ID: 1132588347

View in Genome Browser
Species Human (GRCh38)
Location 16:715737-715759
Sequence GCGGCCCTTCGCGGGCGCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 144}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132588335_1132588347 20 Left 1132588335 16:715694-715716 CCGATCCCAGAGCGCGGCCCGGC 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1132588347 16:715737-715759 GCGGCCCTTCGCGGGCGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 144
1132588339_1132588347 3 Left 1132588339 16:715711-715733 CCCGGCATCGCCTGTCTGCGGCC 0: 1
1: 0
2: 0
3: 5
4: 122
Right 1132588347 16:715737-715759 GCGGCCCTTCGCGGGCGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 144
1132588343_1132588347 -7 Left 1132588343 16:715721-715743 CCTGTCTGCGGCCGGTGCGGCCC 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1132588347 16:715737-715759 GCGGCCCTTCGCGGGCGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 144
1132588337_1132588347 14 Left 1132588337 16:715700-715722 CCAGAGCGCGGCCCGGCATCGCC 0: 1
1: 0
2: 2
3: 8
4: 119
Right 1132588347 16:715737-715759 GCGGCCCTTCGCGGGCGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 144
1132588332_1132588347 22 Left 1132588332 16:715692-715714 CCCCGATCCCAGAGCGCGGCCCG 0: 1
1: 0
2: 2
3: 7
4: 72
Right 1132588347 16:715737-715759 GCGGCCCTTCGCGGGCGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 144
1132588336_1132588347 15 Left 1132588336 16:715699-715721 CCCAGAGCGCGGCCCGGCATCGC 0: 1
1: 0
2: 1
3: 2
4: 63
Right 1132588347 16:715737-715759 GCGGCCCTTCGCGGGCGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 144
1132588333_1132588347 21 Left 1132588333 16:715693-715715 CCCGATCCCAGAGCGCGGCCCGG 0: 1
1: 0
2: 2
3: 10
4: 130
Right 1132588347 16:715737-715759 GCGGCCCTTCGCGGGCGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 144
1132588340_1132588347 2 Left 1132588340 16:715712-715734 CCGGCATCGCCTGTCTGCGGCCG 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1132588347 16:715737-715759 GCGGCCCTTCGCGGGCGCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132588347 Original CRISPR GCGGCCCTTCGCGGGCGCCC AGG Exonic
900244759 1:1631879-1631901 GCTGCCCTTCCCGGGCTGCCTGG + Intergenic
900984477 1:6065548-6065570 GCGGCCCTGCGCAGCCCCCCAGG + Intronic
901526142 1:9824282-9824304 GCGTCCCTACGCGCGCTCCCGGG + Exonic
901602081 1:10430419-10430441 GCGGCCCGTCGCTCGCGCCGCGG + Exonic
901825707 1:11859449-11859471 GCGGGTCCTCGGGGGCGCCCTGG + Intergenic
903069018 1:20717562-20717584 GCGGCTCGTCGGCGGCGCCCGGG + Exonic
903828670 1:26162068-26162090 GCGGCGGTCCGCGGGCGCGCTGG - Exonic
