ID: 1132588731

View in Genome Browser
Species Human (GRCh38)
Location 16:717219-717241
Sequence GGTGGACGCCACAGCGCAGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 78}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132588731_1132588740 4 Left 1132588731 16:717219-717241 CCCACTGCGCTGTGGCGTCCACC 0: 1
1: 0
2: 1
3: 4
4: 78
Right 1132588740 16:717246-717268 CCCAGGCACCTTCCTCTTCATGG 0: 1
1: 0
2: 3
3: 61
4: 336
1132588731_1132588748 22 Left 1132588731 16:717219-717241 CCCACTGCGCTGTGGCGTCCACC 0: 1
1: 0
2: 1
3: 4
4: 78
Right 1132588748 16:717264-717286 CATGGGCTGGAGCCGCTTTGGGG 0: 1
1: 0
2: 0
3: 18
4: 121
1132588731_1132588743 9 Left 1132588731 16:717219-717241 CCCACTGCGCTGTGGCGTCCACC 0: 1
1: 0
2: 1
3: 4
4: 78
Right 1132588743 16:717251-717273 GCACCTTCCTCTTCATGGGCTGG 0: 1
1: 0
2: 0
3: 24
4: 173
1132588731_1132588749 25 Left 1132588731 16:717219-717241 CCCACTGCGCTGTGGCGTCCACC 0: 1
1: 0
2: 1
3: 4
4: 78
Right 1132588749 16:717267-717289 GGGCTGGAGCCGCTTTGGGGAGG 0: 1
1: 0
2: 9
3: 32
4: 261
1132588731_1132588747 21 Left 1132588731 16:717219-717241 CCCACTGCGCTGTGGCGTCCACC 0: 1
1: 0
2: 1
3: 4
4: 78
Right 1132588747 16:717263-717285 TCATGGGCTGGAGCCGCTTTGGG 0: 1
1: 0
2: 0
3: 7
4: 92
1132588731_1132588750 30 Left 1132588731 16:717219-717241 CCCACTGCGCTGTGGCGTCCACC 0: 1
1: 0
2: 1
3: 4
4: 78
Right 1132588750 16:717272-717294 GGAGCCGCTTTGGGGAGGCCCGG 0: 1
1: 0
2: 0
3: 31
4: 194
1132588731_1132588742 5 Left 1132588731 16:717219-717241 CCCACTGCGCTGTGGCGTCCACC 0: 1
1: 0
2: 1
3: 4
4: 78
Right 1132588742 16:717247-717269 CCAGGCACCTTCCTCTTCATGGG 0: 1
1: 0
2: 3
3: 21
4: 217
1132588731_1132588746 20 Left 1132588731 16:717219-717241 CCCACTGCGCTGTGGCGTCCACC 0: 1
1: 0
2: 1
3: 4
4: 78
Right 1132588746 16:717262-717284 TTCATGGGCTGGAGCCGCTTTGG 0: 1
1: 0
2: 1
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132588731 Original CRISPR GGTGGACGCCACAGCGCAGT GGG (reversed) Exonic
900495975 1:2976400-2976422 GGTGGACGCCAGGGCCCAGGTGG - Intergenic
902038207 1:13473093-13473115 GGTGGAGGCCAAAACCCAGTTGG + Intergenic
906131699 1:43462852-43462874 GGGTGACCCCACAGCGCATTAGG + Intergenic
911209327 1:95122621-95122643 GGTGGACACCACAAGGCAGTTGG - Intronic
919523990 1:198624512-198624534 CGTGGAAGCCACAGTGTAGTTGG + Intergenic
1067544837 10:47185166-47185188 GGTGGAGGCTGCAGCACAGTTGG - Intergenic
1074433650 10:113415276-113415298 GGTGGAGGTCAGAGCACAGTGGG - Intergenic
1076795580 10:132796622-132796644 AGTGGAGGCCACACCGCACTAGG + Intergenic
1078210438 11:9265487-9265509 GGAGGTCGCCGCAGCGCAGCCGG + Intergenic
