ID: 1132587828

View in Genome Browser
Species Human (GRCh38)
Location 16:713941-713963
Sequence GTGGCAGGAGGTTTGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 819
Summary {0: 1, 1: 0, 2: 7, 3: 93, 4: 718}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132587815_1132587828 20 Left 1132587815 16:713898-713920 CCACTGGTGAACTCATCTGTCCA 0: 1
1: 0
2: 1
3: 13
4: 164
Right 1132587828 16:713941-713963 GTGGCAGGAGGTTTGGGGGCAGG 0: 1
1: 0
2: 7
3: 93
4: 718
1132587819_1132587828 -3 Left 1132587819 16:713921-713943 CCATGAGTTTCGAGCGCCGGGTG 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1132587828 16:713941-713963 GTGGCAGGAGGTTTGGGGGCAGG 0: 1
1: 0
2: 7
3: 93
4: 718
1132587816_1132587828 0 Left 1132587816 16:713918-713940 CCACCATGAGTTTCGAGCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 9
Right 1132587828 16:713941-713963 GTGGCAGGAGGTTTGGGGGCAGG 0: 1
1: 0
2: 7
3: 93
4: 718
1132587814_1132587828 27 Left 1132587814 16:713891-713913 CCGACTGCCACTGGTGAACTCAT 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1132587828 16:713941-713963 GTGGCAGGAGGTTTGGGGGCAGG 0: 1
1: 0
2: 7
3: 93
4: 718

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132587828 Original CRISPR GTGGCAGGAGGTTTGGGGGC AGG Intronic
900097938 1:947931-947953 CATTCAGGAGGTTTGGGGGCAGG - Intronic
900109506 1:999602-999624 GTGGCGGGAGCTCTGGGGGCGGG + Exonic
900175098 1:1288049-1288071 CTGGCAGGGGGTGCGGGGGCAGG + Intronic
900369180 1:2323899-2323921 GGGGCTGGTGGCTTGGGGGCTGG - Intronic
900514426 1:3074579-3074601 GGGGCAGGAGCTGTGGGGGACGG - Intronic
900951407 1:5860042-5860064 GAGGCAGGAGGGTCTGGGGCTGG - Intergenic
901974351 1:12932506-12932528 ATGGCAGCAGGGTAGGGGGCCGG - Intronic
902010823 1:13269262-13269284 ATGGCAGCAGGGTAGGGGGCCGG + Intergenic
902658288 1:17884443-17884465 GTGTCAGTGAGTTTGGGGGCTGG + Intergenic
902792495 1:18778660-18778682 CTAGCTGGAGGTATGGGGGCAGG + Intergenic
902836929 1:19053530-19053552 CCGGCAGGAGGGCTGGGGGCTGG - Intergenic
903058625 1:20654196-20654218 CTGCCAGGAGGCTTAGGGGCCGG - Intronic
903455505 1:23484260-23484282 GCGGCTGGAGGGTCGGGGGCGGG - Intronic
903614832 1:24643850-24643872 GAGGGAGGACGTTGGGGGGCGGG - Intronic
903737145 1:25537281-25537303 GTGTCAGGAGACCTGGGGGCTGG - Intergenic
903758905 1:25684183-25684205 GAGGCAGGTGGCTGGGGGGCTGG - Intronic
903861580 1:26367808-26367830 GGGGCAAGGGGCTTGGGGGCTGG + Intronic
903968876 1:27106328-27106350 GTGGCTGGAGGGCTGGGGGCAGG + Intronic
904431819 1:30469221-30469243 TTGGGAGGAGGTTCTGGGGCAGG - Intergenic
904608927 1:31714710-31714732 GTGGGAGGTGGTGGGGGGGCGGG + Intergenic
905169357 1:36099989-36100011 GAGGCAGGGGATTTGGGGGCTGG + Intronic
905295310 1:36950918-36950940 GGGGCAGGAGGGTTTGGGGTGGG + Intronic
905300927 1:36985779-36985801 GTGGCAGGAGTTCTGGGGAGTGG - Intronic
905906049 1:41619138-41619160 GTGGCTGGAGGAGTGGGGGTGGG - Intronic
905974897 1:42167824-42167846 GGGGCAGGAGTTTCGGAGGCTGG + Intergenic
906083145 1:43107524-43107546 GTGGGAGGTGGTGGGGGGGCGGG + Intergenic
906126648 1:43431093-43431115 GTGGCAGCAAGTTTGGTGGGGGG + Intronic
906196374 1:43933029-43933051 TTGGCAGGTGGGTTGAGGGCTGG - Intergenic
906607665 1:47183071-47183093 GATGAAGGATGTTTGGGGGCGGG + Intergenic
906688063 1:47775285-47775307 GGAGCAGGAGGTGTGGGGACAGG + Exonic
907456702 1:54580982-54581004 GTGGCAGGAGCTACGGTGGCTGG + Intronic
909278128 1:73714775-73714797 TGGGCAAGAGGTTTGGGGCCAGG + Intergenic
910288407 1:85578205-85578227 GGGCCAGGAGGTGTGGGAGCGGG - Intronic
911031576 1:93494465-93494487 TTCCCAGGAGGTTTGGGGGTGGG + Intronic
912654914 1:111477597-111477619 TTGGCAGGTGGGTGGGGGGCAGG - Intronic
912682463 1:111738286-111738308 GTGGCAGGTGGCGTGGGGGCGGG + Intronic
912881892 1:113423885-113423907 GTGGCGGGTGGGGTGGGGGCGGG + Intronic
913114362 1:115682936-115682958 GTGGCAGGAGGCTGGAGGCCAGG + Intronic
913518334 1:119623597-119623619 GTGGCGGGGGGCTTCGGGGCCGG - Exonic
913595484 1:120371987-120372009 GTGCCAGCAGATCTGGGGGCTGG - Intergenic
914049452 1:144119462-144119484 CTGGCAGGTGATTTGGGGGCAGG - Intergenic
914091792 1:144506988-144507010 GTGCCAGCAGATCTGGGGGCTGG + Intergenic
914129732 1:144845978-144846000 CTGGCAGGTGATTTGGGGGCAGG + Intergenic
914306749 1:146426876-146426898 GTGCCAGCAGATCTGGGGGCTGG - Intergenic
914595300 1:149145926-149145948 GTGCCAGCAGATCTGGGGGCTGG + Intergenic
915066325 1:153227959-153227981 GGGACAGGAGGTGTGTGGGCAGG + Intergenic
915079315 1:153340701-153340723 GGGGCAGGGTGGTTGGGGGCAGG - Intronic
915149207 1:153816365-153816387 GGAGCAGGAGGTTTAGGGGGTGG + Exonic
915570919 1:156744639-156744661 GAGGCGGGAGGGTGGGGGGCGGG - Intronic
916346509 1:163797769-163797791 CTGGCAGGAGGTGTGGGGGGTGG - Intergenic
917211764 1:172638950-172638972 GTGTCCTGTGGTTTGGGGGCTGG + Intergenic
917213565 1:172655540-172655562 ATAGCAGGAGAGTTGGGGGCAGG + Intergenic
917286197 1:173423905-173423927 GTGCCAGCAGGTTTGGTGGCTGG + Intergenic
918043200 1:180925746-180925768 GTGGCTGGAGGGGTGGGGGAAGG + Intronic
918124424 1:181570276-181570298 GTGGTAGGGGATTTGGGTGCAGG + Intronic
919887810 1:201947608-201947630 GTGGCAGGAGGAAGGGGGGCAGG - Intergenic
920113168 1:203601197-203601219 GTGGCAGGAGGGATGGGGTGTGG - Intergenic
920186246 1:204161196-204161218 GTGGCAAGAGGGATGGGAGCTGG + Intronic
920333417 1:205228234-205228256 GAAGCAGAAAGTTTGGGGGCCGG + Exonic
920439446 1:205969419-205969441 GTGCCAGGTGCTGTGGGGGCAGG + Intergenic
920826151 1:209425910-209425932 GTGGCAGTTAGTTTTGGGGCTGG + Intergenic
922449165 1:225722866-225722888 GAGGCAGGAGGACTGGGGTCAGG + Intergenic
922775629 1:228213161-228213183 GAGACAGGAAGTTGGGGGGCGGG - Intronic
923107324 1:230864812-230864834 GTGACAAGAAGATTGGGGGCAGG + Intronic
923393604 1:233538039-233538061 GTGCCAGGAGATTTGGTGTCTGG - Intergenic
924365610 1:243290202-243290224 GTGGCAGGGGATCGGGGGGCGGG - Intronic
924470196 1:244336641-244336663 GTGGAAGGAGGGTTGGGGTCTGG - Intergenic
924665024 1:246062964-246062986 GTGGTAGCAGGTTTGGGAGTGGG - Intronic
1063505583 10:6595212-6595234 GTGGCAGTGGGCTTGGGGGAGGG - Intergenic
1063606805 10:7529669-7529691 GTGGTAGGAGGTGGGGGGGATGG + Intergenic
1063661013 10:8035020-8035042 GTTGCGGGAGGGTTGGGGGGTGG + Intergenic
1064088048 10:12360457-12360479 ATGGGAGGATATTTGGGGGCAGG - Intronic
1064599958 10:16983796-16983818 ATGGCATGAGGTATGGAGGCTGG + Intronic
1065074277 10:22061133-22061155 GTGGCAGCAAGGTTGGGGGAGGG + Intergenic
1065554340 10:26899955-26899977 GTGCCAGCAGGTTTGGTGTCTGG + Intergenic
1065918456 10:30371004-30371026 GTGGGAGGAGGTTGGGGGGCTGG + Intronic
1065954772 10:30684049-30684071 CTGGAAGGGGGTCTGGGGGCCGG - Intergenic
1067167685 10:43878565-43878587 GGGGCAGGAGGCTGCGGGGCAGG - Intergenic
1067560137 10:47299821-47299843 GTGGCATGAGCTTTGGGGTGAGG + Intergenic
1068932039 10:62601178-62601200 GTGCCAGCAGGTTTGGTGCCTGG + Intronic
1069414460 10:68185452-68185474 GTGGCAGGGGGTGTTGGGGAGGG - Intronic
1069637376 10:69933495-69933517 GAGACAGGATGTTTGGTGGCGGG + Intronic
1070480583 10:76878717-76878739 GAGTCAGGGCGTTTGGGGGCTGG + Intronic
1070533465 10:77358153-77358175 GTTGCAGGAGTCTTGGGGGTGGG - Intronic
1071500376 10:86199520-86199542 ATGGCTGGAGAGTTGGGGGCTGG - Intronic
1071563506 10:86660087-86660109 GAGGCTGAAGGTGTGGGGGCAGG + Intronic
1071571665 10:86700586-86700608 GTGGCAGGAGGCAAGAGGGCTGG + Intronic
1072013954 10:91327564-91327586 GTGGCAGCAAGGTTGGGGGAGGG - Intergenic
