ID: 1132590994

View in Genome Browser
Species Human (GRCh38)
Location 16:726422-726444
Sequence CAGTGGCAGCAGCAGCCATG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 603
Summary {0: 1, 1: 0, 2: 6, 3: 72, 4: 524}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132590994_1132590999 1 Left 1132590994 16:726422-726444 CCCCATGGCTGCTGCTGCCACTG 0: 1
1: 0
2: 6
3: 72
4: 524
Right 1132590999 16:726446-726468 CACTGCTAAGTGCGTTGCCAAGG 0: 1
1: 0
2: 0
3: 7
4: 65
1132590994_1132591002 18 Left 1132590994 16:726422-726444 CCCCATGGCTGCTGCTGCCACTG 0: 1
1: 0
2: 6
3: 72
4: 524
Right 1132591002 16:726463-726485 CCAAGGCCTCTGTTGGTCCCAGG 0: 1
1: 0
2: 5
3: 18
4: 238
1132590994_1132591005 30 Left 1132590994 16:726422-726444 CCCCATGGCTGCTGCTGCCACTG 0: 1
1: 0
2: 6
3: 72
4: 524
Right 1132591005 16:726475-726497 TTGGTCCCAGGTGACTCCCAGGG 0: 1
1: 0
2: 1
3: 15
4: 160
1132590994_1132591004 29 Left 1132590994 16:726422-726444 CCCCATGGCTGCTGCTGCCACTG 0: 1
1: 0
2: 6
3: 72
4: 524
Right 1132591004 16:726474-726496 GTTGGTCCCAGGTGACTCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 121
1132590994_1132591000 11 Left 1132590994 16:726422-726444 CCCCATGGCTGCTGCTGCCACTG 0: 1
1: 0
2: 6
3: 72
4: 524
Right 1132591000 16:726456-726478 TGCGTTGCCAAGGCCTCTGTTGG 0: 1
1: 0
2: 0
3: 8
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132590994 Original CRISPR CAGTGGCAGCAGCAGCCATG GGG (reversed) Exonic
900126495 1:1071109-1071131 CAATGGCAGGACCAGCCCTGCGG + Exonic
900643037 1:3696364-3696386 CACTGGCAGGAGCGGCCATGTGG + Intronic
901018028 1:6242683-6242705 CAGCGGCAACAGCAGCTCTGGGG - Intergenic
902292998 1:15447174-15447196 CCCTGCCAACAGCAGCCATGGGG - Intronic
902410337 1:16208274-16208296 CAGGGGCAGCAGCAGGGAGGAGG - Intronic
902673778 1:17994211-17994233 AGGTGGCAGGAGCAGCCGTGGGG + Intergenic
903137914 1:21321386-21321408 CACTGGGAGGAGCAGCCCTGGGG + Intronic
903349849 1:22711005-22711027 CAGCGGCAGCAGCAGCAGCGCGG - Exonic
903808752 1:26022869-26022891 CAGTTGCAGCTGCCACCATGAGG - Exonic
903907489 1:26696775-26696797 CGGTGGCGGCAGCAGCGATGGGG + Exonic
904077018 1:27850803-27850825 CAGTAGCATCACCAGCCTTGGGG + Exonic
905462517 1:38130942-38130964 CAGTGTAACCAGCAGGCATGTGG - Intergenic
905805731 1:40875907-40875929 CAGCAGCAGCAGCAGCAATGTGG - Intergenic
906243400 1:44256541-44256563 GAGAGGCAGCAGCAGCTCTGGGG - Intronic
906345211 1:45010570-45010592 CAGCGGCAGCAGCAGCTCTTTGG - Exonic
906476626 1:46173637-46173659 CAGAGGCAGCAGCAGCCAGAGGG - Intronic
906691613 1:47796447-47796469 CAGTGGCTCTAGAAGCCATGTGG - Intronic
907249202 1:53126788-53126810 CAGTGGCAGAATTAGCAATGTGG + Intronic
