ID: 1132585129

View in Genome Browser
Species Human (GRCh38)
Location 16:702838-702860
Sequence CTCTCTCTTCAGGAGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 291}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132585126_1132585129 -10 Left 1132585126 16:702825-702847 CCTTTTCAGCTGGCTCTCTCTTC 0: 1
1: 0
2: 3
3: 29
4: 521
Right 1132585129 16:702838-702860 CTCTCTCTTCAGGAGCTGCAGGG 0: 1
1: 0
2: 1
3: 18
4: 291
1132585125_1132585129 -4 Left 1132585125 16:702819-702841 CCATCTCCTTTTCAGCTGGCTCT 0: 1
1: 1
2: 2
3: 32
4: 479
Right 1132585129 16:702838-702860 CTCTCTCTTCAGGAGCTGCAGGG 0: 1
1: 0
2: 1
3: 18
4: 291
1132585122_1132585129 14 Left 1132585122 16:702801-702823 CCTTCGGATGAGGAGGGCCCATC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1132585129 16:702838-702860 CTCTCTCTTCAGGAGCTGCAGGG 0: 1
1: 0
2: 1
3: 18
4: 291
1132585124_1132585129 -3 Left 1132585124 16:702818-702840 CCCATCTCCTTTTCAGCTGGCTC 0: 1
1: 0
2: 11
3: 57
4: 370
Right 1132585129 16:702838-702860 CTCTCTCTTCAGGAGCTGCAGGG 0: 1
1: 0
2: 1
3: 18
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132585129 Original CRISPR CTCTCTCTTCAGGAGCTGCA GGG Intronic
900298630 1:1965543-1965565 CTGTCCCTTCAGAAGCTGCTTGG + Intronic
900565463 1:3329758-3329780 CCCTCTCTCCAGAAGCCGCACGG - Intronic
900907787 1:5572915-5572937 CTCTCTCTGCAGTGTCTGCATGG + Intergenic
901748662 1:11392077-11392099 CTCTGTGCCCAGGAGCTGCAGGG + Intergenic
902720674 1:18302118-18302140 CTCCTTCTTCAGGGGCTGCCTGG + Intronic
902876452 1:19343566-19343588 CTCTGTCATCCCGAGCTGCATGG - Intronic
904858930 1:33520615-33520637 CTCTGCCCTCATGAGCTGCATGG - Intronic
905323445 1:37133565-37133587 CTCTCTCTGCTGGAGATGAAAGG - Intergenic
905560797 1:38925538-38925560 CTCTCTCTTGATGAGCAGCCTGG + Intronic
906520052 1:46461544-46461566 CTCTCTCTTCCTTAGCTGCCTGG + Intergenic
906676002 1:47694183-47694205 CTCTCGCTGCAGGAGCAGCTTGG + Intergenic
906998955 1:50830061-50830083 CTCTCTCTTCATGACCCCCAAGG + Intronic
907249109 1:53126217-53126239 CTCACTGTTCAGGAGGTGCCTGG + Intronic
908424213 1:63990028-63990050 GTCTCTCTTAAGGAGCTGACAGG - Intronic
908522464 1:64957390-64957412 TTCTCTCTGCACCAGCTGCAGGG + Intronic
908743824 1:67356204-67356226 ATCTCTCTGCAGCAGCTTCAGGG - Intronic
913248494 1:116891669-116891691 CTCTCTTCTCAGCAGCTGTAGGG - Intergenic
915648190 1:157288759-157288781 CCCTCCCTCCAGGAGCTGCTGGG - Intergenic
916252829 1:162755144-162755166 CTCTCTCCTCAGGTGCTGGATGG + Exonic
918606580 1:186434499-186434521 CTTTCTCTGAAGGAGCAGCAAGG - Intergenic
920109444 1:203576839-203576861 CTCTTTCTTAAAGAGCTGTAAGG + Intergenic
921075686 1:211698673-211698695 CTCTCCCTCCTGGAGCTGAAGGG + Intergenic
921554655 1:216583537-216583559 CTCCCTCTACAGGGGCTTCATGG + Intronic
923850207 1:237786101-237786123 CTCTGTCTTTGGGAGCTGCAAGG + Intronic
923913498 1:238476807-238476829 CTCTCTCTACAGGAGGTGCCTGG - Intergenic