1073072327 10:100802590-100802612 CTGGCAGAAGGTTTTGGGACTGG - Intronic
1073096529 10:100983583-100983605 GTGGCAGGGGCTTTTGGAGCTGG - Exonic
1073101532 10:101009121-101009143 GTGGGAGGAGGCTTGGGGTGAGG - Intronic
1073572017 10:104588899-104588921 ATGGCAGAGGGTTTGGCGGCAGG - Intergenic
1074103370 10:110371221-110371243 CTGTCAGGAGGTTGGGGGCCAGG + Intergenic
1075065824 10:119288265-119288287 GTGGCAGAAGGTCTGTGGACAGG + Intronic
1075475493 10:122730223-122730245 GGGGCAGGAGGTTTGGGGAGAGG - Intergenic
1075684241 10:124353079-124353101 GTAGCTGGGGGTTTGGGGGGAGG - Intergenic
1076066960 10:127456280-127456302 TTGGCAGGTGGCTTGGGAGCTGG + Intergenic
1076131714 10:128018141-128018163 GTGGTAGGAGCTTTGGGGCTGGG + Intronic
1076398236 10:130157342-130157364 GGGGCAGGAGGGGTGGGGGATGG + Intronic
1076445614 10:130512034-130512056 GAGGCAGGAGGTCTGTGGTCAGG + Intergenic
1076701658 10:132276330-132276352 GTGCCAGGAGGTCTGTGGGATGG - Intronic
1076721355 10:132394765-132394787 GTGGGAGCAGGTGCGGGGGCAGG + Intergenic
1076897329 10:133319018-133319040 GTGGGAGGAGGTGTGGGAGCAGG + Intronic
1077108761 11:853050-853072 GTGGCTGTGGGTGTGGGGGCAGG + Intronic
1077392411 11:2306265-2306287 GAGGCCGGAGGGGTGGGGGCAGG - Intronic
1077407092 11:2387543-2387565 GAGGCAGGAAGGGTGGGGGCTGG - Intronic
1078655306 11:13233353-13233375 GTGGGAGGGAGTGTGGGGGCTGG + Intergenic
1078737548 11:14034411-14034433 TTGCCAGGAGGTTTGAGAGCAGG + Intronic
1079003775 11:16778619-16778641 GTGACAGGTGTTGTGGGGGCAGG - Intronic
1079060995 11:17248700-17248722 GTGGCAGCAGGTTCAGAGGCAGG + Intronic
1079110414 11:17602143-17602165 GGGGCAGGAGGTATGGGAGGTGG + Intronic
1079142345 11:17820249-17820271 TGGGCAGGAAGTTTGGGGGAGGG - Intronic
1079480613 11:20875990-20876012 GTGGGAGGGGGTTTGAGAGCAGG - Intronic
1080999922 11:37656158-37656180 GTAGCATGAGGTATGGGGGAAGG - Intergenic
1082097895 11:48146066-48146088 GTGGAAGGAGGCTTGAGGCCAGG - Intronic
1082579656 11:54850358-54850380 GTGGCAGCAAGTCTGGGGGAGGG + Intergenic
1083805210 11:65069392-65069414 GTGGCAGGGGGCTTGTGGCCTGG + Intronic
1083806572 11:65077927-65077949 GCGGCAGGAGAGTCGGGGGCAGG + Exonic
1083942400 11:65903431-65903453 ATCGCTGGAAGTTTGGGGGCAGG + Intergenic
1083962027 11:66020060-66020082 GTGGAAGGAGGTTAGGGGGATGG + Intronic
1084164051 11:67366926-67366948 GTGGCAGGGGGTTTAGGGTGTGG - Intronic
1084403067 11:68956107-68956129 GGGGCTGGGGGTTGGGGGGCAGG + Intergenic
1085204737 11:74724565-74724587 GTAGGAGGAGGCCTGGGGGCTGG - Intronic
1085266293 11:75240034-75240056 GTCTTAAGAGGTTTGGGGGCAGG + Intergenic
1085282732 11:75341608-75341630 GAGGCAGGAGGTTTGGAGTTTGG - Intronic
1085744425 11:79102523-79102545 GTACCAGGAGCTTTGGGAGCAGG - Intronic
1085765319 11:79276971-79276993 TGGGCAGGAGGATTGGGGGTGGG - Intronic
1086062605 11:82715281-82715303 TTGGCAGGAGGATGGAGGGCAGG - Intergenic
1086371052 11:86156315-86156337 GGGTCAGGAGGTTTTGGGTCAGG - Intergenic
1086827702 11:91519450-91519472 CTGGCAGGGGGGTGGGGGGCGGG + Intergenic
1088223931 11:107598613-107598635 GTGCAAGGAGGTTTGGGGAAAGG - Intronic
1089114684 11:116085174-116085196 GGGGTAGGAGTTTGGGGGGCGGG - Intergenic
1089242989 11:117098025-117098047 GTGGTGGGAGCGTTGGGGGCCGG - Intronic
1089411535 11:118247116-118247138 TTGGCAGGAGATTGGAGGGCAGG - Intronic
1090031337 11:123209184-123209206 GTGGGAGAAGGGTTGGGGGAGGG + Intergenic
1090084638 11:123640532-123640554 GTGGCAGGGGGTTGGGGTGGTGG + Intronic
1090242459 11:125193769-125193791 GAGGCAGCACGGTTGGGGGCAGG + Intronic
1090923774 11:131231633-131231655 ATGGCAGAAGGCTTGGGGCCAGG + Intergenic
1090979349 11:131703934-131703956 GAGGCTGGAGCTGTGGGGGCTGG - Intronic
1091066103 11:132514730-132514752 GTGGTAGGAAGTTTGGGGCTGGG + Intronic
1092241906 12:6840726-6840748 CCGGGAGGAGGGTTGGGGGCAGG - Intronic
1092763142 12:11827546-11827568 TGGACAGGAGGTGTGGGGGCAGG - Intronic
1092846665 12:12590401-12590423 GTGGAAGGAAGTTTGGTGGAAGG + Intergenic
1092846742 12:12590688-12590710 GTGGAAGGAAGTTTGGGTGGAGG + Intergenic
1093058539 12:14579176-14579198 GTGGCTGGAGGTGGGGGGGTGGG + Intergenic
1093770664 12:23013946-23013968 GTGCCAGCAGATTTGGTGGCTGG + Intergenic
1093805182 12:23423338-23423360 GTGGTGGGAAATTTGGGGGCAGG - Intergenic
1095180588 12:39143469-39143491 AAGGGTGGAGGTTTGGGGGCGGG - Intergenic
1095946606 12:47757524-47757546 GAGGTGGGAGGTATGGGGGCCGG - Intronic
1096217658 12:49807194-49807216 GCAGCTGGATGTTTGGGGGCTGG + Intronic
1096226167 12:49868152-49868174 GTGGCAGGAGAGTGGGGTGCTGG + Exonic
1096716101 12:53492736-53492758 GGGGAGGGAGGTTGGGGGGCAGG - Intronic
1096815260 12:54197794-54197816 GTCCCAAGAGGCTTGGGGGCAGG + Intergenic
1097007454 12:55929459-55929481 GAGGCAGGATGTCTGGGGGTGGG - Intronic
1097041384 12:56158148-56158170 GTGGGGGGAGGTGGGGGGGCGGG - Exonic
1097058788 12:56267214-56267236 GTGGCAGAGGGCCTGGGGGCGGG - Exonic
1097118617 12:56717073-56717095 GTGGCAACTTGTTTGGGGGCTGG + Intronic
1097123369 12:56753203-56753225 GAGGCTGAAGGGTTGGGGGCGGG + Intronic
1097177790 12:57153279-57153301 GAGGCAGGAAGTCTGGGGACAGG - Intronic
1097249292 12:57623710-57623732 GTGGAAGGAGATTTGGGAGAAGG + Intronic
1097634587 12:62107194-62107216 GTGGGAGTGGGTTGGGGGGCGGG - Intronic
1098887653 12:75976471-75976493 GTGGCAGGGGGTTGGCGGGGAGG + Intergenic
1100901492 12:99246209-99246231 GTTGAGGGAGGTTTGGGGGAAGG - Intronic
1101385487 12:104253616-104253638 GTGGCAGGCGGTGCGGGGGAGGG - Intronic
1101546819 12:105721340-105721362 GTGGCATGAGGTTGGGGGATGGG + Intergenic
1101815176 12:108140708-108140730 CTGGCAGGGGGTCAGGGGGCAGG - Intronic
1102316880 12:111895525-111895547 GTGGCAGCAGGGTGGGGGGTGGG - Intronic
1102757764 12:115357114-115357136 GTAGAGGGAGATTTGGGGGCAGG + Intergenic
1102896452 12:116602120-116602142 GAGAGAGGAGGTTGGGGGGCGGG - Intergenic
1102958469 12:117075242-117075264 TTGGCAGCGGGTTTGGGTGCTGG - Intronic
1103565731 12:121814423-121814445 GTGGCAGGATGGGTGGGGGCGGG - Exonic
1103976021 12:124703271-124703293 GTGGCAGGTGGTCTGAGAGCAGG + Intergenic
1104039977 12:125123421-125123443 ATGGCTGGAGTTTTGGGGGAGGG - Intronic
1104123309 12:125819839-125819861 GTGCCAGCAGGTTTGGTGTCTGG + Intergenic
1104304861 12:127600420-127600442 GTGGCAGGTGGAATGAGGGCAGG + Intergenic
1105441201 13:20416421-20416443 CTGGCAGGAGGTCTGGAGGCAGG + Intronic
1105578555 13:21674171-21674193 GCGGCAGGAGAGTTGGTGGCGGG + Intronic
1106510521 13:30408709-30408731 GAGCCAGTAGGTTTGGAGGCCGG - Intergenic
1107504226 13:41015259-41015281 ATGGCAGTAGGTTTCGGGGGTGG + Intronic
1107974660 13:45677814-45677836 TGGGCAGGAGGTTGCGGGGCAGG - Intergenic
1109190580 13:59318413-59318435 GAGGCAAGAGATTTGGGGGAAGG - Intergenic
1111885417 13:94014671-94014693 ATGGAAGCAGGTGTGGGGGCTGG - Intronic
1112501963 13:99949882-99949904 GTGGCAGGAGGGGAGGAGGCTGG + Intergenic
1112521105 13:100095908-100095930 GTGGGAGTAGGATTGGGGACTGG + Intronic
1113485021 13:110646974-110646996 TGGACAGGAGGTTTGGGGTCAGG - Intronic
1113517931 13:110917264-110917286 GTGGCAGGAGGATTGTGGATAGG + Intergenic
1113574509 13:111384931-111384953 GTGGCAGGATGTTGGGGGAAGGG + Intergenic
1113921821 13:113917646-113917668 GTGGCAGGACGACTGGGGTCCGG - Intergenic
1114271455 14:21102770-21102792 GCTGCAGGAGGTATGGGGGCAGG + Exonic
1115188471 14:30719957-30719979 GGGGCAGGGGGGTGGGGGGCGGG + Intronic
1116718734 14:48464338-48464360 TTGGCGGGAGGATTGGGGGCCGG + Intergenic
