ID: 1132581004

View in Genome Browser
Species Human (GRCh38)
Location 16:684569-684591
Sequence GCGGGCTCGCCGTAGGCCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 66}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132581004_1132581012 11 Left 1132581004 16:684569-684591 CCGCGGGCCTACGGCGAGCCCGC 0: 1
1: 0
2: 1
3: 5
4: 66
Right 1132581012 16:684603-684625 GTGACACGCAGTGCCGACAGCGG 0: 1
1: 0
2: 0
3: 7
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132581004 Original CRISPR GCGGGCTCGCCGTAGGCCCG CGG (reversed) Intronic
900363453 1:2300888-2300910 GCGGGAGGACCGTAGGCCCGGGG - Intronic
905124638 1:35708118-35708140 GCGGCCTCCCCGGAGCCCCGCGG - Intergenic
906416227 1:45622880-45622902 GCGGGCTGGCTGCAGCCCCGGGG - Intronic
906691022 1:47792831-47792853 GGGGGCTCCCCTTAGGCCTGGGG + Intronic
907689222 1:56645552-56645574 CCGCGCCCGCCGGAGGCCCGGGG - Intronic
918349181 1:183635931-183635953 GCGGGCTCTCCGCAGGCAAGGGG + Intergenic
921075253 1:211695418-211695440 GCGGGCTTGCAGTAGTCCAGTGG - Intergenic
1065608394 10:27445275-27445297 GCAGTCTGGCCGAAGGCCCGAGG + Intergenic
1078934884 11:15941614-15941636 GCAGGATCGCTGTAGGCCCGGGG + Intergenic
1084184618 11:67464984-67465006 GAGGGCTTGCCGTGGACCCGTGG + Intronic
1090699135 11:129279118-129279140 GCGGGCGCGCGGGAGGGCCGGGG - Intronic
1096981170 12:55728864-55728886 CAGGGCTCGCCCCAGGCCCGCGG - Intronic
1096983686 12:55743264-55743286 GCGGGGACGCCGGAGTCCCGCGG - Exonic
1103749731 12:123150716-123150738 GCGGCCGCTCCGCAGGCCCGCGG - Intergenic
1111657900 13:91175332-91175354 CCGGGCTCGCCGTTTCCCCGTGG - Intergenic
1113849994 13:113412635-113412657 GCGGGCTGGCAGAAGACCCGTGG + Intergenic
1122558413 14:102593370-102593392 TCGGGCTCGCCGGGGACCCGGGG - Intronic
1132544662 16:527749-527771 CCGGGCGCGCCGTAGCCGCGGGG + Intronic
1132581004 16:684569-684591 GCGGGCTCGCCGTAGGCCCGCGG - Intronic
1136498767 16:30659452-30659474 GCGGCCTGTCCGCAGGCCCGGGG - Exonic
1139426118 16:66880868-66880890 GCGGGCTCGCCGAGGACCCTTGG + Intronic
1142366719 16:89654048-89654070 GGGGGCTCCCCGAAGGCCCCAGG - Intronic
1144269132 17:13600902-13600924 GCGTCCTGGCCGGAGGCCCGAGG - Exonic
1145938067 17:28726538-28726560 GCGGGGTAGCCGGTGGCCCGGGG - Intronic
1147612876 17:41811984-41812006 GCGGGCGCGCCGCCCGCCCGGGG - Exonic
1150231107 17:63550908-63550930 GCGGACTCGCCCTAGGGCCACGG + Intronic
1152426514 17:80221103-80221125 GCGGGCGCACCGTAGGCTGGCGG - Exonic
1158478811 18:57803130-57803152 GGGGGCTGGCCGGGGGCCCGGGG + Intergenic
1161222070 19:3122427-3122449 GCGGGCTCCCCCTCGGGCCGTGG - Exonic
1161719622 19:5895674-5895696 GCGGGCTGGGGGTAGGCCAGGGG + Intronic
1165914130 19:39247633-39247655 TGGGGCTCGCCGTGGGCCTGAGG + Intergenic
1166746764 19:45145500-45145522 GCGGGCTCGTCGTCGGGCTGGGG - Exonic
