCTCAAAAAAGG + Intergenic
1001212795 5:169826423-169826445 GGGGACGAGCTGACCAAGACTGG + Intronic
1003792457 6:9562146-9562168 TGGGACTTGAAAACCAAAACAGG + Intergenic
1006302817 6:33202835-33202857 TGAGAATAGCTGACCAAGACTGG + Intronic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1011238635 6:85246411-85246433 TGTGCCTCGCTGAACAAAGCAGG + Intergenic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1020434116 7:8143798-8143820 TGGTTCTCGCTGACCGAACCTGG - Intronic
1030378881 7:108788370-108788392 TTGTATTCTCTGACCAAAACAGG - Intergenic
1031661041 7:124424567-124424589 TGGGAATTGCTGATCCAAACGGG + Intergenic
1033759686 7:144425155-144425177 TGGTACTTGTTGACCAAGACTGG + Intergenic
1042375265 8:68043599-68043621 TGGGACTCAGTGACAAAATCTGG - Intronic
1055537892 9:77268107-77268129 TGGGATCCGCTGAGCAAGACTGG + Intronic
1060883682 9:127135970-127135992 AGGGACTTGCTGCCCAAAATTGG + Intronic
1192381793 X:70625076-70625098 TGCAACTCACTGACAAAAACAGG + Intronic
1197246553 X:124172688-124172710 TGGGACCTCCTGACCAAAACTGG + Intronic
1197396855 X:125938217-125938239 TGGGATTCCATGAGCAAAACAGG + Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1198378458 X:136062017-136062039 TGGGACTAGCTGAAGAAAGCAGG + Intergenic