1116790948 14:49339377-49339399 GTGGCAGGGGGTGTGTGGGTTGG - Intergenic
1117261009 14:54033409-54033431 GTGGCAGAAGGGCTGGGGGAGGG - Intergenic
1117264100 14:54067767-54067789 GTAGCAGGGGGTTGGTGGGCGGG - Intergenic
1117322860 14:54640659-54640681 GTGGCACGAGGCTTTGGGGATGG + Intronic
1117387461 14:55230431-55230453 ATGGCCGGAGGTGTGGGGGTTGG + Intergenic
1118166541 14:63341707-63341729 GGGGGAAGAGGTTTGGGAGCAGG + Intergenic
1118763050 14:68892303-68892325 GGGGCAGGAGGTGAGGAGGCGGG + Intronic
1118764130 14:68898839-68898861 GTGGCATGAGATTTGGGAGGGGG + Intronic
1118836269 14:69480211-69480233 GTGGAAGGAGGCTTGGAGGAGGG + Intergenic
1118842776 14:69525486-69525508 GTGGGGGGTGGTTTGGGGACAGG + Intronic
1119392831 14:74302838-74302860 CGGGGAGGAGGTTTGGGAGCAGG - Intronic
1119431831 14:74573433-74573455 GTGGCAGGAGGTCAGAGGGCAGG + Intronic
1119817144 14:77580002-77580024 GTGGGAGGAGGCTTGTGGGGAGG - Intronic
1120286218 14:82505256-82505278 GTGGCATGAGGTTTGGGTAAGGG - Intergenic
1120528673 14:85606896-85606918 GTGGCAGGGGGTGTGGGGGAAGG - Intronic
1120987854 14:90349922-90349944 TTGGCAGCATGTTGGGGGGCGGG - Intergenic
1121019113 14:90568142-90568164 GAGGCAGGCGGTGTGGGGGATGG + Intronic
1121154758 14:91672376-91672398 GAGGCAGGAGGCTTGAGGCCAGG - Intronic
1121634632 14:95445654-95445676 ATTGCAGGGGGTTTGGGGACAGG + Intronic
1121834729 14:97081712-97081734 GTAGCAGAGGGTTTGGGGGTTGG - Intergenic
1121997270 14:98612912-98612934 GTGGTAGGAGGTTCTGGGGACGG + Intergenic
1122400056 14:101461718-101461740 GTGGCAGGAGGGCAGGGGCCAGG - Intergenic
1122417982 14:101559550-101559572 GTGCCTGGAGGATTGGCGGCGGG - Intergenic
1122692163 14:103536556-103536578 ATGCCAGGAGCTTTGGGGTCAGG + Exonic
1122724208 14:103739831-103739853 GTGGCAGGAGGGTGGCTGGCAGG + Exonic
1122771020 14:104097663-104097685 GGGGCAGGTGGGGTGGGGGCAGG + Intronic
1122811609 14:104292123-104292145 ATGGCGGGAGGTGGGGGGGCGGG - Intergenic
1122847829 14:104510411-104510433 GGGGCAGGAGGGGAGGGGGCAGG - Intronic
1122887820 14:104718332-104718354 GTGGCGGGAGCTGTTGGGGCAGG + Intronic
1122953119 14:105056734-105056756 GTGGCAGGAGGCGGGGGAGCGGG - Intronic
1122979617 14:105185655-105185677 TTGGCAGGGGGCTTGGGTGCGGG + Intergenic
1123061624 14:105597165-105597187 GTGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086129 14:105718239-105718261 GTGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123086362 14:105718895-105718917 GTGGCAGGAGGGGTGGGTGAAGG + Intergenic
1123403258 15:20005950-20005972 CTGGCAGTAGGTTTGGGGTGAGG - Intergenic
1123419328 15:20118698-20118720 CTGGCAAGTGATTTGGGGGCAGG - Intergenic
1123446537 15:20334805-20334827 CTGGCAAGTGATTTGGGGGCAGG + Intergenic
1123479251 15:20615999-20616021 GTGGCAGGAGCTGAGAGGGCGGG + Intergenic
1123512596 15:21012604-21012626 CTGGCAGTAGGTTTGGGGTGAGG - Intergenic
1123528550 15:21125240-21125262 CTGGCAAGTGATTTGGGGGCAGG - Intergenic
1123638762 15:22384386-22384408 GTGGCAGGAGCTGAGAGGGCGGG - Intergenic
1124096016 15:26649400-26649422 GTGGCAGTAGGTTTAGTGTCTGG - Intronic
1124417266 15:29482502-29482524 GTTGCCAGAGGTTTGGGGGAGGG - Intronic
1124805539 15:32878230-32878252 GTGGCTGGAGTTTAGTGGGCAGG + Intronic
1124960000 15:34386828-34386850 GCGGGAGGAGGTTGGAGGGCTGG + Intronic
1124976629 15:34533049-34533071 GCGGGAGGAGGTTGGAGGGCTGG + Intronic
1125720692 15:41843802-41843824 GGAGGATGAGGTTTGGGGGCTGG + Exonic
1125732441 15:41900680-41900702 GGGGCACGAGGTGGGGGGGCAGG + Exonic
1126895619 15:53254143-53254165 GTGGGAGGAGGGTTGAGGGCTGG + Intergenic
1127264631 15:57351586-57351608 CTGGCAGTTGGGTTGGGGGCTGG + Intergenic
1127618398 15:60709835-60709857 GGGGCAGGAGTGTTGGGGGATGG - Intronic
1127774081 15:62252109-62252131 GTGGGAGGAGGTTGGAGGGCTGG + Intergenic
1127775660 15:62262343-62262365 GTGGGAGGAGGTTTGAGGGCTGG + Intergenic
1127858877 15:62976463-62976485 GTGGGGAGAGGGTTGGGGGCTGG + Intergenic
1128063743 15:64751435-64751457 GTGGCAGAAGCTGTGGGGGCAGG - Intronic
1128088663 15:64904271-64904293 GGGACAGGAGGTTGGGGGTCAGG - Intronic
1128311808 15:66635633-66635655 GAGGCAGGAGGTTTGATGGATGG - Intronic
1128356163 15:66928344-66928366 GTGACAGGAAGGTGGGGGGCAGG - Intergenic
1128786500 15:70401366-70401388 GGGGGAGGCGGGTTGGGGGCGGG - Intergenic
1128800645 15:70494786-70494808 GTGGCTGGAGGCTTAGGTGCTGG + Intergenic
1128892723 15:71345191-71345213 GTGGCGGGGGGTTGGGGGGGTGG + Intronic
1129029352 15:72607369-72607391 GTGAGAGGAGGTTGGAGGGCTGG - Intergenic
1129037289 15:72658413-72658435 GTGAGAGGAGGTTGGAGGGCTGG - Intronic
1129212598 15:74078812-74078834 GTGAGAGGAGGTTGGAGGGCTGG + Intronic
1129397801 15:75262267-75262289 GTGAGAGGAGGTTGGAGGGCTGG - Intronic
1129401412 15:75286548-75286570 GTGAGAGGAGGTTGGAGGGCTGG - Intronic
1129406508 15:75322641-75322663 GTGGCGGGCGGCGTGGGGGCAGG + Intergenic
1129475012 15:75779248-75779270 GTGAAAGGAGGTTGGAGGGCTGG - Intergenic
1129518131 15:76169320-76169342 GAGGGAGGAGATTTGGGGTCGGG + Intronic
1129519727 15:76178074-76178096 GAGGCAGTAGGATTGGGGACAGG + Intronic
1129637361 15:77335000-77335022 GAGGCAGGAGGGTTGGTAGCTGG + Intronic
1129729735 15:77923133-77923155 GTGAGAGGAGGTTGGAGGGCTGG + Intergenic
1129838790 15:78730842-78730864 GTGAAAGGAGGTTGGAGGGCTGG - Intergenic
1130259928 15:82346766-82346788 GTGGGAGGAGGTTGGAGGGCTGG + Intronic
1130268797 15:82432670-82432692 GTGGGAGGAGGTTGGAGGGCTGG - Intronic
1130281301 15:82522243-82522265 GTGGGAGGAGGTTGGAGGGCTGG - Intergenic
1130472676 15:84238426-84238448 GTGGGAGGAGGTTGGAGGGCTGG - Intronic
1130480167 15:84352997-84353019 GTGGGAGGAGGTTGGAGGGCTGG - Intergenic
1130491602 15:84435132-84435154 GTGGGAGGAGGTTGGAGGGCTGG + Intergenic
1130503217 15:84514172-84514194 GTGGGAGGAGGTTGGAGGGCTGG + Intergenic
1130594970 15:85243060-85243082 GTGGGAGGAGGTTGGAGGGCTGG - Intergenic
1130688969 15:86063887-86063909 GTTGCTGGAGGGTGGGGGGCGGG + Intergenic
1130689936 15:86073420-86073442 GGGGTAGGAGGTTTGGGTGGTGG + Intergenic
1130903256 15:88223038-88223060 CTGGCAGGAGGGTGGGCGGCAGG + Intronic
1130979055 15:88800367-88800389 GTGGCAGGAGGTCCTGGGACAGG + Intergenic
1131069865 15:89459534-89459556 CTGGCAGGAGGCTGGGGTGCAGG - Intergenic
1131257772 15:90872934-90872956 GTGTCAGGAGGTTCTGGTGCTGG + Exonic
1132433592 15:101779303-101779325 GTGGGAGGAGGTTGGAGGGCTGG + Intergenic
1132497660 16:271316-271338 CTGGAAGGGGGTATGGGGGCTGG + Intronic
1132587828 16:713941-713963 GTGGCAGGAGGTTTGGGGGCAGG + Intronic
1132856403 16:2047036-2047058 GTGGCAGGAGCTTTGATGCCAGG - Intronic
1132893070 16:2214102-2214124 GGGGCGGGAGGCTGGGGGGCGGG - Intronic
1133292988 16:4734873-4734895 GTGGCAGGCCGGCTGGGGGCGGG + Intronic
1133414254 16:5593988-5594010 TGGGCAGAAGGTGTGGGGGCAGG - Intergenic
1134119038 16:11570816-11570838 GTAGAAGGAGGTTGGGGGGTGGG + Intronic
1134687531 16:16169346-16169368 CTGTCTGGAGGTTTGGGGGCAGG + Intronic
1134832393 16:17334124-17334146 GTGCCAGCAGGTTTGGGGTCTGG - Intronic
1135279487 16:21141500-21141522 GTGGCAGGAGATGTGGGCTCAGG + Intronic
1136285071 16:29236049-29236071 GAGGCACGGGGTTTGGGAGCCGG - Intergenic
1137350041 16:47705608-47705630 ATGGCAGGTGGTCTGGGAGCTGG + Intergenic
1138101279 16:54254093-54254115 GTGGCAGGAGGATTTGAGGTTGG - Intronic
1138649558 16:58451555-58451577 CTGGCAGGGGGTTGGGGGGGGGG + Intergenic
1139911494 16:70400090-70400112 GTGTCAGGAGGTGTGGTTGCTGG + Exonic