903853326 1:26321089-26321111 GGGGCCCTTGGGGGGTGCCCTGG - Intergenic
903986889 1:27234971-27234993 CCTGCCCTCCGCGGGCGCCGAGG + Intronic
916694237 1:167220756-167220778 GCGCCCCCTGGCGCGCGCCCGGG + Intergenic
917876793 1:179293656-179293678 CCGCCCCTTCCCGGGCGCGCGGG - Intergenic
919925400 1:202189368-202189390 GCCGCCCTTCTGGGGAGCCCAGG - Intergenic
920401627 1:205680056-205680078 GCGGCCCCTCCCCGGAGCCCCGG - Intronic
921029700 1:211326761-211326783 GCGCCCCTCCGCCCGCGCCCCGG + Intronic
921155159 1:212433228-212433250 GCGGCCCGCGGCGGGCGCCCTGG + Intronic
922696976 1:227735685-227735707 GCGGCGGTGCGGGGGCGCCCAGG + Intronic
922765986 1:228157051-228157073 GCTGCCCTTCTCAGGTGCCCAGG - Intronic
922958509 1:229625699-229625721 GCGGCTCTGCGCGGGCGCGACGG - Intronic
1064443121 10:15371104-15371126 GCGGCGCGTCACGGGCGGCCGGG + Intergenic
1074592040 10:114822249-114822271 GAGGCCCCAGGCGGGCGCCCTGG + Intronic
1076683453 10:132186710-132186732 GCGGGTCTGCGCGGGGGCCCGGG + Intergenic
1077495595 11:2885150-2885172 GCGGCCCGTCGCGGTCGCGGTGG - Exonic
1079166256 11:18046209-18046231 GCGGCCCTTCCCGCGGGCACCGG - Intergenic
1080628360 11:34051631-34051653 GGGGGCCTTCGCGGCCGCTCGGG - Intergenic
1083158844 11:60842289-60842311 GCGGCCTTTCGGGGGACCCCAGG - Exonic
1083430708 11:62612547-62612569 GGCGCCCTTCGCGCGCGCCCCGG - Exonic
1083607150 11:63985957-63985979 GTGGGGCTCCGCGGGCGCCCCGG + Intronic
1084146129 11:67266364-67266386 TCGGCCCCTCGCGGGCTCGCTGG + Intergenic
1084387725 11:68854733-68854755 GCGGTCCTGCGCGGGCGCCGGGG - Intergenic
1085423080 11:76380664-76380686 CCGGCCCCTGGCGGGCTCCCGGG - Intronic
1089711627 11:120319034-120319056 GCTGCCCTTGGTGGGTGCCCTGG + Exonic
1089789608 11:120933185-120933207 GCGGCCTTTCCCGGGTGACCTGG - Intronic
1096253783 12:50050910-50050932 GCGGCCCAGCGCCGGGGCCCCGG + Intergenic
1100391574 12:94149361-94149383 GCCGCACCTCGCAGGCGCCCCGG - Exonic
1103415459 12:120739528-120739550 GCGGCCCGGCGGGGGCTCCCTGG + Exonic
1103562676 12:121800503-121800525 GCGGGGCTTCGAGGCCGCCCCGG - Intronic
1103764600 12:123271464-123271486 CCCGGCCTCCGCGGGCGCCCCGG + Intronic
1104718325 12:131030991-131031013 GCGGCCCTCGGTGGGGGCCCTGG - Intronic
1105349503 13:19602444-19602466 GCTGCCCAGCGCTGGCGCCCCGG - Intergenic
1108408760 13:50127661-50127683 GCGGTCCCTGGAGGGCGCCCGGG + Intronic
1114532081 14:23402656-23402678 GCGGCCGTTCGAGGGACCCCAGG - Intronic
1115850736 14:37588152-37588174 GCGCCCCAGCCCGGGCGCCCGGG + Intergenic
1117377484 14:55129409-55129431 GGGGCTCTCCGCGCGCGCCCCGG - Intronic