907528796 1:55071968-55071990 CAGTGGCAGCAGCAACCGCCAGG + Intronic
907597747 1:55735272-55735294 GACTGGCAGCAACAGCAATGTGG - Intergenic
907692674 1:56685275-56685297 CAGTGACAGTAGTAGCAATGGGG + Intronic
908854110 1:68405321-68405343 CAGCAGCAGCAGCAGCAATACGG + Intergenic
909593378 1:77377449-77377471 CAGTGGCAGCAGGACTAATGAGG - Intronic
910643408 1:89488832-89488854 CCTCGCCAGCAGCAGCCATGTGG + Intergenic
911789628 1:101996974-101996996 CAGCGGCGGCAGCCGCCCTGGGG + Exonic
912313336 1:108645029-108645051 CAGTGTCAGCAGTGGCAATGTGG - Intergenic
912380252 1:109243706-109243728 CCCTGGCTGCAGCAGGCATGGGG + Intergenic
912382601 1:109255418-109255440 CTGGGGCAGCTGCAGCCATAGGG - Intronic
912611674 1:111052924-111052946 CATTAGCAGCAGCAGCAGTGTGG - Intergenic
912634248 1:111277164-111277186 CAGTGGCAGAAGCAGATGTGAGG - Intergenic
912871583 1:113311516-113311538 CTGGGGCAGCAGTAGCCATGGGG + Intergenic
913182633 1:116336923-116336945 CAGTGACAGCAGCAGTGGTGGGG + Intergenic
913320850 1:117587430-117587452 CAGGGCCAGCAGCAGACACGAGG - Intergenic
913957966 1:143320836-143320858 CCGTGGCAGGACCAGCAATGGGG + Intergenic
914052275 1:144146194-144146216 CCGTGGCAGGACCAGCAATGGGG + Intergenic
914126922 1:144820347-144820369 CCGTGGCAGGACCAGCAATGGGG - Intergenic
914941433 1:152026676-152026698 TGGTGGCAGGAGTAGCCATGCGG + Intergenic
915427067 1:155835709-155835731 CAGCCGCAGCAGCAGACCTGCGG - Intronic
916163126 1:161939658-161939680 CAGGGGCTGAAGCAGCCATCTGG - Intronic
916271855 1:162952009-162952031 CAGTGGCTGAAGTGGCCATGTGG + Intergenic
916584251 1:166136479-166136501 CAGAGACAGCAGCAGCTGTGAGG - Intronic
916733573 1:167587513-167587535 CACTGGCAGCCACAGCCCTGGGG + Intergenic
917152656 1:171961311-171961333 CAGTGACAAGAGCAGCCATGAGG + Intronic
917285250 1:173416206-173416228 CAGTGGCAGCAGCTGGGCTGTGG + Intergenic
918279243 1:182987117-182987139 AAGTGGAAGCAGCAGCCAAAGGG - Intergenic
918332984 1:183477198-183477220 CAATGGCAGCAGAAGTCATTCGG - Intronic
919927422 1:202199477-202199499 CTCTGGCAGCAGCGGGCATGGGG + Intronic
919961335 1:202472819-202472841 CAGTTGCAACAGAAACCATGTGG - Intronic
920033673 1:203051993-203052015 CAATGACAGCTGCAGCCCTGGGG + Intronic
920337480 1:205254854-205254876 CAGTGGCAGCAGGAGACAGGTGG - Intronic
920349583 1:205328998-205329020 CAGAGGCAGCACCAGCGTTGAGG - Intergenic
920453987 1:206083861-206083883 CACTAGCAACAGCAGCCATTGGG + Intronic
920545002 1:206809107-206809129 CAGTGGGGGCAACACCCATGGGG - Intronic
921053104 1:211524979-211525001 CCTTGGCAGCAGCTGCAATGGGG + Intergenic
922728935 1:227940129-227940151 CTGTGTCTGCAGCATCCATGGGG + Intronic
922872322 1:228912842-228912864 CAGCAGCAGCAGCAGCTATGTGG - Intergenic