1140049169 16:71464366-71464388 GTCGATGAAGGTTTGGGGGCAGG - Intronic
1141563932 16:84888604-84888626 GTGGCAGGAGGTGTGGGCAGGGG - Intronic
1141800138 16:86302325-86302347 GTGGATGGAGGTTTGGGAGTGGG - Intergenic
1142112332 16:88339380-88339402 GTGGCAGGGGGATGGGGGACAGG + Intergenic
1142141045 16:88473009-88473031 TGGGCAGGAGGTCTGGGCGCAGG + Intronic
1142185906 16:88694620-88694642 GTGGCACGGGGCTTGGGAGCAGG + Intergenic
1142320235 16:89377475-89377497 GGGGCAGGAGGGCTGGGGGGCGG + Intronic
1142360855 16:89626066-89626088 GTGGCGGGAGGACGGGGGGCAGG - Intronic
1203137763 16_KI270728v1_random:1740024-1740046 CTGGCAGGTGATTTGGGGGCAGG + Intergenic
1142472787 17:172500-172522 GGGGCAGGGAATTTGGGGGCAGG + Intronic
1143021765 17:3920432-3920454 GTGTCAGCAGGATTGGGAGCTGG - Intergenic
1143096389 17:4480682-4480704 GTGGAAGGAGGGTTAGGGGCTGG + Intronic
1143325549 17:6095915-6095937 GTGGCAGTAGGCTTGGGGCTGGG + Intronic
1143758187 17:9081725-9081747 ATGGCAGGAGGCTGGGGGTCAGG + Intronic
1143771350 17:9171012-9171034 GCGGCAGGAAGTTGGGGGGAGGG - Intronic
1144171491 17:12663869-12663891 GTGGAGGGAGGTTTGGGAACGGG - Intergenic
1144206648 17:12984371-12984393 GTGGCAAGAGGCCGGGGGGCAGG + Intronic
1144682285 17:17204118-17204140 GAGGCAGGAGGTGTGGGCGATGG - Intronic
1144967887 17:19089362-19089384 GTGGCGGGAGGGTTGGGGGCGGG - Intergenic
1144980030 17:19162701-19162723 GTGGCGGGAGGGTTGGGGGCGGG + Intergenic
1144988192 17:19215531-19215553 GTGGCGGGAGGGTTGGGGGCGGG - Intergenic
1145819148 17:27818019-27818041 GGGTCAGGAGGGTTGGGGGAAGG - Intronic
1146418916 17:32664242-32664264 GTGGCAGGAGGGTTGTTGGTTGG + Intronic
1146752219 17:35391849-35391871 GTGGCGGCAGGTATGGGGGGGGG - Intergenic
1147399932 17:40174611-40174633 CTGGCAGGAGGTTTGAGTGTTGG + Intergenic
1147419346 17:40314442-40314464 GTGGCAGGAGGAGGTGGGGCAGG + Intronic
1147491082 17:40866936-40866958 ATGGCAGGAGGACTGGGTGCTGG - Exonic
1147533551 17:41302456-41302478 CTGGCAGGAGCTTTGCTGGCAGG + Exonic
1148680481 17:49470636-49470658 GTGGGAAGAGCATTGGGGGCAGG + Intronic
1149309130 17:55377144-55377166 GTGGCGGGAGGGTTGGTGGGAGG + Intergenic
1149458083 17:56805435-56805457 GGGGCAGGAGGAGTGGGTGCAGG - Intronic
1149572266 17:57680879-57680901 GTGGGAGCAGGGTGGGGGGCAGG - Exonic
1149850411 17:60030510-60030532 GTGTCTGGAGGTGTGGGGCCAGG + Intergenic
1149859755 17:60116014-60116036 GTGTCTGGAGGTGTGGGGCCAGG - Intergenic
1149998951 17:61420203-61420225 GTGGCAGGGGGCTTGGCTGCAGG + Intergenic
1150161045 17:62898428-62898450 TTGGAAAGAGGTTTGGGGGGTGG + Intergenic
1150502669 17:65665957-65665979 GTGGAAGTTGGTTTGGGAGCTGG - Intronic
1150625172 17:66836694-66836716 GAGAGAGGAGGTTTGGGGGTGGG - Intronic
1151317869 17:73335077-73335099 GGGGTAGGAGTTTTGGGGGCCGG + Exonic
1151602330 17:75113909-75113931 GTGGGAGCAGGTTTAGGGCCTGG + Intronic
1152169525 17:78735180-78735202 GGGGCATGAGGTTAGGGGCCGGG - Intronic
1152684896 17:81689097-81689119 GTGGCAGGACTCCTGGGGGCCGG + Intronic
1152801872 17:82334338-82334360 GGGGCAGGAGATTGGGGTGCGGG + Intergenic
1152863326 17:82708878-82708900 GGGGCAGGTGGTAAGGGGGCAGG - Intergenic
1153166818 18:2271020-2271042 GTGGCAGCAGGTTTGGTGCCTGG - Intergenic
1153265184 18:3262400-3262422 GAGGGAGGAGGGTTGGCGGCGGG + Exonic
1153642640 18:7169835-7169857 GTGGCAGGGGTTTTGGGGGTGGG - Intergenic
1153665018 18:7360665-7360687 GTGGAGGGAGAATTGGGGGCGGG + Intergenic
1155123536 18:22847389-22847411 GTGACATTAGGTTTGGGGCCAGG - Intronic
1157116549 18:44867682-44867704 GTGGAAGGTGTCTTGGGGGCAGG - Intronic
1157331790 18:46709337-46709359 GTGGCAGAAGATTTGGTGTCTGG - Intronic
1157454016 18:47810265-47810287 GGCTCAGGAGGTTTGGGGACAGG - Exonic
1157501979 18:48197247-48197269 GAGGCAGGATGATTGGAGGCAGG - Intronic
1157620498 18:49014512-49014534 GTGGCAGGAGGTTGGGCCACCGG + Intergenic
1157911774 18:51623220-51623242 GTGGCAGGAGGTGTGTGTGTAGG - Intergenic
1158868166 18:61658133-61658155 ATGGGAGGGGATTTGGGGGCAGG + Intergenic
1158905522 18:62007626-62007648 GTTGCCAGAGGTTTGGGGGAGGG + Intergenic
1159224473 18:65514299-65514321 GTGGCAGTAGCTATGGTGGCTGG - Intergenic
1159966151 18:74597956-74597978 GGGGCGGGGGGTTTGGAGGCGGG + Intronic
1160837118 19:1129966-1129988 GGGGCAGGAGTTTTGGGTGGAGG - Intronic
1160865222 19:1253217-1253239 GGGGCAGGGGGGTAGGGGGCCGG + Intronic
1160891223 19:1379739-1379761 GGGCCAGGTGGTTGGGGGGCTGG - Intergenic
1161349132 19:3782862-3782884 GTGGGTGGAGGTTCGGGGCCAGG + Intronic
1161470743 19:4455747-4455769 GTGGGAGGAGGATGGGGGTCTGG + Intronic
1161627088 19:5333604-5333626 GTGGCTGGAGGTGAGGGGGGCGG - Intronic
1162140914 19:8585193-8585215 GTGGCCGGTGGCTTGGCGGCGGG + Exonic
1162176411 19:8832971-8832993 GTGGCAGCAAGCCTGGGGGCGGG + Intronic
1162413641 19:10520992-10521014 GTGGGAGGAGGTATGGGGTGGGG - Intergenic
1162858975 19:13491290-13491312 GTGCCATGAGCTCTGGGGGCTGG + Intronic
1163015282 19:14450871-14450893 GTGGTGGGAAGTGTGGGGGCTGG - Intronic
1163125713 19:15243191-15243213 GCGGCAGGGGGGGTGGGGGCTGG + Exonic
1163446352 19:17348780-17348802 CTGGCAGTAGGCTTAGGGGCAGG + Intergenic
1163663429 19:18591979-18592001 CTGCCTGGAGGTTTGGCGGCGGG + Intronic
1163694829 19:18758858-18758880 GTGGCAGGGGTTCCGGGGGCAGG - Intronic
1164721877 19:30438498-30438520 CTGGCAGCAGGGTTGGGGGTGGG + Intronic
1165391163 19:35539716-35539738 GGTGCAGGAAGTTTGTGGGCAGG + Intronic
1165636272 19:37342958-37342980 GTGGCATTAGCTTTGGGAGCAGG - Intronic
1165832340 19:38735978-38736000 GGGGCAGGGGTTCTGGGGGCGGG + Intronic
1165833081 19:38738706-38738728 GTGGCAGGAGGTTGGGGGCAGGG - Intronic
1166344685 19:42157832-42157854 GTGGGAGGAGATTTGGAGGAAGG + Intronic
1166634022 19:44433551-44433573 GTGGCGGGAGAGTTGGGGGGCGG - Intronic
1166812521 19:45522679-45522701 GGGGCAGGAGCTTTAGGGGCAGG - Intronic
1167169214 19:47820025-47820047 CTAGCAGGGGGTTTGGGGGAGGG + Intronic
1167192357 19:48000213-48000235 GGGGCAGGATTTTTGGGGGGCGG - Intronic
1167197730 19:48042257-48042279 TTGGCAGGAAGATTGGAGGCAGG - Intronic
1167260929 19:48457270-48457292 AAGGCAGGAGGCCTGGGGGCTGG - Intronic
1167715312 19:51139161-51139183 GTGCCAGCAGGTTTGGTGTCTGG + Intergenic
1202688840 1_KI270712v1_random:72030-72052 CTGGCAGGTGATTTGGGGGCAGG - Intergenic
924960817 2:32923-32945 CTGGGTGGAGGTTAGGGGGCAGG - Intergenic
925017705 2:543971-543993 GAGGCAGGAGGGTGGGAGGCAGG + Intergenic
925604174 2:5641342-5641364 GTGCCAGCAGATCTGGGGGCTGG - Intergenic
925681803 2:6429997-6430019 GAGGCAGGGGGATTGGGGGTGGG + Intergenic
925905445 2:8537216-8537238 GGGTCAGGATGTGTGGGGGCTGG - Intergenic
925969589 2:9096987-9097009 GTGCCAGCAGGGGTGGGGGCAGG + Intergenic
926010004 2:9400195-9400217 GGGGCAGGAGGGGAGGGGGCAGG - Intronic
926010012 2:9400210-9400232 GGGGCAGGAGGGGAGGGGGCAGG - Intronic
926010020 2:9400225-9400247 GGGGCAGGAGGGGAGGGGGCAGG - Intronic
926931559 2:18046439-18046461 GTGGCAGTGGGTATGGGGGATGG + Intronic
927062858 2:19440781-19440803 GAGGCAGGGGGTTTGGGGGCTGG - Intergenic
927667830 2:25044431-25044453 GAGTAAGGAGGTTTGGGGGCGGG + Intronic
927709197 2:25314580-25314602 GTGGCGGGAGGTGTGGGGGTGGG - Intronic
927879087 2:26677850-26677872 GTGGCAGCAGCTGTGGTGGCAGG + Intergenic
927959479 2:27232016-27232038 GTGGCAGCTGCTTTGTGGGCTGG + Exonic
927967199 2:27278106-27278128 GTGCCAGGAGGATTGAGGGAGGG + Intronic
928130186 2:28643381-28643403 GTGGCAGGCAGTTTGGGCTCTGG - Exonic
931021280 2:58047169-58047191 GTGGCGGGAAGTTGGGGCGCGGG + Intronic
