ID: 1132584571

View in Genome Browser
Species Human (GRCh38)
Location 16:700661-700683
Sequence GGCACGGAGGATATTTAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132584571_1132584580 10 Left 1132584571 16:700661-700683 CCAGTCTAAATATCCTCCGTGCC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1132584580 16:700694-700716 GGACCCTCGCTCCCCAGACCCGG 0: 1
1: 0
2: 2
3: 15
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132584571 Original CRISPR GGCACGGAGGATATTTAGAC TGG (reversed) Intronic