1063927738 10:10997078-10997100 CTCTCTCTACAGCTGCTGCCTGG + Intergenic
1064589335 10:16872558-16872580 CTGTGTCTTCATGAGCTGGAAGG - Intronic
1066454544 10:35561539-35561561 CTCCCTGCTCAGGAGCTCCAAGG - Intronic
1067532615 10:47085539-47085561 CTGTCCTGTCAGGAGCTGCAGGG - Intergenic
1068165622 10:53328375-53328397 ATCTCTCCTCATGAGCTTCAGGG + Intergenic
1069033316 10:63620801-63620823 TTCTCTCTTCAGGTGCGGTACGG + Exonic
1069963361 10:72092469-72092491 CCCTCTCTTCATGGCCTGCAGGG + Intergenic
1070601184 10:77867468-77867490 CTCACCCTTCAGGAAGTGCATGG - Intronic
1071251770 10:83826241-83826263 CCCTCTCTTCAAGTTCTGCATGG - Intergenic
1071463187 10:85917833-85917855 CTCTCTCCAGAGAAGCTGCAAGG + Intronic
1072764411 10:98083992-98084014 CTGTCTCTTCAGGAGGTGGAAGG + Intergenic
1074229186 10:111516812-111516834 GGTTCCCTTCAGGAGCTGCATGG - Intergenic
1075782463 10:125026278-125026300 CTCCCTCTTTAGCAGCTCCATGG + Exonic
1079317512 11:19421740-19421762 CTCTCTCTTAAGGCACTTCATGG - Intronic
1079471631 11:20783696-20783718 CACTCACATGAGGAGCTGCATGG - Exonic
1079556760 11:21768497-21768519 ATCTCTGCTCAGGACCTGCATGG + Intergenic
1081243474 11:40734987-40735009 CTCTCTCTTCTGCAGCTGGGAGG + Intronic
1083493792 11:63033043-63033065 GCCTATCTTTAGGAGCTGCATGG + Intergenic
1084192996 11:67507363-67507385 ACCTCTCTTCAGGCGCTCCATGG + Exonic
1084665935 11:70576301-70576323 CTCTCTCCCCAGGAGGTGCATGG - Intronic
1087175363 11:95090450-95090472 CCTTCACTTCATGAGCTGCAGGG + Intronic
1088451170 11:109982777-109982799 CAATCTCTTCAGGATCTCCATGG - Intergenic
1088743710 11:112787037-112787059 CACTCTCAACCGGAGCTGCAAGG - Intergenic
1089394984 11:118130829-118130851 CTCCCAATTCAGGAGCTCCAGGG - Intergenic
1089985210 11:122806018-122806040 ACCTCTCTTCAAGAGCAGCAAGG - Intronic
1090359047 11:126160211-126160233 CTTTCTCTGCAGGCCCTGCACGG + Intergenic
1090496530 11:127218086-127218108 CTCTCTTTTCAGGCCCTTCAAGG + Intergenic
1090959343 11:131542312-131542334 TTGTCTCTTCAGGTGCTACATGG - Intronic
1091133468 11:133166413-133166435 CTCTGCCATCAGGAGCTGTATGG - Intronic
1091403686 12:196193-196215 CCCGCTCTTCCGGAGCTGCCTGG + Exonic
1091463603 12:664655-664677 CTTTCTGTTCTGGAGCTGCTGGG + Intergenic
1091711006 12:2740495-2740517 CTTTCTCCTCAGGAACTGGATGG + Intergenic
1092208410 12:6630894-6630916 GGCTCCCTTCAGGAGCTGAATGG + Intronic
1093240261 12:16661648-16661670 CTCTGTCTTCAGAACCAGCAAGG + Intergenic
1095058461 12:37649590-37649612 CTCTTTTTTCAGTATCTGCAAGG + Intergenic
1097688381 12:62712006-62712028 CTCTAGCTGCAGGAGCAGCAGGG - Intronic
1098455742 12:70671712-70671734 CTCTCCATTCAGTATCTGCAAGG - Intronic
1100035323 12:90243808-90243830 CTCTCTCCTGAGGATCTGAAGGG - Intergenic
1100246756 12:92765858-92765880 CTCTCTCTCCAAGAGCAGAAGGG + Intronic
1100394291 12:94171262-94171284 CGCTCTCCTCAGGATCTGTATGG + Intronic