1079145447 11:17847197-17847219 GGTGGGCGCCAGAGCACATTTGG + Intronic
1079413572 11:20212135-20212157 GGTGGGTGCCACAGCACATTGGG + Intergenic
1082920746 11:58490757-58490779 GGTGGACACCACAGTGAGGTTGG + Intergenic
1083547295 11:63558403-63558425 GGGAGACGCCATAGCGCAGATGG + Exonic
1084561019 11:69905505-69905527 GGTGGAGGACTCAGCCCAGTGGG - Intergenic
1095084725 12:38049026-38049048 GGAGGCCCCCACAGCACAGTGGG + Intergenic
1102832644 12:116019310-116019332 GCTGGAGGCCACATTGCAGTTGG - Exonic
1102909950 12:116705687-116705709 GTTGCACGCCACTGCGGAGTTGG - Intergenic
1103922096 12:124404402-124404424 GAGGGACGCCACAGCCCAGGTGG - Intronic
1106592007 13:31105979-31106001 GCTGGACCCCACAGCCAAGTGGG + Intergenic
1113840894 13:113360695-113360717 GGTGGGAGCCACAGGGCTGTGGG - Intronic
1118292766 14:64541086-64541108 CGAGGATGCCACAGTGCAGTCGG + Exonic
1119327421 14:73769125-73769147 GATGGAGGCCACAGGGCAGGAGG - Intronic
1120708699 14:87771398-87771420 GGAGGCCCCCACAGCACAGTGGG + Intergenic
1121845680 14:97170063-97170085 GGTGGAGGCTACAGCACAGCTGG + Intergenic
1123538597 15:21262754-21262776 GGTGGTGGCGACAGAGCAGTAGG - Intergenic
1125929932 15:43593386-43593408 GGTGGAGGACACAGCACAGATGG + Intronic
1125943100 15:43693218-43693240 GGTGGAGGACACAGCACAGATGG + Intronic
1127857398 15:62963624-62963646 TGTGCAGGCCACAGTGCAGTGGG - Intergenic
1130588888 15:85200314-85200336 TGTGGACGCCACAGAAGAGTGGG + Intergenic
1131249255 15:90819902-90819924 GGTGGGGGCCACAGCGCAGGGGG - Intergenic
1132588731 16:717219-717241 GGTGGACGCCACAGCGCAGTGGG - Exonic
1132910480 16:2308209-2308231 GATGGGAGCCACAGGGCAGTGGG - Intronic
1141807403 16:86351141-86351163 GGTGGACGCCAGCGAGCAGGGGG + Intergenic
1143510552 17:7393248-7393270 GGCGGGCGCCACAGCACAGACGG + Exonic
1147559962 17:41502652-41502674 GGTGGTCGCCACCGGGCAGGAGG + Intronic
1147716454 17:42512031-42512053 GGTGGAAGCCAGGGTGCAGTAGG + Intronic
1147945539 17:44078211-44078233 GGTGGAAGCCACAGGGCTGGGGG + Exonic
1152689007 17:81709035-81709057 GGTGGATGCCAGGCCGCAGTCGG + Intergenic
1155457308 18:26031889-26031911 GATGGACTCCACATCTCAGTAGG + Intronic
1160501462 18:79403154-79403176 GGTGGGGGCCACAGCGGCGTGGG - Intronic
1163391877 19:17036104-17036126 GGGGGACAGCACAGGGCAGTTGG + Intergenic
1166679899 19:44759656-44759678 GGTTGACCCCACAGGGCAGGGGG - Exonic
1168342844 19:55635526-55635548 GATGCACTCCACAGCGCAGAGGG - Exonic
926347122 2:11957604-11957626 GGTGGTAGCCACAGCCCAGGTGG + Intergenic
928158091 2:28894778-28894800 GGTAGAGGCCAAAGCGAAGTAGG - Exonic
931762826 2:65432196-65432218 AGTGAACGCCGCAGCGCCGTGGG + Intronic
934560222 2:95309350-95309372 GGTGGAGGCCCCAGGGCAGCAGG - Intronic