923624217 1:235601024-235601046 CTGAAACAGCAGCAGCCATGGGG - Intronic
1062851074 10:743987-744009 CAGTGGCAACAACAGCCAGAAGG + Intergenic
1063079399 10:2751263-2751285 CAGAAGCAGCAGCTGCCATTTGG + Intergenic
1063121501 10:3107925-3107947 CTGTGGCTCCAGCAGCCACGGGG + Intronic
1063149314 10:3322208-3322230 CAGAGGCAGGAGCAGCACTGGGG + Intergenic
1063168005 10:3481095-3481117 CAGTATCACCAGCAGACATGGGG + Intergenic
1063370330 10:5517228-5517250 CATTGGCAGCTGCATACATGAGG + Intergenic
1063930727 10:11026172-11026194 AAATGGAAGCAGCAGCCAAGAGG - Intronic
1065822218 10:29536222-29536244 AAGAGGGAGCAGCAGACATGAGG + Intronic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1065892868 10:30135990-30136012 TACTGACTGCAGCAGCCATGGGG - Intergenic
1066007973 10:31165603-31165625 CAGTGGCACCAGCAGGCACTGGG + Intergenic
1066453302 10:35550544-35550566 CAGGAGAAGCAGCAGGCATGGGG - Intronic
1067157361 10:43793222-43793244 CCCCGGCATCAGCAGCCATGGGG - Intergenic
1067430527 10:46240635-46240657 CAGTGGTAGCAGCAGCAACAGGG - Intergenic
1067817032 10:49487514-49487536 CACTGGCACCAGCAGCTAAGTGG - Intronic
1068657594 10:59591347-59591369 CAGCAGCAGCAGCAGCCATATGG - Intergenic
1068791098 10:61032112-61032134 CTGGGGCAGCATCAGCCATAAGG - Intergenic
1069229886 10:65996165-65996187 TGGTGGAAGCAGCAGCCATGGGG + Intronic
1069558965 10:69416318-69416340 CAGACCCAGAAGCAGCCATGGGG - Exonic
1069610010 10:69766648-69766670 CAGTGGGAGCAGAAGCCATGGGG - Intergenic
1069719569 10:70541009-70541031 CAGTGGCTGGGGCTGCCATGTGG + Intronic
1070688967 10:78510754-78510776 CAGGGGCAGCTGCAGGCAGGAGG - Intergenic
1070816653 10:79328653-79328675 CTGTGGCAGCAGCAGAGGTGGGG - Intergenic
1070950647 10:80428320-80428342 CAGTGTCAGCAGAGGCCAGGAGG + Intronic
1071005507 10:80879801-80879823 CAATGTCAGCAGCAGCCCTCTGG - Intergenic
1071208264 10:83309195-83309217 CAGTGGCAAAAAGAGCCATGGGG + Intergenic
1071480513 10:86061597-86061619 CTGGGGGAGCAGCAGCCATCTGG - Intronic
1071982993 10:91022620-91022642 CAGTGGCAGATGCAGCTGTGCGG - Intergenic
1072015193 10:91339996-91340018 GAGTGGCAGCAGCAGCTTTAGGG - Intergenic
1072733748 10:97865655-97865677 CAGTGGCAGCAGCAGCGGTGGGG + Exonic
1072762093 10:98065064-98065086 CAGTGTCTCCAGCAGCTATGTGG + Intergenic
1073535094 10:104269183-104269205 CGGCGGCAGCAGCAGCAAGGAGG - Exonic
1074134524 10:110615239-110615261 CTGTGCCAGCAGCAGCTCTGAGG + Intergenic
1074731356 10:116379869-116379891 CGGTGGCAGCAGGAGCAAAGTGG - Exonic
1075041858 10:119114422-119114444 CAGTGGCAGCAGAAGCCCGCAGG + Intronic
1075454049 10:122573475-122573497 CTGTGGCAGCAGAGGACATGGGG + Intronic
1075485998 10:122822421-122822443 CTGAGGCAGCCGCAGCCTTGGGG + Intergenic