1102016056 12:109648688-109648710 CTCGCTGCTCAGGAGCTACAAGG - Intergenic
1102322367 12:111948217-111948239 CTCCCTCAACAGGAGCAGCAAGG - Intronic
1105866208 13:24461786-24461808 CTCTCACTTCCAGAGCTGCGGGG + Intronic
1106055912 13:26236605-26236627 CACGTTCTTCAGGAGCTGAAAGG + Intergenic
1108192434 13:47955839-47955861 GTATCTTTTCAGGAGCTGCAAGG - Intronic
1111811828 13:93100783-93100805 CTTTATCTTCTGTAGCTGCAGGG - Intergenic
1113428014 13:110225767-110225789 CTCTCTCTTCAGTCACTGCATGG + Intronic
1113665309 13:112136890-112136912 GTGTCTCTGCAGGAGCTGCGTGG + Intergenic
1113822603 13:113225711-113225733 CTCTGACTCCAGGAGCTGGACGG - Intronic
1113999938 14:18225132-18225154 CTCTCTTTGTAGGATCTGCAAGG - Intergenic
1114000031 14:18227010-18227032 CTCTCTTTATAGGATCTGCAAGG - Intergenic
1114187172 14:20411572-20411594 CTCTCTCCTCAGGAACTTAATGG - Intronic
1114863676 14:26559685-26559707 CTCTGTCTTCATGAGATCCACGG - Intronic
1116635489 14:47389668-47389690 TTCTCACTTCTGCAGCTGCAGGG - Intronic
1117960020 14:61153592-61153614 CTCTCTCCTCAGCTCCTGCAGGG - Intergenic
1117975929 14:61296583-61296605 CTCTGTCTTGAAGGGCTGCAGGG + Intronic
1118766099 14:68910141-68910163 CTCCTCCTTCAGTAGCTGCAGGG - Intronic
1119644407 14:76338082-76338104 CTCTCACTAAAGGAGCTTCAAGG + Intronic
1119880050 14:78092604-78092626 CTAGCTCTTCAGGGGCTGGAAGG + Intergenic
1120003738 14:79333290-79333312 CTCTCCCTTCAGTGACTGCAAGG + Intronic
1120910643 14:89663715-89663737 CTCTCCCTTGAGGACGTGCAGGG + Intergenic
1121221495 14:92288689-92288711 CGCTCTCCATAGGAGCTGCAGGG - Intergenic
1122199942 14:100116408-100116430 CTATCTTTTCAGGAGCCCCAGGG + Intronic
1122204829 14:100143187-100143209 CTCACTCCTCAGGAGAGGCAGGG - Intronic
1122259083 14:100501960-100501982 CTCACTCTCCAGGAGCCCCAGGG + Intronic
1122384634 14:101335580-101335602 CTCTCTCTTCAGTGACTTCAGGG - Intergenic
1123479109 15:20614779-20614801 CACTCCCTTCAGAATCTGCAGGG + Intergenic
1123638904 15:22385606-22385628 CACTCCCTTCAGAATCTGCAGGG - Intergenic
1124964517 15:34423264-34423286 CTCTTCCAACAGGAGCTGCAGGG - Intronic
1124981137 15:34569490-34569512 CTCTTCCAACAGGAGCTGCAGGG - Intronic
1125735163 15:41919697-41919719 CTCGCTCTCCAGCAGCTGCCAGG + Intronic
1126556340 15:49992144-49992166 CTCTTCCTTCAAGAGCTGTAAGG + Intronic
1127263237 15:57341134-57341156 CTCTCTTGTCTGGAGGTGCAGGG + Intergenic
1128398551 15:67254168-67254190 CACTCTCTCCCGGAGCAGCAAGG + Intronic
1129172898 15:73818595-73818617 TGCTCTCTGCAGCAGCTGCAGGG - Intergenic
1129393814 15:75233707-75233729 CTGTCCCTTCAGGAACTGCTGGG - Intergenic
1130059789 15:80561061-80561083 CTCTATCCTCAAGACCTGCAAGG - Intronic
1130100225 15:80887805-80887827 CTCTCTGATCAAGAGGTGCAGGG + Intronic
1130403955 15:83581471-83581493 CTCTCTCTGCAGGGGCTCCAAGG - Intronic
1130892019 15:88141440-88141462 CTCACACTGCAGGGGCTGCAAGG + Intronic
1132585129 16:702838-702860 CTCTCTCTTCAGGAGCTGCAGGG + Intronic
