ID: 1132585690

View in Genome Browser
Species Human (GRCh38)
Location 16:705071-705093
Sequence AGAAGCCGCCCGCCCGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 107}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132585666_1132585690 29 Left 1132585666 16:705019-705041 CCCCCCACCCTCCTCCTCCCGCG 0: 1
1: 0
2: 4
3: 157
4: 1569
Right 1132585690 16:705071-705093 AGAAGCCGCCCGCCCGGGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 107
1132585675_1132585690 18 Left 1132585675 16:705030-705052 CCTCCTCCCGCGGGCAGTAGCTC 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1132585690 16:705071-705093 AGAAGCCGCCCGCCCGGGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 107
1132585671_1132585690 26 Left 1132585671 16:705022-705044 CCCACCCTCCTCCTCCCGCGGGC 0: 1
1: 0
2: 5
3: 43
4: 440
Right 1132585690 16:705071-705093 AGAAGCCGCCCGCCCGGGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 107
1132585669_1132585690 27 Left 1132585669 16:705021-705043 CCCCACCCTCCTCCTCCCGCGGG 0: 1
1: 0
2: 3
3: 79
4: 784
Right 1132585690 16:705071-705093 AGAAGCCGCCCGCCCGGGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 107
1132585674_1132585690 21 Left 1132585674 16:705027-705049 CCTCCTCCTCCCGCGGGCAGTAG 0: 1
1: 0
2: 2
3: 12
4: 164
Right 1132585690 16:705071-705093 AGAAGCCGCCCGCCCGGGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 107
1132585667_1132585690 28 Left 1132585667 16:705020-705042 CCCCCACCCTCCTCCTCCCGCGG 0: 1
1: 0
2: 6
3: 100
4: 1827
Right 1132585690 16:705071-705093 AGAAGCCGCCCGCCCGGGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 107
1132585678_1132585690 11 Left 1132585678 16:705037-705059 CCGCGGGCAGTAGCTCAGCGCAG 0: 1
1: 0
2: 1
3: 9
4: 104
Right 1132585690 16:705071-705093 AGAAGCCGCCCGCCCGGGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 107
1132585677_1132585690 12 Left 1132585677 16:705036-705058 CCCGCGGGCAGTAGCTCAGCGCA 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1132585690 16:705071-705093 AGAAGCCGCCCGCCCGGGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 107
1132585676_1132585690 15 Left 1132585676 16:705033-705055 CCTCCCGCGGGCAGTAGCTCAGC 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1132585690 16:705071-705093 AGAAGCCGCCCGCCCGGGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 107
1132585673_1132585690 22 Left 1132585673 16:705026-705048 CCCTCCTCCTCCCGCGGGCAGTA 0: 1
1: 0
2: 2
3: 9
4: 142
Right 1132585690 16:705071-705093 AGAAGCCGCCCGCCCGGGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 107
1132585672_1132585690 25 Left 1132585672 16:705023-705045 CCACCCTCCTCCTCCCGCGGGCA 0: 1
1: 0
2: 4
3: 63
4: 529
Right 1132585690 16:705071-705093 AGAAGCCGCCCGCCCGGGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132585690 Original CRISPR AGAAGCCGCCCGCCCGGGGA GGG Intronic