1119004173 14:70908452-70908474 GCGGCCTCTCCCGGGAGCCCCGG - Intronic
1119249065 14:73136649-73136671 CCGGCCCTTTGTGGCCGCCCGGG + Intronic
1121648004 14:95534482-95534504 GCGGCGCTCCGGAGGCGCCCGGG + Intronic
1122635407 14:103127381-103127403 GCGGCCGGCCGCGGGCGCCGAGG + Exonic
1122888886 14:104723712-104723734 GCGGCTCTTCGCGGCCGCCAGGG + Intergenic
1122951899 14:105049878-105049900 ACGGCCCTGCGCGGCCTCCCTGG + Exonic
1125485502 15:40108472-40108494 TGGGCCGTTCTCGGGCGCCCAGG + Intronic
1126574262 15:50182307-50182329 GCGTCCCGCCGCGTGCGCCCCGG + Exonic
1127588242 15:60397905-60397927 GCGGCCCATCGCGGGCGGGCAGG + Exonic
1127674823 15:61228971-61228993 GCGGCCGGGAGCGGGCGCCCGGG - Intronic
1130564221 15:84980953-84980975 GCGGCTTCTCGCGGACGCCCAGG + Intronic
1132588347 16:715737-715759 GCGGCCCTTCGCGGGCGCCCAGG + Exonic
1132933819 16:2471365-2471387 ACGGCCCTTCCCGGGAGGCCGGG + Intergenic
1139575949 16:67842299-67842321 GCGGTCCTTCGCGGCGTCCCCGG + Exonic
1139597759 16:67968228-67968250 GCGGCCGGGCGCGGGCGCCGGGG + Intronic
1141336289 16:83158441-83158463 GCTGCCCTTCCAGGGAGCCCAGG + Intronic
1141443664 16:84044935-84044957 GGGGCCCTTCCCGGGAGCACTGG - Intergenic
1141657751 16:85425090-85425112 TCGGCCCTCCCTGGGCGCCCTGG + Intergenic
1142763710 17:2055011-2055033 GCGCCACCTCGCGGGCGCGCAGG - Intronic
1142764197 17:2056527-2056549 CCGGTCCTTCGCCGGTGCCCAGG + Intronic
1145750813 17:27353929-27353951 GCGGCCCTTCTCGGCCGGCAGGG + Intergenic
1146271328 17:31487855-31487877 GCGGCCATTGGTCGGCGCCCTGG + Intronic
1148867280 17:50635102-50635124 TCGCCCCCTCCCGGGCGCCCAGG - Intronic
1150267806 17:63842403-63842425 GAGGCGCTGCGAGGGCGCCCGGG - Intronic
1151370750 17:73644921-73644943 GCGGGCTGTCGCCGGCGCCCGGG + Intergenic
1152217500 17:79042328-79042350 GCCGCCCCTCGCGGGCTCCCTGG + Intronic
1152570685 17:81120038-81120060 GGAGCCCTTCCCGGGCGCCAAGG - Exonic
1152697767 17:81805151-81805173 GAGGCCCCTTGCGGACGCCCTGG + Intronic
1152758794 17:82097938-82097960 GTGCCCCTTCGGAGGCGCCCGGG - Intronic
1152867929 17:82735412-82735434 GCAGCTCTTCGCGGGCGCGCTGG - Intergenic
1153805728 18:8706741-8706763 CAGGCCCTCCGGGGGCGCCCCGG - Intronic
1156338140 18:36187575-36187597 GTGGACCTTCGCGGGTTCCCGGG + Exonic
1157662749 18:49460266-49460288 GGGTCCCTTCGCCGCCGCCCCGG + Intronic
1160766855 19:812647-812669 GCGGCGCCACGCGGGCGGCCTGG - Exonic
1160831949 19:1108321-1108343 GCCGCCCTCCGAGGGCGCGCTGG - Exonic
1160873203 19:1286228-1286250 GCCGCCCTTCGCGCGCGCCGAGG + Exonic
1161349905 19:3785815-3785837 GTGGCCCGGCGCTGGCGCCCAGG - Intronic
1161383367 19:3978046-3978068 GCGGCCCTTCCCCGACGGCCTGG - Exonic