931022939 2:58070478-58070500 GTTGCCTGAGGTTTAGGGGCAGG - Intronic
931154245 2:59609123-59609145 GTGGCAGGAGGCTGGGGGAGTGG - Intergenic
931638597 2:64362162-64362184 GAGGGAGGACGTTTGGGGGAAGG + Intergenic
932457106 2:71856937-71856959 GGGGCAGGCGGTGTGAGGGCAGG + Intergenic
932559515 2:72855039-72855061 GTGGCAGGAGACTTGGGAGCTGG - Intergenic
933319616 2:80757421-80757443 GTGGCAGGAGGATATGGGGAGGG + Intergenic
933957595 2:87384069-87384091 CTGGCAGGTGATTTGGGGGCAGG + Intergenic
934086414 2:88513523-88513545 GTGTCAGGTGATTTGGGGGAGGG + Intergenic
934118050 2:88814189-88814211 GTGGAAGGAGCCATGGGGGCAGG - Intergenic
934241715 2:90275964-90275986 CTGGCAGGTGATTTGGGGGCAGG + Intergenic
934271457 2:91540721-91540743 CTGGCAGGTGATTTGGGGGCAGG - Intergenic
934588674 2:95527238-95527260 TTGGCACGGGGTTTGAGGGCTGG + Intergenic
935707100 2:105866483-105866505 GTGGCAGGAGGTGGGGGCGATGG + Intronic
936013400 2:108940346-108940368 GAGGGAGGACGTATGGGGGCTGG + Intronic
936161584 2:110087454-110087476 GTGGAAGGAGCCATGGGGGCAGG - Intronic
936183079 2:110283900-110283922 GTGGAAGGAGCCATGGGGGCAGG + Intergenic
936403863 2:112185450-112185472 GAGGCAGGAGGCTGGGAGGCTGG + Intronic
936527783 2:113253474-113253496 GTGGCAGGAGGTTGAGTGGAAGG - Intronic
937116888 2:119413006-119413028 GAGGCAGGAGGCATGGAGGCAGG - Intergenic
937118793 2:119427924-119427946 TTGGCAGGAAGGTCGGGGGCTGG + Intergenic
937278130 2:120699391-120699413 GAGGCAGGAGAATTGTGGGCAGG + Intergenic
937342603 2:121100863-121100885 GTGGCAGCTGGGTGGGGGGCTGG + Intergenic
937350984 2:121161563-121161585 GTGGCAGAAATTTTGGGGGTGGG - Intergenic
938287023 2:130127584-130127606 GTGGCAGAAAGTCTGGGGACTGG - Intronic
938352358 2:130608398-130608420 GTAGGAGGAGGTTCGGGAGCTGG + Intergenic
938428570 2:131211286-131211308 GTGGCAGAAAGTCTGGGGACTGG + Intronic
938469472 2:131545304-131545326 GTGGCAGCAAGTCTGGGGGCCGG + Intergenic
938563435 2:132495292-132495314 GTGGCAGTGGCTTTTGGGGCAGG + Intronic
940158053 2:150680321-150680343 GTGGCAGCAGATTTGGAGTCTGG + Intergenic
940257222 2:151743754-151743776 GTGGCAGCAGGGCTGGGGGATGG + Intergenic
940650650 2:156436736-156436758 GTGGCAGGACTTTTGGGGCGAGG + Intronic
942079285 2:172385118-172385140 GAGGCAGGTGGGGTGGGGGCGGG - Intergenic
942459411 2:176159202-176159224 CTGGCAAGAGGCTAGGGGGCGGG + Intronic
942609529 2:177728363-177728385 GTGGGGGCAGGGTTGGGGGCGGG + Intronic
942986887 2:182153853-182153875 AGGGTAGGAGGTTTGGAGGCAGG + Intronic
944476309 2:200110376-200110398 CTGGCAGAAGGTTTGGTGGATGG - Intergenic
944673642 2:202016752-202016774 GGAGGAGGAGGTGTGGGGGCGGG + Intergenic
944965498 2:204927417-204927439 GTGCCAGCAGGTTTGGTGTCTGG - Intronic
945336740 2:208600986-208601008 GTGGCAGGAGGTGGTGGGGTTGG + Intronic
945725691 2:213470401-213470423 TTGGCAGGAGCATTGTGGGCAGG + Intronic
945858889 2:215098237-215098259 ATTGCAGGGGGTGTGGGGGCTGG - Intronic
946427938 2:219609273-219609295 GTGGCAGCAGGCCTGAGGGCCGG + Intronic
946816890 2:223588038-223588060 GGGTCAGTGGGTTTGGGGGCTGG - Intergenic
947491909 2:230602728-230602750 GTGGGTGGGGGTGTGGGGGCGGG - Intergenic
947752725 2:232541193-232541215 GTGGCAGGAGGATTGCTGGGGGG + Intronic
948378850 2:237539608-237539630 GAGGCAGGAGGGTTAAGGGCAGG - Intronic
948588260 2:239034813-239034835 GAGGCAGGAGGCTGGGGGGTGGG - Intergenic
948941957 2:241201183-241201205 GGTGCAGAAGGTTTGGGGCCCGG - Intronic
948958931 2:241316436-241316458 GGGCTTGGAGGTTTGGGGGCTGG - Exonic
949031245 2:241798537-241798559 GTTGGATGAGGTTTGAGGGCGGG - Intronic
1168790880 20:574845-574867 AGGGCAGGAGGGGTGGGGGCAGG + Intergenic
1168793975 20:598754-598776 GTGGCAGGAGACTCGGGGGATGG + Intergenic
1168928280 20:1600418-1600440 GTGGCTGGAAGGTTGGAGGCCGG + Intronic
1169066048 20:2694518-2694540 GGTGCAGGGGCTTTGGGGGCAGG - Intronic
1169111495 20:3037060-3037082 GTGGCAGAAGAGGTGGGGGCAGG - Intronic
1169196933 20:3688401-3688423 GGGGCAAGAGGCTTGGGGCCAGG + Exonic
1170667291 20:18397712-18397734 GTGGTTGGATGTCTGGGGGCGGG + Intronic
1170697417 20:18671805-18671827 GGGGCAAGAAGTTTGAGGGCAGG + Intronic
1170830785 20:19838896-19838918 CTGGGTGGAGGTTTGGGGGCTGG - Intergenic
1170894482 20:20401388-20401410 GTGGTGTGAGGTTTGGGGGGTGG - Intronic
1171013473 20:21521307-21521329 GTGGGAGGAGGTTGGGGCGGAGG + Intergenic
1171982852 20:31639324-31639346 GGGGCCTGAGGCTTGGGGGCTGG - Intronic
1172108766 20:32532930-32532952 CTGGCAGGCTGTTTGGGGGTTGG - Intronic
1172245709 20:33443750-33443772 GGGGGAGGAGCTCTGGGGGCGGG + Exonic
1172860539 20:38046749-38046771 GAGGCAGGAGGTTGGAGGACGGG + Intronic
1174139667 20:48404073-48404095 GGGGCAGGAAGTCAGGGGGCAGG + Intergenic
1174447835 20:50602359-50602381 CTGGCAGGAGACCTGGGGGCAGG + Exonic
1175092602 20:56517389-56517411 GTGGCAGGAGTGATGGGGTCTGG + Intronic
1175417779 20:58812930-58812952 GTGGGAAGATGTTTGTGGGCAGG + Intergenic
1175547214 20:59786120-59786142 GTGGCAGGAGGCCTGGGGCTGGG + Intronic
1175694271 20:61089738-61089760 GAGGCAGGAGGCTTGGGGGGCGG - Intergenic
1175756431 20:61533249-61533271 GTGGCAGGGCGATGGGGGGCAGG + Intronic
1175955171 20:62605407-62605429 GAGGCAGGAGGGTTGGGGGAAGG - Intergenic
1175983591 20:62753404-62753426 GTGGCAGGAGGTTGGGAGGGAGG + Intronic
1176703762 21:10093232-10093254 GTGGCAGGGGGGTTGGGGGATGG + Intergenic
1177653869 21:23991554-23991576 ATGACAGTAGGGTTGGGGGCGGG + Intergenic
1177659471 21:24064163-24064185 CTGTCAGGGGGGTTGGGGGCAGG + Intergenic
1177760945 21:25401636-25401658 GTGGCAGTAAGTTTGGGGTTGGG + Intergenic
1178174290 21:30078340-30078362 ATGGAAGGAGGTATGGAGGCTGG - Intergenic
1178326148 21:31646956-31646978 CTGGTGGGAGGTGTGGGGGCGGG + Intergenic
1178357158 21:31918944-31918966 GTGGTATGAGGTTGAGGGGCTGG + Intronic
1178399808 21:32275842-32275864 GGTGCTGGTGGTTTGGGGGCTGG - Intronic
1178473171 21:32913313-32913335 GGGGAAGGGGGTTTGGGGGTAGG - Intergenic
1179249956 21:39664308-39664330 GAGTACGGAGGTTTGGGGGCTGG - Exonic
1179510690 21:41871341-41871363 GGTGCAGGAGGTTGGGGGGTGGG - Intronic
1179815321 21:43902513-43902535 GTGCCTGTAGGTTTGGTGGCTGG + Intronic
1179822883 21:43947063-43947085 GTGACGGGAGGGTGGGGGGCTGG + Intronic
1179890824 21:44334346-44334368 GTGGCAGGAAGCTTGGGGCGGGG - Intronic
1179939121 21:44626938-44626960 GTGACAGGAGATTTGTGAGCTGG + Intronic
1180081591 21:45489993-45490015 GGGGGAGGAGGTGTGGGGGACGG - Intronic
1180081610 21:45490034-45490056 GGGGGAGGAGGTGTGGGGGACGG - Intronic
1180146098 21:45919869-45919891 GTGGCAGGGGTGTGGGGGGCAGG + Intronic
1180168279 21:46041352-46041374 GTGGGAGAACGTTCGGGGGCTGG - Intergenic
1180211887 21:46299821-46299843 TTGGCAGGGGTTTTGGGGTCTGG - Intergenic
1180226483 21:46396310-46396332 GTGCCAGCAGGTTTGGTGTCTGG + Intronic
1180552585 22:16552567-16552589 CTGGCAGGTGATTTGGGGGCAGG + Intergenic
1180613670 22:17113786-17113808 GAGGCAGCAGGGTTGGGGGCTGG + Exonic
1180992003 22:19942330-19942352 GTTGCAGGAGGCCTGGGGGAGGG + Intronic
1180999055 22:19979480-19979502 GGGGCAGGAGGTGTGAAGGCAGG + Intronic
1181271394 22:21660916-21660938 GTGGCAGCAGGGTTGGTGGCAGG - Intronic
1181351449 22:22261465-22261487 CTGGCGGGTGATTTGGGGGCAGG - Intergenic
1181386203 22:22547559-22547581 GTGTCATGAGATCTGGGGGCTGG + Intergenic
1182085771 22:27560248-27560270 GTGGCTGAAGGTTTGGGAGGAGG - Intergenic
1182155300 22:28066490-28066512 GTGACCAGAGGTTTGGGGGTGGG - Intronic
1182260574 22:29071150-29071172 GTGGCAGGAGGTGGGGGGGGCGG + Intergenic