1075717021 10:124561649-124561671 CAGTGTCAGCAGAGGCCAAGTGG + Intronic
1075873601 10:125788863-125788885 CTGACTCAGCAGCAGCCATGGGG + Exonic
1076244345 10:128934337-128934359 CAGCGTCAGCAGGAGCCAAGGGG - Intergenic
1076549717 10:131270619-131270641 CAGCAACGGCAGCAGCCATGCGG - Intronic
1076921977 10:133459034-133459056 CAACGGCAGCAGCAGCTGTGAGG + Intergenic
1077158438 11:1101897-1101919 CAGTGCCAGCAGCAGCCGTCGGG - Intergenic
1077273285 11:1691821-1691843 CAGTGGCTGCAGGGGCCCTGGGG - Intergenic
1078364335 11:10693861-10693883 CAGTGGCACGAGTTGCCATGGGG - Intronic
1079486668 11:20942277-20942299 CATTCCCAGCAGCAGCCAAGAGG - Intronic
1080397690 11:31905017-31905039 CACAGGCAGCAGGAGCCTTGGGG + Intronic
1080800136 11:35602796-35602818 GAGCGGCAGCAGCAGACATGTGG - Intergenic
1081374525 11:42343227-42343249 CAGTGGCAGACTCAGCTATGTGG - Intergenic
1081702762 11:45162272-45162294 CAGGGGTTGCAGCAGCCCTGGGG + Intronic
1081864163 11:46350583-46350605 CAGTGGCTGCTGAAGCCAGGTGG + Intronic
1082046395 11:47732543-47732565 CAGTGGCAGGACCAGCCTTTAGG + Exonic
1082128402 11:48457593-48457615 CAGTGGCAGTAGCAGCCTCAGGG + Intergenic
1083284256 11:61647815-61647837 AAGGGGCAGCAGCAGCCATCTGG - Intergenic
1083560651 11:63670987-63671009 CAGGGGCAGCTGCAGCCCAGGGG + Intronic
1083880948 11:65547964-65547986 CAGTGGCAGGAGTAGTCAGGGGG + Exonic
1084004557 11:66316141-66316163 CAGTGGCAGCTGTAGCCTTGTGG + Exonic
1085282613 11:75340918-75340940 CAGGGCCAGCAGCAGCAGTGTGG - Intronic
1085390761 11:76180975-76180997 GAGTGGGAGCAGCAGGCAGGAGG - Intergenic
1088280077 11:108126638-108126660 AGGTGGCAGCAGTAGACATGAGG + Intronic
1088645623 11:111913967-111913989 CAGAGGTAGCAGCATCCTTGGGG + Exonic
1089502142 11:118938988-118939010 CAGTGGTAGCTGCAGGCATTGGG + Intronic
1089519080 11:119051903-119051925 CAGATGAAGCAGCCGCCATGGGG - Exonic
1089572440 11:119419453-119419475 CAGGAGCAGCAGCAGCCACGAGG + Exonic
1089634883 11:119805741-119805763 CAGTGACGGCAGCAGGCATTGGG - Intergenic
1091802776 12:3334836-3334858 CTGTGGCTGCAGCTGCCATTGGG + Intergenic
1091803676 12:3341466-3341488 CAGAGGAAGAAGCAGCCAGGTGG + Intergenic
1092211098 12:6646996-6647018 CAGAGGCAGGAGCAGCACTGCGG + Exonic
1093127748 12:15350827-15350849 CAGTGGAAGCTGCGGACATGTGG + Intronic
1094480563 12:30877932-30877954 CACTGGCATCAGCAGCCATTGGG + Intergenic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1095396868 12:41771783-41771805 CAGAGGCACCTGCAGGCATGAGG + Intergenic
1095426969 12:42085751-42085773 CAGAGGCAGCAGCAGTCCTTCGG - Exonic
1097269355 12:57764883-57764905 GAGAGGCAGAGGCAGCCATGAGG - Exonic