1161438720 19:4279063-4279085 GCGGCCAGTCTCGGGCGTCCCGG + Exonic
1166748232 19:45152055-45152077 ACGGCCCGACGGGGGCGCCCTGG + Exonic
1167134910 19:47610147-47610169 GCTGCCCTCCGCAGGGGCCCGGG - Intronic
1168316464 19:55486764-55486786 GCTGGCCTTCGCGGAGGCCCGGG + Exonic
925169643 2:1743391-1743413 GCGGCCCCTCTCGGGAACCCCGG + Intronic
932714848 2:74093579-74093601 ACGGCCCTTCGCGGGGGTCACGG + Exonic
936572130 2:113626164-113626186 GGAGCCCCTCGTGGGCGCCCAGG + Intergenic
937345560 2:121123384-121123406 CCGGCCCTGCCCGGTCGCCCTGG + Intergenic
941686964 2:168456823-168456845 GCGGCTCCTCCCCGGCGCCCGGG - Intronic
941934672 2:170973652-170973674 GGGGCCCTGCGAGGGCGGCCCGG - Intergenic
942505565 2:176638016-176638038 GTGGCCCTCAGCGAGCGCCCTGG - Intergenic
948047035 2:234952447-234952469 GCAGCCCTCCGCGTGCGCTCGGG + Intronic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
1169220595 20:3820255-3820277 GCGCCCCCTCGCGGCCGCCGGGG + Intergenic
1169327409 20:4686857-4686879 GCGGGCGATCGCTGGCGCCCAGG + Intronic
1172143995 20:32743557-32743579 GCGGCCCTGCGAGGGCTCCCCGG - Exonic
1172484879 20:35292076-35292098 GCTGCCCTTCCTGAGCGCCCTGG - Exonic
1174812656 20:53660288-53660310 GCGGCCACTCGCGGGCGGCGTGG - Intergenic
1175428697 20:58888554-58888576 GCGGCCTTGCCTGGGCGCCCTGG - Intronic
1175429586 20:58891896-58891918 GGCGCCCTTCGAGGGCCCCCGGG - Intronic
1175743947 20:61440722-61440744 TCGGCCCGTGGCGGGCGCCATGG + Intronic
1176062600 20:63178893-63178915 GCCGCCCTCTGCGGGCGCCTGGG - Intergenic
1176178396 20:63739048-63739070 GCGGGCCTTCTCTGGAGCCCGGG - Exonic
1176547890 21:8209275-8209297 GCGGCCACGCGCGCGCGCCCCGG - Intergenic
1177783053 21:25640040-25640062 GCGTCCGCTCGCGGGCACCCTGG - Intronic
1178922482 21:36747774-36747796 GCGCCCCGTCCCGGGCGGCCTGG - Exonic
1179788812 21:43743864-43743886 ACGTCCCTTCCCGGGCTCCCAGG - Intronic
1179882575 21:44299774-44299796 GCGCCCCTTCGCCAGCGCCGAGG - Intergenic
1181032429 22:20154973-20154995 GTGGCCCTGAGGGGGCGCCCGGG + Intergenic
1181849856 22:25742219-25742241 GGGTCCCTTCGCGGCCACCCGGG + Exonic
1183486386 22:38089461-38089483 GCCGCCCCCCGCGGGGGCCCGGG - Intronic
1183683664 22:39349888-39349910 ACGCCCCCTCGCGGGAGCCCTGG + Intergenic
1183931379 22:41237908-41237930 GCGGCCCTCCGCGCGGCCCCGGG - Exonic
1184402663 22:44282818-44282840 GCGGCCCTCCTCGGGCACACTGG - Intronic
1185340023 22:50287063-50287085 GTGGCCCTTCTCGGTCGCACGGG - Intronic
1185428061 22:50784716-50784738 GGAGCCCCTCGTGGGCGCCCAGG - Intergenic
953464404 3:43106073-43106095 GCGGCTCTGCGCAGGCGCACAGG - Exonic
966919871 3:184604381-184604403 TCGGCCCCTCGCGGTCGCCCCGG - Intronic