1182295293 22:29308622-29308644 GCGGCAGGGGCGTTGGGGGCTGG - Exonic
1182715210 22:32352680-32352702 GCAGCAGCAAGTTTGGGGGCCGG - Intergenic
1182926196 22:34127552-34127574 GTGGCAGGAGGTTGGAATGCAGG + Intergenic
1183099600 22:35575628-35575650 GTGGCTGGGGTTTGGGGGGCAGG + Intergenic
1183268921 22:36848871-36848893 GTGGCGGGGGGGTGGGGGGCGGG - Intergenic
1183321209 22:37166265-37166287 TCGGCAGGAGGTGGGGGGGCGGG - Intronic
1183409570 22:37646950-37646972 TGGGCAGGAGGTTGGGGGGGAGG + Intronic
1183505039 22:38203947-38203969 GAGTCAGGAGGGTTGGGGCCAGG + Intronic
1183544967 22:38450583-38450605 GTGGCATGAGGTGTGAGGTCGGG - Intronic
1183582300 22:38733238-38733260 ATGGCAGGGGCTTTGGGGTCTGG + Exonic
1183946191 22:41327138-41327160 GGGGCAGGAGGCCTGGGGGAGGG + Intronic
1184149319 22:42629263-42629285 GTGGCTGGAGGGTTGGGGCAAGG - Intronic
1184347651 22:43923602-43923624 CTGGGAGGGGGATTGGGGGCGGG - Intergenic
1184458681 22:44625288-44625310 GCTGCAGTAGGTCTGGGGGCTGG + Intergenic
1184561949 22:45268632-45268654 GGGGCGGGAGGAATGGGGGCGGG - Intergenic
1185039631 22:48497615-48497637 GGGGCTGGAGGCCTGGGGGCGGG + Intronic
1185039674 22:48497732-48497754 GGGGCTGGAGGCCTGGGGGCGGG + Intronic
1185039717 22:48497849-48497871 GGGGCTGGAGGCCTGGGGGCGGG + Intronic
1185050227 22:48550562-48550584 GTGGGATGAGGGTAGGGGGCAGG - Intronic
1185342643 22:50298514-50298536 CTGGCAGGAGTTTGGGGGCCTGG - Intronic
949999759 3:9647907-9647929 GTGGGAGGAGTTGGGGGGGCAGG + Intergenic
950214903 3:11152613-11152635 GTGGGAGGGGGGATGGGGGCAGG - Intronic
950695414 3:14697699-14697721 GCAGCAGGGGGGTTGGGGGCTGG - Intronic
950809424 3:15636780-15636802 GTGGGGGGGTGTTTGGGGGCAGG + Intronic
951735918 3:25863594-25863616 ATGCCATGAGGTTAGGGGGCTGG - Intronic
951825189 3:26860437-26860459 ATGGCAGGAGGGAAGGGGGCTGG - Intergenic
952314687 3:32222364-32222386 GTGGCAGTAGGCAAGGGGGCAGG - Intergenic
952849678 3:37717569-37717591 GTGGCAGGAGAGAAGGGGGCTGG + Intronic
954401584 3:50322169-50322191 GTGGCCGCAGGGTTGGGGTCAGG + Exonic
954671092 3:52291767-52291789 GTGACAGGTGGGATGGGGGCAGG - Exonic
954882573 3:53845990-53846012 GGGGCCGGAGGTTTGGGGCCGGG - Intronic
955711557 3:61784264-61784286 GTGGCAGTGGGGTTGGGGGACGG + Intronic
956008233 3:64803329-64803351 GGGGCATGAGTTTTGGGGACAGG + Intergenic
956236507 3:67078147-67078169 GTGCCAGCAGGTTTGGTGTCTGG - Intergenic
956259754 3:67326209-67326231 GTGGCAGAAGACTTGGGGGAAGG + Intergenic
956260423 3:67333871-67333893 GTGGCTGGAGGTGTGGGGAAGGG + Intergenic
956727161 3:72165351-72165373 GTTGCAGTAGGTATCGGGGCAGG + Intergenic
956781392 3:72606088-72606110 GAGGCAGGGGGTTGGGGGGCAGG - Intergenic
959471085 3:106750975-106750997 GGGGCAGGAGGTTGGGGTGGGGG + Intergenic
960148271 3:114226227-114226249 GTGGCTGGAGGCTTGGGGCAGGG + Intergenic
961211552 3:125129596-125129618 CTGTCAGGAGGATGGGGGGCTGG + Intronic
961453752 3:127014390-127014412 GGGGCATGGGGTGTGGGGGCAGG - Intronic
961760991 3:129167708-129167730 GTTAAATGAGGTTTGGGGGCTGG - Intergenic
961780022 3:129315904-129315926 GTAGCAAGAGGATTGGTGGCGGG + Exonic
962108830 3:132420546-132420568 GTGGCAGGGGGTTGGGGGTGGGG - Intronic
962786609 3:138774266-138774288 GTGGTAGGAGGTTTGGGAGAGGG - Intronic
962831708 3:139147895-139147917 GTGGCAGCGAGTTTGGGGGAGGG - Intronic
962977535 3:140458621-140458643 GAGGCAGCAGGAGTGGGGGCAGG - Intronic
963108255 3:141664677-141664699 GTGGAAGGAGGCTTGGGGGAAGG - Intergenic
963159219 3:142133431-142133453 GAGGCAGGAGGTTTGAGCCCAGG - Intronic
963767984 3:149357689-149357711 GTGGCTGCAGGGTTGGGGGTGGG - Intergenic
964116862 3:153145427-153145449 GTAGAATGAGGATTGGGGGCAGG - Intergenic
964138609 3:153371979-153372001 ATGGCAGCTGGTTTGGGGGTGGG + Intergenic
964607452 3:158572709-158572731 GGGGCATGAGGTGTGGGGGTAGG + Intronic
966673082 3:182551487-182551509 CTGTCAGGGGGTTTGGGGGAGGG - Intergenic
966870934 3:184290392-184290414 GTGGCAGGAGAGGTGGGGGAAGG + Intronic
967100499 3:186211529-186211551 GTGGAAGGAGGGCTGAGGGCTGG + Intronic
969177188 4:5407638-5407660 ATGGCAGGAGTTTGGGGGGTGGG + Intronic
969222998 4:5773571-5773593 GTGGCAAGGGGTGTGGGTGCCGG + Intronic
969362055 4:6671192-6671214 GTGCCAGCAGGTTTGGTGCCTGG + Intergenic
969747103 4:9080997-9081019 GTGGCAGCAAGTCTGGGGGAGGG + Intergenic
971385314 4:26136419-26136441 ATGGCAGGAGATGTGGAGGCTGG - Intergenic
971753635 4:30681187-30681209 GGGGCTGGGGGTTAGGGGGCAGG - Intergenic
972249415 4:37284163-37284185 GTGCCAGCAGATTTGGGGTCTGG + Intronic
972383060 4:38536814-38536836 GTGGCAGCATGGTTGGGGTCTGG - Intergenic
972894752 4:43606421-43606443 CTGGCTGGGGGGTTGGGGGCTGG + Intergenic
973604511 4:52573119-52573141 GTGCCAGCAGGTTTGGTGTCTGG - Intergenic
975329783 4:73100023-73100045 GGAGCAGGAGGGTTGGGAGCAGG - Intronic
976105339 4:81611630-81611652 CTGGCAGCAGGTTTGGGGAAAGG + Intronic
976604610 4:86970912-86970934 TTGGGATGAGGTTTGGGAGCTGG + Intronic
976845943 4:89489706-89489728 GTGGGAGGGGGTGTGGTGGCGGG + Intergenic
978073123 4:104495046-104495068 GAGGGAGGAGGTGTGGAGGCTGG + Intergenic
978409813 4:108415178-108415200 CTCCCAGGAGATTTGGGGGCAGG + Intergenic
978471906 4:109077438-109077460 TTAGCAGGAGTGTTGGGGGCGGG - Intronic
978605058 4:110470926-110470948 GCAGCAGGGGGTTGGGGGGCAGG + Intronic
979095315 4:116541591-116541613 GTGGAAGGAGCTTTGGGCTCTGG + Intergenic
979521872 4:121676661-121676683 GTGACAGGAAGCCTGGGGGCGGG + Intronic
979693688 4:123587615-123587637 GGGGCAGGTGGGTGGGGGGCAGG + Intergenic
980375978 4:131949584-131949606 GTGGCAGGGGGGTTGGGGGATGG + Intergenic
980894747 4:138851372-138851394 GTGGCAGTAGGAATGGGGGCCGG - Intergenic
980900047 4:138896357-138896379 GTAGCAGCAGGTTTGGTGTCTGG + Intergenic
980920634 4:139083168-139083190 GTGGTGGGAGGTTTGGGGGGGGG + Intronic
981244001 4:142513330-142513352 GTGCCAGGAGATTTGGTGTCTGG + Intronic
981616273 4:146647886-146647908 GTGACAGGCGGTTTGGGAGAGGG + Intergenic
982069077 4:151679437-151679459 CTGGGAGGCGGTGTGGGGGCGGG + Intronic
982405547 4:155015872-155015894 TTGGCAGGAAGTTTGGAGGTAGG + Intergenic
983763195 4:171440194-171440216 CTGGCAGGAGGTGTTGGAGCAGG - Intergenic
984741262 4:183165551-183165573 GTGGAAGGGGGTGTGGGGGAAGG + Intronic
986348673 5:6857197-6857219 GTGGCAGGGGGTGGGGGGGCGGG + Intergenic
987966974 5:24890104-24890126 GAGGCAGGAGGTTAGGAGGAGGG + Intergenic
989845098 5:46131319-46131341 GTGGCAGCAAGTTTGGGGGAGGG + Intergenic
990285662 5:54298535-54298557 GGGGCAGGAAGGTTGGGGGGTGG - Intronic
991584779 5:68190806-68190828 GTGGGTGGAGGGTTGGGGGATGG - Intronic
992190315 5:74285495-74285517 GGGTGGGGAGGTTTGGGGGCTGG - Intergenic
992549025 5:77844231-77844253 GGGGCCGGAGGAGTGGGGGCCGG + Intronic
992812206 5:80400243-80400265 GTGTAAGGAGGTTTGGTGTCTGG + Intergenic
994143532 5:96367531-96367553 GTGGCAGCAAGTCTGGGGGAGGG - Intergenic
995412910 5:111878732-111878754 GTGGCAGGGGGGTGGGGGACAGG - Intronic
996796513 5:127353840-127353862 GAGGGAAGAGGTTTGGGGACTGG + Intronic
997360620 5:133292369-133292391 GAGGCAGGAGGACTGGGGCCTGG - Intronic
998369869 5:141654034-141654056 GGGGCTGGGGGATTGGGGGCTGG + Exonic
998932317 5:147194850-147194872 GTGCCAGAAGGTTTGGTGTCTGG + Intergenic
999155626 5:149455616-149455638 GTAGCTGGAGGTCGGGGGGCGGG + Intergenic
999665280 5:153906348-153906370 GTGGCATGGAGTTTGGGGGAGGG - Intergenic
1000747013 5:165046149-165046171 GTGGCAGCAGGGCTGGGGGAGGG - Intergenic
