ID: 1132584571 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:700661-700683 |
| Sequence | GGCACGGAGGATATTTAGAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 68 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 64} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1132584571_1132584580 | 10 | Left | 1132584571 | 16:700661-700683 | CCAGTCTAAATATCCTCCGTGCC | 0: 1 1: 0 2: 0 3: 3 4: 64 |
||
| Right | 1132584580 | 16:700694-700716 | GGACCCTCGCTCCCCAGACCCGG | 0: 1 1: 0 2: 2 3: 15 4: 233 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1132584571 | Original CRISPR | GGCACGGAGGATATTTAGAC TGG (reversed) | Intronic | ||