1135085878 16:19474117-19474139 GTGTGTCTTCAGGAACTGCAGGG - Exonic
1136031414 16:27506042-27506064 CTCTCTCTTCAGCAGCTCCTGGG + Exonic
1136289243 16:29261678-29261700 CGCGCTCTTCTGGAGCTGGACGG + Intergenic
1136635328 16:31517874-31517896 ATCTCTCTGGAGGTGCTGCAGGG - Intergenic
1136665819 16:31811412-31811434 ATCTCTCTGGAGGTGCTGCAGGG - Intergenic
1138547174 16:57726878-57726900 CTCCCTCTTCAGGTGCATCATGG - Exonic
1139290507 16:65854130-65854152 GTCTCACCTCAGGAGCTGCATGG + Intergenic
1139330866 16:66188885-66188907 TTCTCTCTGCAGGAGCCCCAGGG - Intergenic
1141710410 16:85695654-85695676 GTCTCTCAGCAGGAGCCGCAGGG - Intronic
1141836847 16:86546295-86546317 CTCTCTGTTCAGGTGGTGAAAGG - Intronic
1142067659 16:88072057-88072079 GTCTCCCTCCAGGTGCTGCAGGG + Exonic
1142094978 16:88234635-88234657 CGCGCTCTTCTGGAGCTGGACGG + Intergenic
1142255752 16:89013056-89013078 CTCTCTGTTTAGGGGCTGCAAGG + Intergenic
1144075598 17:11716721-11716743 CTCTTTTCTCTGGAGCTGCAGGG - Intronic
1144095983 17:11901187-11901209 CTCTCTCTTTTGGTGCTGGAGGG - Intronic
1146612789 17:34322449-34322471 CTCTTTCTTCAATAGCTTCAAGG + Intergenic
1147038504 17:37699551-37699573 CTCTCTCTTCATGGGCGGCCAGG + Intronic
1148216623 17:45836995-45837017 CTCCCTCAGCAGGAGCTGCGGGG - Intergenic
1149547995 17:57518633-57518655 CTCTCTCCTCTGGAGCTGGCAGG + Intronic
1149967425 17:61179646-61179668 CTCTCCCTTCAAGCACTGCAGGG + Intronic
1150109418 17:62485111-62485133 CTCTCTTATTTGGAGCTGCAGGG - Intronic
1151535381 17:74736416-74736438 CTCTGTCACCAGGAGCTGCCGGG + Intronic
1152232128 17:79119123-79119145 CTCTCACTTGAGGTTCTGCAGGG + Intronic
1152307981 17:79532254-79532276 TTCTGCCTTTAGGAGCTGCAGGG - Intergenic
1152368372 17:79870379-79870401 CTGCCTCTTCAGGAGTTGCTGGG - Intergenic
1152433882 17:80263642-80263664 CTCTTGCTTCTGGATCTGCAGGG + Exonic
1152587823 17:81196933-81196955 CGCTCTCTGCAGCAGCAGCATGG + Exonic
1155085415 18:22453364-22453386 GTCCCTCATCAGGAGCAGCATGG + Intergenic
1157211007 18:45742004-45742026 CACTCTGTGCAGGAACTGCATGG - Intronic
1157818443 18:50748274-50748296 CTGTGACTGCAGGAGCTGCAGGG + Intergenic
1159909852 18:74135348-74135370 CTCTTTCTTTAGGATCTGCTTGG + Intronic
1160037454 18:75315046-75315068 CTCTCTCTACAGAGGCTGTAGGG - Intergenic
1160165056 18:76503861-76503883 CTCTCTCTTCCAGAGGCGCAGGG - Intergenic
1160403962 18:78631658-78631680 CTCTCCCTTCAGGGGCAGGAAGG - Intergenic
1161427596 19:4212491-4212513 CTGTCTCTCCAGGATGTGCAGGG - Exonic
1161655414 19:5511390-5511412 CTCTCTCATCACTAGCTGCCTGG + Intergenic
1161842451 19:6691029-6691051 ATATCTCTTGAGGAGCTGGATGG - Intronic
1164347950 19:27291032-27291054 CTCTCTTTGCAGTATCTGCAAGG + Intergenic
1164570707 19:29372394-29372416 CTCACACTTCAGCAGCTACAGGG - Intergenic
1164727739 19:30477978-30478000 CTCAATCATCAGAAGCTGCAAGG - Intronic
1165366027 19:35365570-35365592 CCCTCACTACAGGAGCAGCAGGG + Intergenic