1002131126 5:177082280-177082302 GGGGAGGGAGGTGTGGGGGCTGG - Intergenic
1002305125 5:178278664-178278686 GGGGCAGGAGGTAGGGGGCCTGG - Intronic
1002321338 5:178377787-178377809 GTGGAAGGCGCTTTAGGGGCTGG + Intronic
1002447561 5:179298626-179298648 GTGGCAGGAGGGGTGTGGACGGG + Intronic
1003164028 6:3660734-3660756 GTGGCGGGAGGTTAGGGGAATGG + Intergenic
1003268686 6:4588804-4588826 GTGCCTGGAGCTTTGAGGGCTGG - Intergenic
1003871833 6:10410200-10410222 GTGGGGGGAAGTATGGGGGCTGG + Exonic
1004167563 6:13270385-13270407 GAAGCAGGAGGGTGGGGGGCTGG - Intronic
1004651572 6:17614607-17614629 GTGGATTGTGGTTTGGGGGCGGG + Intergenic
1005245020 6:23873557-23873579 GTGGCATGTGGTTTGGGTGAAGG - Intergenic
1006505731 6:34487519-34487541 GATGCAGGAGGTTTGGATGCAGG + Intronic
1006723745 6:36180368-36180390 GTGCCAGCAGGTTTGGTGCCTGG - Intergenic
1006867039 6:37216914-37216936 GTGCCAGTAGGTTTGGTGTCTGG - Intronic
1006945709 6:37783341-37783363 ATGGCAGGAGGCTGGGAGGCCGG + Intergenic
1007302456 6:40877593-40877615 GAGGCAGGGGGTTTGAAGGCTGG - Intergenic
1007413797 6:41680288-41680310 GTTCCAGGAGGTGAGGGGGCAGG + Intergenic
1007527316 6:42507866-42507888 GTGACAGGAGGGAGGGGGGCGGG - Intergenic
1007733378 6:43965366-43965388 GCAGCAGGAGGTTGGGGGGTGGG - Intergenic
1007740448 6:44006440-44006462 GGGGCAGCAGGTTGGGTGGCAGG + Intergenic
1010083320 6:71887531-71887553 CTGGGAGCAGGTTAGGGGGCAGG + Intronic
1011558902 6:88595661-88595683 GTGGCTGCAGATGTGGGGGCTGG - Intergenic
1011741319 6:90363503-90363525 GGGGCATGAGGCTTGGGGACCGG - Intergenic
1012267683 6:97166518-97166540 GTGGCGGGTGGGTTGGGGGAGGG - Intronic
1013179948 6:107709057-107709079 ATGGCAGGGGGTTAGGTGGCAGG - Intronic
1013273631 6:108562648-108562670 TTGGGAGGAGGTTTGGGGGCTGG + Intronic
1013288467 6:108699838-108699860 CTGGCAGGAGGGCTGGGGCCTGG + Intergenic
1014336451 6:120142616-120142638 GAGGCAGCAGCTTTGGTGGCTGG - Intergenic
1014570171 6:122997673-122997695 GCAGCAGGAGGTCTGGGGGCTGG + Exonic
1014818044 6:125956775-125956797 GTGGCAGCCGGTTTTGAGGCCGG + Exonic
1015233055 6:130938649-130938671 GTGGGAGGAGGCTAGAGGGCTGG - Intronic
1015369777 6:132437662-132437684 GTGCCAGCAGGTTTGGTGTCTGG + Intergenic
1015403491 6:132812930-132812952 GTGGCAGGGGGTTAGGGAGTGGG - Intergenic
1015655939 6:135519236-135519258 GTGACAGCAGGTTTGGTGTCTGG + Intergenic
1015820981 6:137259985-137260007 GTGCCAGCAGGTTTGGTGTCTGG + Intergenic
1017173012 6:151475662-151475684 GTGCCAGCAGGTTTGTGGACTGG + Intergenic
1017947978 6:159111336-159111358 GTGGAAGGAGGTTTGCAGACAGG - Intergenic
1017972756 6:159327394-159327416 GTGGGAGGGGGTGTGGGGACTGG - Intergenic
1018003693 6:159601452-159601474 GTGGAAAGAGGACTGGGGGCTGG + Intergenic
1018060229 6:160084386-160084408 GGGGCAGGAGCTTTGGTGACTGG + Intronic
1018834565 6:167473292-167473314 GTGGCAGGTGGCTTTGTGGCAGG + Intergenic
1018838771 6:167504398-167504420 GTGGCGGGAGGGGTGGGGGTGGG + Intergenic
1018879873 6:167866916-167866938 GTGGCTGAAGGTTTGGGGCTGGG - Intronic
1018929272 6:168229546-168229568 GGTGCAGGTGGTTTGGGAGCCGG - Intergenic
1018990205 6:168668832-168668854 GTGACAGCAGGTGTGGGGGAGGG - Intronic
1018990261 6:168668975-168668997 GTGACAGCAGGTGTGGGGGAGGG - Intronic
1019371214 7:662828-662850 GTGGGGGGAGCTTTGGAGGCTGG - Intronic
1019421163 7:952022-952044 CTGGGAGGGGGTTTGGGGGAGGG - Intronic
1019574156 7:1728231-1728253 GTGGCAGGGGGATGGGGAGCAGG - Intronic
1019597869 7:1866677-1866699 TTGGCGGGAGCGTTGGGGGCAGG + Intronic
1019665857 7:2252133-2252155 GTGGGAGGGGGGTTGTGGGCTGG - Exonic
1020281819 7:6653683-6653705 GCGGCAAGACGTTTGGGCGCCGG + Exonic
1020331110 7:7017800-7017822 GTGGCAGGAGGTGTGAGGGGAGG - Intergenic
1020361339 7:7329844-7329866 GTGGCAGGAGGCTTTTGGGTTGG - Intergenic
1021276137 7:18653902-18653924 GTGGATGGAGGGTTGGGGACAGG - Intronic
1022353573 7:29588900-29588922 GTGGCAGGTGCATGGGGGGCTGG - Intergenic
1022451864 7:30523346-30523368 GTGGGAGGAGGTTGGAGGGCTGG + Intronic
1023875700 7:44285143-44285165 GAGGCAGGAGGGGAGGGGGCCGG + Intronic
1024008303 7:45243602-45243624 GTGGCAGGAGGCTTGTCAGCTGG - Intergenic
1024023015 7:45387991-45388013 ATGGCAGGAGGTGGGGGTGCTGG - Intergenic
1024116157 7:46195832-46195854 ATGTCAGGAGATGTGGGGGCTGG - Intergenic
1024897664 7:54279211-54279233 GTGGGTGGATGTGTGGGGGCTGG + Intergenic
1025141400 7:56469660-56469682 GAGGCGGCAGGTTTGGCGGCAGG + Intergenic
1026577003 7:71580766-71580788 GTTGGAGGAGGTTTGGGAGAAGG + Intronic
1026822239 7:73557460-73557482 GGGGCCGGAGCTTAGGGGGCTGG - Intronic
1027180596 7:75936661-75936683 TGGGCAGGGGGTTGGGGGGCAGG + Intronic
1028556749 7:92134007-92134029 GTGGCAGGCGCGCTGGGGGCTGG - Intronic
1028937901 7:96486458-96486480 CTGGCAGGAGGTGAGGAGGCGGG + Intronic
1029424147 7:100486188-100486210 GTGGCAGAGGGTTGGGGGGGCGG - Intronic
1029472261 7:100762043-100762065 GGGGAAGGAGGCTTGGGGGAGGG + Intronic
1029731975 7:102444503-102444525 GAGGCTGGAGGGTGGGGGGCGGG - Intronic
1030131972 7:106209141-106209163 GTGGCAGCAAGGTTGGGGGAGGG + Intergenic
1030197163 7:106863759-106863781 GTGGGAGGAGGTTTGAGGGTGGG - Intergenic
1031554043 7:123149491-123149513 GTGGCAGGGGGTTGGGGCACTGG + Intronic
1032680159 7:134174167-134174189 GGGGAAGGAAGTTGGGGGGCTGG + Intronic
1033184860 7:139218195-139218217 GTGGCAGGGGCTTAGGGGGCAGG - Intergenic
1033620314 7:143056689-143056711 GTGGGAGGATATTTGGGGCCAGG - Intergenic
1034255075 7:149720407-149720429 GTGGCAGGACTTTTGGGAGCTGG - Intronic
1034436723 7:151066096-151066118 GTGCCAGGGGGTGAGGGGGCAGG + Intronic
1034488470 7:151380779-151380801 GTGGAAGGAGGGGTGGGGGCGGG - Intronic
1034966568 7:155394984-155395006 GGGGCTGGGGGTTGGGGGGCGGG + Intronic
1035400839 7:158564596-158564618 TGGGCAGGGGGCTTGGGGGCTGG - Intronic
1035544859 8:472504-472526 GTGGCAGGTGGGGTGGGGGTGGG - Intergenic
1035724058 8:1813790-1813812 GGGGCAGGAGGTTGGGGAGTGGG - Intergenic
1036646019 8:10611759-10611781 GTGTGGGGAGGTATGGGGGCCGG + Exonic
1036808135 8:11849045-11849067 GTGGCAGCATGTGTGGGGACGGG - Exonic
1038363248 8:26904446-26904468 GTGGGAGCAGGTTTGGAGGGAGG + Intergenic
1038760182 8:30378664-30378686 ATGGCAGGAGCTTTGGGATCAGG - Intergenic
1040424390 8:47270528-47270550 GACCAAGGAGGTTTGGGGGCGGG - Intronic
1040612371 8:48998029-48998051 GTGGCAGCAAGTCTGGGGGAGGG + Intergenic
1041024338 8:53668692-53668714 GTGGCAGCAGGTTTGGTGTCTGG + Intergenic
1041321926 8:56622306-56622328 GGGGAAGGAGGTATAGGGGCAGG + Intergenic
1041717966 8:60949213-60949235 GTAGCAGGAGGGTTTGGGGTAGG + Intergenic
1041718361 8:60952231-60952253 GTAGCAGGAGGGTTTGGGGTAGG + Intergenic
1042249913 8:66745757-66745779 GTGCCAGCAGGTTTGGTGTCTGG + Intronic
1044152155 8:88794381-88794403 GTGCCAGGAGATTTGGTGTCTGG - Intergenic
1044271784 8:90253243-90253265 CTTGCAGGAGGTTGGGGGGTGGG - Intergenic
1044765230 8:95565116-95565138 TTGGCAGGAGGTTGTGGGGATGG + Intergenic
1045272821 8:100676411-100676433 GAGGCAGGAGGTTGGGGGCATGG - Intergenic
1045411738 8:101927151-101927173 GTGGGAGGAGGTGTGAGGGTGGG - Intronic
1045680898 8:104658788-104658810 TTGGTAGGAGGTTTGGGGAAAGG - Intronic
1046940695 8:119928149-119928171 GTGGCAGGAGGGTTCTGGGTTGG + Intronic
1047309440 8:123679396-123679418 GTGGCAGGAGAGATGGGGGAGGG - Intergenic
1047846421 8:128810440-128810462 GTGACAGCAGGTTTGGTGTCTGG - Intergenic
1048213917 8:132479437-132479459 GAGCCAGGAGGTGAGGGGGCCGG - Intronic
1048280236 8:133100332-133100354 ATGGCAGGAGGTTTGAGTGCTGG - Intronic