1166949396 19:46416533-46416555 GCGGGGCCGCGGGAGGCCCGGGG - Intergenic
1167001108 19:46746250-46746272 CCGGGCCCGCCGTGGGCCCGGGG + Exonic
929786991 2:45000542-45000564 GCGGCCTGGCCGTAGGACAGAGG - Intergenic
935196816 2:100820855-100820877 GCGTGCGCGCCCTGGGCCCGCGG + Intronic
941095997 2:161239398-161239420 GCCGACTCGCCGCAGGCCAGCGG - Intergenic
948845794 2:240682266-240682288 GCGGGCCCGCTGTAGGCGGGAGG + Exonic
948848063 2:240692464-240692486 GCGGGCCCGCTGTAGGCGGGAGG - Exonic
1178610110 21:34073087-34073109 GCGGGGTCGCGGCCGGCCCGGGG - Intergenic
1179828793 21:43983205-43983227 GGGGGCGCGCGGTAGCCCCGAGG - Exonic
1181094447 22:20495906-20495928 GCGGGCCAGACGTAGGCCCGGGG + Intronic
1183322962 22:37176312-37176334 GAGGGCTGGCTGTAGGCGCGTGG - Intergenic
1183675536 22:39297105-39297127 GCGGGCTCCCAGCGGGCCCGTGG - Intergenic
1183942082 22:41301731-41301753 TCGGGCTCGGCGCAGGCCCGCGG + Exonic
1184508092 22:44916434-44916456 GCGGGCTCGGCGAGGGCCTGGGG + Exonic
1185173270 22:49305494-49305516 GTGGGCCCGTCGTGGGCCCGTGG + Intergenic
950215241 3:11154359-11154381 GCGGGGGCGCTGCAGGCCCGCGG + Intronic
982260343 4:153488844-153488866 GCGGGCTCGCCGGCAGCCTGTGG + Intronic
989405696 5:41058161-41058183 GCAAGCTCACCGTGGGCCCGTGG + Exonic
997265167 5:132490979-132491001 GCGGGCCCGCGGTGGCCCCGGGG - Intergenic
998364319 5:141618939-141618961 GCGGGAGCGGCGTAGGCGCGGGG - Exonic
1001639484 5:173234782-173234804 TCGGGGTCGCTGTAGGCACGTGG + Exonic
1003873506 6:10418977-10418999 GCGGCCTCGCCCTAGACCCCAGG - Intronic
1004615057 6:17281456-17281478 CCGGGCTCGCCCTTGGCCCCCGG + Exonic
1008630501 6:53359415-53359437 GCGGGCCCGCCGAGGGCGCGGGG - Intergenic
1015366367 6:132401529-132401551 GCGGGCGCGCGGCCGGCCCGAGG - Exonic
1020120578 7:5500959-5500981 GCGGGCGCGCGGTCGGCGCGCGG + Exonic
1020224906 7:6272433-6272455 GTGGGCTCGCCGGCGGCCTGGGG - Intronic
1022094533 7:27130486-27130508 GCGGGCTCGCGGGCGGTCCGCGG + Exonic
1028223124 7:88219812-88219834 GCGGCCTCGCCCTAGGCCCCTGG - Intronic
1035021898 7:155805221-155805243 GCGGGCTCGGCGGCGGCCCCTGG - Intronic
1038372274 8:27006275-27006297 GCTGGCTCGCCGTGGACCCTAGG - Intergenic
1040305684 8:46210609-46210631 GTGGGCTGGCCGCAGGCCTGAGG + Intergenic
1048988057 8:139745884-139745906 GCGTGCTCGCCATGGGCACGTGG - Intronic
1056116654 9:83447504-83447526 GCGGGCCAGCCGTAGGCCCGAGG + Intronic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1062084544 9:134641965-134641987 GAGGGCTCGACTTTGGCCCGCGG - Exonic
1062517756 9:136944676-136944698 GCGGGCTCCCCGTTGGGCGGGGG - Intronic
1062554483 9:137107779-137107801 GCGGGCTTGCCGCAGCCTCGGGG + Intronic
1193716576 X:84941318-84941340 GCTGCCTCGCTGTAGGCCCAGGG - Intergenic
1195285132 X:103376578-103376600 GCGGGCTGGCATTCGGCCCGGGG + Exonic
1196717226 X:118823657-118823679 GCGGGGGCGCAGCAGGCCCGCGG - Intergenic