1166205374 19:41265475-41265497 ATCTCTCTTCCGGGGCTGGAAGG + Intronic
1166219998 19:41358012-41358034 CTCTCACTGCAGGGGCGGCATGG - Exonic
1166816727 19:45550780-45550802 CTCTCATTAGAGGAGCTGCAAGG - Intronic
1168347546 19:55658341-55658363 GTCTCTCTTCAGGGGTTGAAGGG + Intronic
925703032 2:6658096-6658118 CTCTCTGTTCAGAAGTAGCAAGG + Intergenic
927022482 2:19031587-19031609 CTCTCCCCTCATGATCTGCATGG + Intergenic
928223988 2:29431880-29431902 CTCTATCTTTAGGAGCTCCCAGG + Intronic
928370710 2:30738283-30738305 TTCTCTCCTCAGGACCTCCAGGG - Exonic
933514333 2:83281380-83281402 CTCTCACATCAGAAGCTTCACGG + Intergenic
933824329 2:86144858-86144880 CTTCCTCTTCAGCAACTGCATGG + Exonic
934552122 2:95269001-95269023 CTCTCTCTCCAAGATCAGCAGGG - Intergenic
934896580 2:98124982-98125004 CTCACTCTAAAGGAGCTGAATGG + Intronic
935492125 2:103734021-103734043 CCCTTTCCTCAGGAGCTGCTGGG + Intergenic
935652516 2:105394290-105394312 CTCTCTCTTTAGGGACTCCAAGG - Intronic
935734965 2:106099270-106099292 TTCTCTCTTCATGAAATGCATGG - Intronic
935847442 2:107182072-107182094 TTCTCTCTCCAGGTGCTCCAAGG + Intergenic
936393231 2:112095327-112095349 CTCTCACTTCAGGATCAGAAGGG + Intronic
937375800 2:121334931-121334953 CTGTGTCTCCAGGAGCTCCAGGG + Intergenic
939570543 2:143835374-143835396 TTCTCTCATCTGGAGCTTCATGG - Intergenic
941441106 2:165537977-165537999 ATCTGTCCTCAGGAGCTGAAGGG - Intronic
942402727 2:175620849-175620871 CTCTGTCTCCATGAGATGCAAGG + Intergenic
944614202 2:201443355-201443377 CTCTCTCTCCAGGAGAGCCAAGG - Intronic
947528791 2:230895557-230895579 CTCTCTCTGCAGGAGCCAGAAGG - Intergenic
947578922 2:231299442-231299464 CTCTCTCTTGAGGAGCCTCAGGG - Intronic
947706489 2:232280828-232280850 CTCTGTCTTCAAGAAATGCATGG + Intronic
947820249 2:233064122-233064144 CCCTCTCTGCAGGAGCAGCTGGG + Intronic
1169236131 20:3931295-3931317 ATCTATCTTCAGGAGTTGCTGGG - Intronic
1171360099 20:24581519-24581541 CTATCTCTGCAGGAGATGCTCGG - Intronic
1172570798 20:35968788-35968810 TTCCTTCTTCAGGAGCTGCCAGG - Exonic
1172711230 20:36925335-36925357 GTCTCTCTCCAGGACCTTCAGGG - Intronic
1172804603 20:37602805-37602827 GTCTCTCCTCAAGAGCTGGATGG - Intergenic
1174568481 20:51484221-51484243 CTCTCCCTCCATGACCTGCAGGG + Intronic
1175173393 20:57094739-57094761 CTCACCCATCAGGAGCTGCCCGG - Intergenic
1180424402 22:15154905-15154927 CTCTCTTTGTAGGATCTGCAAGG - Intergenic
1180424494 22:15156783-15156805 CTCTCTTTATAGGATCTGCAAGG - Intergenic
1180847825 22:18994077-18994099 CTCTCTCATCAGGGCCTCCAAGG - Intergenic
1181471756 22:23145067-23145089 GTCTATCTTCTGCAGCTGCAGGG + Intergenic
1183343233 22:37293668-37293690 CTTTCTCCCCAGGATCTGCAGGG - Intronic
1184074273 22:42166195-42166217 CTCTCCCTCCAAGAGCTGAATGG + Intronic
1184768923 22:46586812-46586834 CTCCCTCCTCATCAGCTGCAGGG - Intronic
1185017208 22:48351744-48351766 CTCTCTTTTCAGGCACAGCACGG + Intergenic