948783371 2:240338517-240338539 GGTGGACCCCACACAGCAGCAGG - Intergenic
1172625127 20:36342426-36342448 GCTGGAGGCCTCAGCCCAGTAGG + Intronic
1176137900 20:63532894-63532916 GGTGGCCACCACAGCCCCGTGGG - Intronic
1185090108 22:48761779-48761801 GGCGGACGACACAGAGCAGCTGG + Intronic
1185151138 22:49164549-49164571 GCTGAAAGCCACAGTGCAGTGGG - Intergenic
1185263671 22:49885933-49885955 GGTGGTCGTCACAGCGCGGCCGG - Exonic
949223773 3:1669020-1669042 GGTGAAAACCACAGCCCAGTTGG - Intergenic
969043306 4:4318045-4318067 GGTGGGCGCCACACTGCTGTGGG - Intronic
981615601 4:146640201-146640223 CGTGGACACCACAGCGCCGTCGG - Exonic
982773643 4:159420822-159420844 AGGGGCCCCCACAGCGCAGTGGG - Intergenic
997751253 5:136347946-136347968 AGATGAAGCCACAGCGCAGTTGG - Intronic
999381985 5:151127724-151127746 GATGAAGGCCACAGCGCAGAAGG - Intronic
1002652518 5:180710707-180710729 TGTGGAGGCCAGAGAGCAGTGGG + Intergenic
1003570821 6:7255318-7255340 GAAGGAAGCCACAGCCCAGTGGG + Intergenic
1005559623 6:27025052-27025074 GGTGGATGCCAGATTGCAGTGGG - Intergenic
1007378778 6:41473371-41473393 GGTGGGCCCCACAGAGCACTGGG + Intergenic
1012217301 6:96603016-96603038 GGTGGAAGCCACAGCCAAGGAGG + Intronic
1013849134 6:114492936-114492958 GGAGGACTCCATAGAGCAGTTGG + Intergenic
1018837867 6:167498651-167498673 GGGAGAAGCCACAGCCCAGTGGG + Intergenic
1031401142 7:121327686-121327708 GGTGGACGTATCAGCTCAGTGGG - Intronic
1035336054 7:158127541-158127563 GGTGGCGGCCACAGTGCTGTTGG - Intronic
1038063440 8:23937375-23937397 GTTGGAGGCCACAGAGAAGTGGG + Intergenic
1040279931 8:46035000-46035022 GGAGGCCCCCACAGCACAGTGGG + Intergenic
1046679964 8:117157817-117157839 GTTGGCCGCCACTGCGCAGCTGG - Exonic
1048461100 8:134622690-134622712 GTTGGAAGCCAGAGAGCAGTAGG - Intronic
1049573976 8:143382112-143382134 GATGGAGGCCACAGCACAGGTGG - Intronic
1049806702 8:144544266-144544288 GGTGGAGGCCACAGGGCAGTGGG - Intronic
1051367158 9:16329288-16329310 AGGGGACGCCACAGCACAGTAGG + Intergenic
1056587708 9:87939092-87939114 GGTGGTGGCCACAGACCAGTAGG - Intergenic
1056609162 9:88113847-88113869 GGTGGTGGCCACAGACCAGTAGG + Intergenic
1057223028 9:93267969-93267991 GGTGGGCGCTGCAGCTCAGTGGG + Intronic
1061497393 9:130982793-130982815 GGAGGACGCCACCGCGGAGAAGG + Intergenic
1062453898 9:136626853-136626875 GGTGGAGGTCACAGGGCTGTGGG + Intergenic
1190385527 X:49879617-49879639 GGTGGACGCCACCGAGAAGGTGG + Intergenic
1195238914 X:102931840-102931862 GACAGAAGCCACAGCGCAGTGGG + Intergenic
1200142896 X:153910588-153910610 GCTGGAGGCCACAGCGGAGAGGG - Exonic
1200163039 X:154019003-154019025 GGTGGAGGCCACAGGGAAGCAGG + Exonic