1048340813 8:133537216-133537238 GTGGGGGGAGGTATGGGGGAAGG + Intronic
1048437587 8:134432520-134432542 GTGGCAGGATGGTTGGGGATGGG - Intergenic
1048551103 8:135434077-135434099 GTGGCAGGGGGTGCGGGGGTGGG + Intergenic
1048698399 8:137055521-137055543 ATGGCAGGGGATGTGGGGGCAGG - Intergenic
1049054701 8:140226656-140226678 GTGGAAGGAGGGTTGCAGGCAGG - Intronic
1049178449 8:141207971-141207993 GTGGCACCAGGCTTGGAGGCAGG + Intronic
1049214809 8:141402684-141402706 GGAGCAGGAGGTATGGGGGAGGG - Intronic
1049215489 8:141405971-141405993 GTGGTAGGAGGTCAGAGGGCAGG + Intronic
1049433679 8:142576647-142576669 CTGGCAGGAGGGCTGGGGGCAGG - Intergenic
1049446471 8:142633746-142633768 GTTGGAGTAGGTTTGGGGCCAGG + Intergenic
1049554860 8:143276835-143276857 GTGGAGGGTGGGTTGGGGGCAGG - Exonic
1049563283 8:143324214-143324236 GAAGCACGAGGTTTGGGGGAGGG - Intronic
1049675607 8:143887569-143887591 GAGGCAGGAGGCTTAGGGGCCGG + Intergenic
1049747134 8:144267718-144267740 CTGGCAGGAGATGTGGGGGCTGG + Intronic
1049778726 8:144417912-144417934 ATGGCAGGAAGTCTGGGGGAAGG + Intergenic
1050293187 9:4178236-4178258 GGGGCAGAAATTTTGGGGGCAGG - Intronic
1051355598 9:16237292-16237314 GTGGAAGGTTGTTTGTGGGCTGG + Intronic
1051660400 9:19420762-19420784 GTGGCAGCAGGTTGGGGGTCTGG + Intronic
1052997376 9:34558306-34558328 GTGGCAGGAGATGTGGGGCTGGG - Intronic
1053097349 9:35340003-35340025 GTGGCTGCAGATTTGGGGGAGGG + Intronic
1053641027 9:40080252-40080274 CTGGCAGGGGGGTTGGGGGATGG + Intergenic
1053765109 9:41385216-41385238 CTGGCAGGGGGGTTGGGGGATGG - Intergenic
1054141915 9:61537380-61537402 GTGGAAGGAGGCTTGGGAGTTGG - Intergenic
1054321769 9:63676548-63676570 CTGGCAGGCGGGTTGGGGGATGG + Intergenic
1054543725 9:66296378-66296400 CTGGCAGGGGGGTTGGGGGATGG - Intergenic
1054913368 9:70474230-70474252 GAGGCAGGAGGATTGAGAGCAGG - Intergenic
1055578922 9:77687958-77687980 GTGGCAGCAAGGTTGGGGGAGGG - Intergenic
1056700386 9:88900871-88900893 GTGCCAGCAGGTTTGGTGTCTGG + Intergenic
1056927266 9:90845607-90845629 GTGGCAGGAGGTGAGGGGGAAGG - Intronic
1057333269 9:94136282-94136304 GTGGGAGGATGGTTGAGGGCAGG - Intergenic
1057429303 9:94979744-94979766 GGGGCAGGTGGTGGGGGGGCAGG + Intronic
1057487781 9:95499491-95499513 GGGGCAGGAGGGAAGGGGGCAGG + Intronic
1058740401 9:107936937-107936959 GTGCCAGCAGATTTGGGGTCTGG - Intergenic
1058740715 9:107939565-107939587 GTGGGAGGAGGCTTGGGCCCAGG + Intergenic
1059401891 9:114075974-114075996 GTGGCAGGAGTTCTGGGTGCTGG + Intronic
1059884304 9:118728352-118728374 GTGGCAGGTGCACTGGGGGCAGG + Intergenic
1060048024 9:120356172-120356194 CTGGCAGGTGGGCTGGGGGCTGG - Intergenic
1060516732 9:124270666-124270688 CAGGCAGGAGGGTCGGGGGCAGG - Intronic
1061061716 9:128253956-128253978 GTGGCAGGAGAATGGGGGGTGGG - Intronic
1061064226 9:128267397-128267419 GTGGGAGGAGGTTGGAGGGCTGG + Intronic
1061095102 9:128452046-128452068 CTCGCAGGAGGATTGGGAGCTGG + Intergenic
1061326164 9:129866075-129866097 GGGGCAGGAGGCTGGAGGGCAGG - Intronic
1061371013 9:130197604-130197626 CTGGCGGGAGGGCTGGGGGCAGG + Intronic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1061590905 9:131596976-131596998 GAGGCAGGTGGGTTGGTGGCAGG - Intronic
1061709398 9:132477376-132477398 GTGGGATGGGGTTTGGTGGCTGG - Intronic
1061961939 9:133992909-133992931 GGGGCAGGAAGTGGGGGGGCGGG - Intergenic
1062023504 9:134329983-134330005 ATGGAAGGTGGTGTGGGGGCGGG + Intronic
1062118771 9:134822826-134822848 GTGGGAGGAGGGTCGGGGCCTGG - Intronic
1062130863 9:134892379-134892401 GTGACAGGAGGTGTAGGGGCAGG - Intergenic
1062192003 9:135252917-135252939 GTGACATGAGGTTTGGGTCCAGG - Intergenic
1062272065 9:135714297-135714319 CTGGCAGGAGGTAAGGGGGACGG - Intronic
1062276399 9:135733455-135733477 GTGGGGGCAGGTGTGGGGGCGGG - Intronic
1062353257 9:136149285-136149307 GTGGGAGGAGGGCCGGGGGCTGG - Intergenic
1062392731 9:136340429-136340451 GTGGCATGGGGTTGGGGGGAGGG - Intronic
1062433188 9:136535055-136535077 CTGGAAGGAGGTCTGGGGCCTGG - Intronic
1062445665 9:136593154-136593176 GGGGCAGGAGGAGTGGGGACGGG - Intergenic
1062480209 9:136747615-136747637 GAGGCTGGAGGGTTGGAGGCTGG - Intronic
1062480217 9:136747643-136747665 GAGGCTGGAGGTTTGGAGGCTGG - Intronic
1062480234 9:136747701-136747723 GAGGCTGGAGGGTTGGAGGCTGG - Intronic
1062519655 9:136952384-136952406 GTGGCAGGGGGGTTGGGGTCTGG - Exonic
1062522597 9:136964439-136964461 GTGGCAGGTTGTGCGGGGGCTGG - Intergenic
1202788799 9_KI270719v1_random:63327-63349 GTGGCAGGGGGGTTGGGGGATGG + Intergenic
1185572883 X:1147873-1147895 GTGGGAGGAAGTGTGGTGGCAGG - Intergenic
1185599287 X:1327861-1327883 GTGGGTGGAGGGTGGGGGGCTGG + Intergenic
1185923003 X:4114767-4114789 GTGTCAGCAGGTTTGGTGTCAGG + Intergenic
1186459198 X:9734811-9734833 CTGGCAGGAGGGGTGGGGACTGG - Intronic
1187483788 X:19682977-19682999 GTGCCAGCAGATTTGGGGGACGG - Intronic
1187698296 X:21941540-21941562 GAGGCATGAGGTCTGGGCGCGGG + Intronic
1188262203 X:28034873-28034895 GTGACAGGATGGTTGGTGGCTGG + Intergenic
1188441097 X:30215825-30215847 GGGGAAGGAGGTTTGGACGCAGG + Intronic
1189289781 X:39876923-39876945 GTGCCAGGAGGCTTGGAGCCTGG - Intergenic
1190324751 X:49199765-49199787 GCGACAGAAGGTGTGGGGGCGGG - Intronic
1190489579 X:50968286-50968308 GTGGGAGGAGATTTGGAGGCGGG - Intergenic
1190752134 X:53371987-53372009 GGGGGAGGAGGGTTGTGGGCAGG - Intergenic
1191070377 X:56394442-56394464 GTGGCAGCAAGGTTGGGGGAGGG - Intergenic
1191718293 X:64207822-64207844 GTGACAGAATGTTTGGTGGCTGG - Intergenic
1192359900 X:70432835-70432857 GGGGGAGCAGGTGTGGGGGCTGG + Intronic
1192573058 X:72222035-72222057 GGGGCTGGAGGCTTGAGGGCAGG - Intronic
1192724043 X:73729013-73729035 GTTGCAGGGGGGATGGGGGCGGG - Intergenic
1192983010 X:76367128-76367150 ATGGCAGGAGTTTTGGGGGTCGG + Intergenic
1194846185 X:98812139-98812161 ATGGCAAAAGGTTGGGGGGCAGG - Intergenic
1195002294 X:100653509-100653531 GGGCCAGTAGGTTTGGGGGAGGG - Intronic
1195051132 X:101098068-101098090 GTGGCGGGAGGCTCGGTGGCGGG - Intergenic
1195854327 X:109313918-109313940 GTGCCAGCAGGTTTGGGGTCTGG + Intergenic
1195875578 X:109537037-109537059 GTGGCAGGACGGCTGGGCGCCGG + Intronic
1198427153 X:136531694-136531716 AGGGCAGGAGGTTTGGAGGAGGG - Intergenic
1198485754 X:137085919-137085941 GTGGCAGCAGGCCTGGGAGCTGG + Intergenic
1198689022 X:139259959-139259981 GTGGCAGCAAGGTTGGGGGAGGG + Intergenic
1198963926 X:142208067-142208089 CTGGCAGCAGGCATGGGGGCAGG + Intergenic
1199344625 X:146723960-146723982 GGGGCTGGAGGGCTGGGGGCAGG + Intergenic
1199600112 X:149536810-149536832 GGGGCAGGGGGTGGGGGGGCAGG + Intergenic
1199650471 X:149943130-149943152 GGGGCAGGGGGTGGGGGGGCAGG - Intergenic
1200045004 X:153396648-153396670 GTGGCGGCAGGGTTTGGGGCTGG + Intergenic
1200085942 X:153605160-153605182 GTGGCATGGGGTCTGGGGCCTGG - Intergenic
1200163448 X:154020435-154020457 GTGGCAGGAGCTCTGCCGGCGGG - Intergenic
1200909607 Y:8518071-8518093 CTGGTAGGGGGTTGGGGGGCTGG + Intergenic
1201637104 Y:16135938-16135960 GTGGCATGATGTGTGTGGGCTGG - Intergenic
1202301782 Y:23423470-23423492 TTGGCAGGAGGTTGGGGAGGTGG - Intergenic
1202366706 Y:24170754-24170776 GTGGGAGGAGGTTGGAGGGCTGG - Intergenic
1202373699 Y:24214728-24214750 GTGGGAGGAGGTTGGAGGGCTGG + Intergenic
1202497082 Y:25455392-25455414 GTGGGAGGAGGTTGGAGGGCTGG - Intergenic
1202504076 Y:25499369-25499391 GTGGGAGGAGGTTGGAGGGCTGG + Intergenic
1202569029 Y:26247128-26247150 TTGGCAGGAGGTTGGGGAGGTGG + Intergenic