1185300698 22:50078859-50078881 CTGTCTCTTCAGGATCAGGAAGG - Intronic
949575669 3:5336985-5337007 CTCTCCATTCAGGGGATGCATGG + Intergenic
950234342 3:11305593-11305615 CTCTCTCTTCAAGACCAGCTTGG + Intronic
952691127 3:36207854-36207876 CTCACCCTTATGGAGCTGCAGGG - Intergenic
953040304 3:39250427-39250449 TTCTCTCTTTAGGAGCTGACAGG + Intergenic
953182904 3:40613210-40613232 CGCTCTCTTGAGGGACTGCAGGG - Intergenic
954132230 3:48566668-48566690 CTCTCTCGCCAGGAGCTCCAGGG + Exonic
954167291 3:48770116-48770138 CTCTCTTTTCATGTGGTGCAAGG + Intronic
960330443 3:116353470-116353492 CTCTGTCTTCAAGAAGTGCATGG - Intronic
961033891 3:123629101-123629123 AGCCCTCTTCAGGGGCTGCAGGG - Intronic
962430160 3:135311715-135311737 GTCTCTCTCCAGCAGCTGCTGGG + Intergenic
962769044 3:138595004-138595026 GTCTCTCATCAGGAGATCCAAGG + Intergenic
963304745 3:143639173-143639195 CTCTCACTTCAGGGGGTGGAGGG - Intronic
964918055 3:161860089-161860111 ATCTCCTTTCAGGAGCTGGAGGG - Intergenic
969599565 4:8167991-8168013 CTCTCTCTGCTGGGGCTGCTGGG - Intergenic
971843283 4:31882805-31882827 CTTTCTCTTCATGAATTGCAAGG - Intergenic
974335085 4:60532787-60532809 TTCTCTCTTAAGTAGTTGCAAGG - Intergenic
975950769 4:79768341-79768363 CTCTGTCTTCAGGTCATGCAAGG - Intergenic
976620420 4:87121240-87121262 CTCTCTCTTCAGGAGGAAAAAGG - Intronic
982169491 4:152646931-152646953 GTCTCTCTGAAAGAGCTGCAGGG - Intronic
983490150 4:168379726-168379748 CTCTTTGATAAGGAGCTGCAAGG + Exonic
983862339 4:172723139-172723161 CTCTCTCTAAAGGATCTGCGTGG + Intronic
984566060 4:181331363-181331385 GTCTCCCTTCAGAGGCTGCAAGG + Intergenic
985491815 5:184390-184412 CTGACTCCTCAGGAGCAGCATGG + Exonic
985888714 5:2699696-2699718 CTCACCCTTGAGGAGCTGGATGG + Intergenic
985917066 5:2930239-2930261 CTTTATCTTCATCAGCTGCACGG + Intergenic
985971280 5:3380644-3380666 CTCTCCCTCCAGGGGCTCCAGGG - Intergenic
987389707 5:17364289-17364311 CTCTTTCTTGAGCAGCTGCTAGG - Intergenic
989469277 5:41796257-41796279 CTCTCTATTCAGGAGCTTCAGGG + Intronic
989864520 5:46432474-46432496 CTCTCTTTTTAGAATCTGCAAGG - Intergenic
992888220 5:81180521-81180543 CTGTTTCCTCAGAAGCTGCAGGG - Intronic
995225021 5:109691031-109691053 CTCTCTCTTCAGAGGCAGCGGGG - Intronic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
995831726 5:116361724-116361746 GGCTCTCATCAGGAGATGCAGGG - Intronic
996488088 5:124059938-124059960 CTCTCTCTGCAGGAGCACAAAGG - Intergenic
999323132 5:150626876-150626898 CTCTCTCTCCAGGTGCTCCATGG - Intronic
999622144 5:153484575-153484597 CTCTCACTTCAGGATCTGGTTGG - Intergenic
1000292658 5:159885065-159885087 CCCTCTCATCAGAAGATGCAGGG + Intergenic
1000929565 5:167235056-167235078 CTCTAGCTTCTGGAACTGCAAGG - Intergenic
1001641430 5:173246650-173246672 CCCTCTCTTGAGAAGCTGTAGGG + Intergenic
1001769363 5:174281356-174281378 CTCCATCCTGAGGAGCTGCAGGG - Intergenic