968084683 3:195869017-195869039 GCGGCCCTGCTCCTGCGCCCTGG + Intronic
970194995 4:13544081-13544103 GCGGCGCTGCGCGGACGCGCGGG - Exonic
982198108 4:152936212-152936234 GCTGCCCTTCCCGGCCGGCCAGG + Intergenic
985512826 5:321828-321850 GGGGGCCTGCGGGGGCGCCCAGG - Intronic
985995939 5:3596714-3596736 GTGGGCCTGCCCGGGCGCCCTGG - Intronic
990699589 5:58460482-58460504 ACAGCCCTTCCCGGCCGCCCGGG + Intergenic
991245715 5:64506565-64506587 GCGCCCCGGCGCGGGCGGCCCGG - Exonic
995764677 5:115602364-115602386 GCGGCCCCTCGGGGGCGGCGGGG - Exonic
998374526 5:141682091-141682113 GAGGGCCTTCGTGGGCTCCCAGG - Intronic
1002174909 5:177396440-177396462 GCGGACCTCCGCGGGGGCACTGG - Intronic
1002174936 5:177396521-177396543 GCGGACCTCCGCGGGGGCACTGG - Intronic
1002174971 5:177396629-177396651 GCGGACCTCCGCGGGGGCACTGG - Intronic
1003034960 6:2634170-2634192 CCCGGCCTTCGCGGGCTCCCGGG + Intronic
1004690369 6:17987781-17987803 GCGGCCCCTCGCGGCTGCCCGGG + Intergenic
1005886344 6:30100806-30100828 GCGGCGCCTCGCGGGCGACTGGG + Intergenic
1007752050 6:44076707-44076729 GCGGCATGTCGCGGGCGCCGCGG + Intergenic
1016949447 6:149566256-149566278 GCGCCTCTCCGCGGCCGCCCGGG + Intergenic
1025207309 7:57001241-57001263 GCGGCCCCTGGCAGGAGCCCGGG - Intergenic
1025664628 7:63575645-63575667 GCGGCCCCTGGCAGGAGCCCGGG + Intergenic
1028160164 7:87475880-87475902 GCGGCCCCAGCCGGGCGCCCCGG - Intronic
1034222783 7:149459505-149459527 GCGGCCCGTCGGGGGCGGCGGGG - Intronic
1038152573 8:24956014-24956036 CCAGCCCTTCGCGCTCGCCCTGG + Exonic
1040523691 8:48199478-48199500 GCGGCCCTTCGCTGCAGCCGAGG - Intergenic
1040825079 8:51611908-51611930 GCTGCCCATCGCTGGTGCCCCGG - Intronic
1047463580 8:125091632-125091654 CCGGCCCTGCGCGTGCGCCGTGG - Exonic
1049015422 8:139916525-139916547 GCGGCACTCCGCGGCCTCCCGGG + Intronic
1051171543 9:14322605-14322627 GCCGCGCTTCCCGCGCGCCCAGG - Intronic
1057076025 9:92138548-92138570 GCCGCCCTTCCAGGGAGCCCAGG - Intergenic
1060277329 9:122191999-122192021 ACGGCCCTTGGTGGGCACCCAGG - Intronic
1061863462 9:133479336-133479358 CCGGCGCTCCGCGGGGGCCCCGG - Intergenic
1062293927 9:135813655-135813677 GCGGCCCTTGGTGGGCACCTGGG + Intronic
1062575544 9:137205602-137205624 GCGGGCGTTCACGGGCGGCCAGG - Exonic
1186200129 X:7148188-7148210 GAGGACCTTCTCGCGCGCCCGGG + Intronic
1196765230 X:119236597-119236619 GCGGCGCTTCGACGGCGTCCAGG + Exonic
1197335113 X:125203490-125203512 GCTGCCCTTCGAGGGCTCGCTGG - Intergenic
1200209861 X:154342393-154342415 GCGGCCCCTCGACGGCGCCGAGG - Intergenic
1200220991 X:154389699-154389721 GCGGCCCCTCGACGGCGCCGAGG + Intergenic