1002052299 5:176577956-176577978 CTCTGTCCCCACGAGCTGCATGG + Intronic
1003250740 6:4427580-4427602 CTCACTCTTCAAAAGCTGCTTGG - Intergenic
1003460704 6:6325187-6325209 CTCACTCTTCTGAAGCTGAAGGG + Intergenic
1009153888 6:59786463-59786485 CTCTTTCTGAAGGATCTGCAAGG + Intergenic
1009279954 6:61736404-61736426 CTCTATCTTGAGGATCTGCCTGG + Intronic
1010716725 6:79238934-79238956 CTTTCTCTTCTGTAGTTGCAAGG + Intergenic
1011721053 6:90157031-90157053 CGCACTCTTCAAGAGCTTCAAGG + Intronic
1013743612 6:113318787-113318809 CTCTCTCCTGAGGAGCTTCTGGG - Intergenic
1017377345 6:153786634-153786656 CTCTCCCTTCAGTGGCTCCAGGG - Intergenic
1017454526 6:154589101-154589123 CTCTCTCTTCAGTGGCTGTAGGG + Intergenic
1019002451 6:168766232-168766254 CTCTATCTTCAGGACATTCATGG - Intergenic
1019034708 6:169044731-169044753 CTCTCTCTTCTGCAGCTTCTGGG - Intergenic
1020617417 7:10476795-10476817 ACCTCTCTTCAGGCGCTCCATGG - Intergenic
1021634930 7:22682772-22682794 TTCCCTTTTCTGGAGCTGCATGG + Intergenic
1024476755 7:49820112-49820134 CAATCTCTTCAAGAGCTTCAGGG - Intronic
1025740512 7:64192318-64192340 CTCGCTCTCCAGGAGCTCCGGGG - Intronic
1026659416 7:72286540-72286562 CTCTCTGTTCAACAGCTACATGG + Intronic
1028734873 7:94197303-94197325 CTCTTTCTCCAGTATCTGCATGG - Intergenic
1028736039 7:94213497-94213519 CTCTGGTTTAAGGAGCTGCATGG - Intergenic
1028765307 7:94550638-94550660 CTCTGTCCTCATGTGCTGCAAGG + Intronic
1029464440 7:100716502-100716524 CTCTCTCTCCAGAAGCCCCAGGG + Intergenic
1031325248 7:120388372-120388394 CTCTCTATTCAGCAACAGCATGG + Intronic
1032038445 7:128537627-128537649 CTCTCTTATTTGGAGCTGCAGGG - Intergenic
1032091686 7:128914633-128914655 CCCTCACTCCAGGAGCTGCAAGG + Intergenic
1033571893 7:142637675-142637697 CTCTCTCTACATGAGCTTTATGG + Intergenic
1034681490 7:152931876-152931898 CTGGCTCTTCGGGAGCTCCAGGG + Intergenic
1034681604 7:152933098-152933120 CTGGCTCTTCGGGAGCTCCAGGG - Intergenic
1036476035 8:9094394-9094416 CTCTCTCTGCAATTGCTGCAAGG + Intronic
1036694494 8:10965676-10965698 CTCTCTTTCCGGCAGCTGCAGGG + Intronic
1037340048 8:17834924-17834946 CTCTGGCTTCAGTAACTGCATGG - Intergenic
1037466121 8:19162315-19162337 CTGTCTCTTCATGGGCTGCCAGG - Intergenic
1037499734 8:19474111-19474133 ATCTCTCATCAGAAGCTCCATGG - Intronic
1037547543 8:19939408-19939430 GTCCCTCTGGAGGAGCTGCAAGG - Exonic
1037908095 8:22727298-22727320 CTCTCTCTGCAGGAGGAGGATGG + Intronic
1038218549 8:25585678-25585700 CTCTCTCCTCAGGGGCTTGAGGG - Intergenic
1039516171 8:38135745-38135767 CTCACTGTACAAGAGCTGCACGG + Exonic
1039799107 8:40938889-40938911 CCCTCTCTTCCGGCCCTGCAGGG + Intergenic
1041271443 8:56113221-56113243 CTCTCCTTTCAGGAGCTCCGGGG + Exonic
1041383933 8:57279417-57279439 CTCACTCTCCTGAAGCTGCAGGG - Intergenic
1041691627 8:60693394-60693416 CTCTCTCTGCAGGTGCCCCAAGG - Intronic
1042100767 8:65272788-65272810 CTCTGTCTTCAGTGGCAGCAGGG - Intergenic
1044591355 8:93916972-93916994 CTCGCGCTCCGGGAGCTGCACGG + Exonic
1044708443 8:95031260-95031282 CTCTTTCAGCAGGTGCTGCAAGG + Intronic
1044843381 8:96356943-96356965 TTCACTGTTCAGGAGCTGCTCGG - Intergenic
1049349463 8:142156557-142156579 CCCTCTCATCTGGAGCTGAAGGG + Intergenic
1052287721 9:26805812-26805834 TTCTTACTTCAGTAGCTGCAAGG - Intergenic
1052337566 9:27335877-27335899 TTCTCTCTTCAAGAGCAGCCTGG - Intronic
1053016527 9:34665363-34665385 CTCTCTCTGCAGGATCTACTGGG - Exonic
1053534053 9:38908254-38908276 CCCTGTTTTCATGAGCTGCAGGG - Intergenic
1053713877 9:40860680-40860702 CTCTCTTTATAGGATCTGCAAGG + Intergenic
1053713977 9:40862731-40862753 CTCTCTTTGTAGGATCTGCAAGG + Intergenic
1054206277 9:62132673-62132695 CCCTGTTTTCATGAGCTGCAGGG - Intergenic
1054424260 9:64991028-64991050 CTCTCTTTATAGGATCTGCAAGG + Intergenic
1054424364 9:64993079-64993101 CTCTCTTTGTAGGATCTGCAAGG + Intergenic
1054632080 9:67455673-67455695 CCCTGTTTTCATGAGCTGCAGGG + Intergenic
1055443158 9:76356279-76356301 GTGGCTCTTCAAGAGCTGCAGGG - Intronic
1055569935 9:77606480-77606502 CTCTCTTTTCAGGAAGTGAATGG + Intronic
1055644939 9:78354540-78354562 CTCTCTCTCCATCAGCAGCATGG + Intergenic
1056841363 9:90000226-90000248 CTCTTTCTGCAGGAGCAGCAGGG - Intergenic
1057669663 9:97076906-97076928 CTCTCTCTTCTGGAGCTCCCCGG + Intergenic
1057705109 9:97390339-97390361 CTCTCTCTATAGGAGCACCAGGG - Intergenic
1059087975 9:111325040-111325062 CTCTCTCAGCAAGATCTGCAAGG + Intergenic
1060342914 9:122792740-122792762 CTCTCTCTGCAGGAGCAGACAGG + Intergenic
1060496859 9:124125598-124125620 CTGGCTCTTCAGGAGCAGCTTGG + Intergenic
1060528618 9:124334574-124334596 CTCCCTCTGCTGGAGCTCCAAGG - Intronic
1060910718 9:127347879-127347901 CTCTCCCTTTAGGAAATGCACGG - Intronic
1061010805 9:127953594-127953616 CTCCCTGTGCAGGAGCTGAAAGG - Exonic
1062074372 9:134576543-134576565 CTTCCTCTTCAGGAGCATCAAGG - Intergenic
1062434873 9:136542504-136542526 CTCCCTCTGCAGAAGCCGCACGG - Intronic
1062514658 9:136926564-136926586 CTCTGTCTTCGTGAGCTGGATGG - Exonic
1062715211 9:138006759-138006781 CTCTCCCGTCAGGATCTGCCAGG - Exonic
1186227545 X:7417227-7417249 CTCTGTGGTCATGAGCTGCAGGG + Intergenic
1186465736 X:9783276-9783298 TACTCTCTTCTGGACCTGCAAGG - Intronic
1187067239 X:15853830-15853852 CGCTATCTTCAGGACTTGCACGG - Intronic
1189286487 X:39855485-39855507 AGCTCCTTTCAGGAGCTGCAGGG - Intergenic
1190279921 X:48922827-48922849 CTCTCTCCTCTGGGGCTGCCTGG + Exonic
1190683885 X:52853143-52853165 CTCACTCTGCTGCAGCTGCATGG - Intergenic
1193099852 X:77597294-77597316 TTCTCTCTTCAGTACCTCCATGG - Intronic
1196078948 X:111610387-111610409 CTCTCTCTTGGGGAGTTTCATGG - Intergenic
1200119303 X:153782941-153782963 GACTCTCTGCAGGTGCTGCACGG + Exonic
1200324839 X:155225506-155225528 CTTTCTCTTCAGGTGAAGCAGGG + Intronic
1202150487 Y:21839597-21839619 CTCTTTCTCCACAAGCTGCAGGG + Intergenic