1097315437 12:58166204-58166226 CTGAGGCCTCAGCAGCCATGTGG + Intergenic
1097315878 12:58171095-58171117 CAGTGGCTGCAGTACCCCTGTGG + Intergenic
1097909023 12:64949271-64949293 CAGCAGCAGCAGCAGCCACATGG - Intergenic
1099072151 12:78058520-78058542 CAGTGACAGCAGCTGATATGAGG + Intronic
1100378695 12:94041985-94042007 CAGAGGCAGCACCAGGCATCAGG - Intergenic
1100544792 12:95591315-95591337 CAGTTACAGCACCAGCCAGGTGG + Intergenic
1101829085 12:108243133-108243155 CAGTGGCATCAGCATCCCTTGGG + Intronic
1102218541 12:111179003-111179025 CAAAGCCAGCAGCAGCCAAGGGG + Intronic
1102361970 12:112295995-112296017 AAGTGAGAGAAGCAGCCATGTGG + Intronic
1102631477 12:114284666-114284688 CACTAGCAGCAGCATCCCTGGGG - Intergenic
1104595194 12:130115868-130115890 CAGGGTCAGCAGCCCCCATGGGG - Intergenic
1104730875 12:131104674-131104696 CGGTGGCAGCAACAGACATTTGG + Intronic
1104891020 12:132140247-132140269 CCGTGGCAGCACCGGCCCTGCGG + Intronic
1104917046 12:132271140-132271162 CTGCGGCAGCAGTGGCCATGTGG + Intronic
1105843485 13:24275200-24275222 CACTGACAGCTGCAGCCAGGAGG + Intronic
1105988396 13:25592436-25592458 TAGTGGCTACAGTAGCCATGAGG + Intronic
1106953214 13:34907434-34907456 CAGTGGCAGCACCATCACTGAGG - Intergenic
1107632736 13:42358694-42358716 CAGTACTAGCAGAAGCCATGTGG - Intergenic
1108320619 13:49286219-49286241 CAGTGGCAGCTGAATCCATCAGG + Exonic
1110255214 13:73426001-73426023 AGGTGACAGCACCAGCCATGTGG - Intergenic
1112265506 13:97919935-97919957 CAGAGGGAGCCCCAGCCATGAGG - Intergenic
1112424807 13:99288286-99288308 CAGTTGCAGTAGGTGCCATGTGG + Intronic
1113120164 13:106917303-106917325 CAGTGGCCGCAGCGGCCATGGGG + Intergenic
1113547029 13:111160863-111160885 CTGTGGCCTCACCAGCCATGTGG + Intronic
1113629124 13:111869025-111869047 CAAGGCCAGCAGGAGCCATGTGG - Intergenic
1116845460 14:49861158-49861180 CAGACCCAGAAGCAGCCATGGGG + Intergenic
1116861573 14:49999985-50000007 AAGCAGCAGCAGCAGCCAAGGGG + Intronic
1117110422 14:52447287-52447309 CTGTGGTAGCAGTGGCCATGGGG + Intronic
1117202464 14:53406286-53406308 CACAGGCAGAAGCAGCCATAAGG - Intergenic
1117474884 14:56084087-56084109 CAGTGGAACCAGCACCCAGGTGG - Intergenic
1118710279 14:68513267-68513289 CACTGGAAGCACCACCCATGAGG - Intronic
1118722512 14:68604442-68604464 CAGTGGCTGCACCAGCCAGGCGG + Intronic
1119970843 14:78968398-78968420 CAGTGGCAGAGGCAGCAAAGAGG - Intronic
1120977751 14:90264548-90264570 CAGTGCCTTCAGCAGCCCTGGGG + Intronic
1121025806 14:90615576-90615598 CAGTGGCTCCAGCAGCCTAGAGG - Intronic
1121332166 14:93056444-93056466 CAGTGGCAGCTGCACTGATGGGG - Intronic
1121539065 14:94711555-94711577 CTGTGGCACAAGCAGCCCTGAGG - Intergenic
1121632717 14:95432764-95432786 GAGTGGCATCAGGAGCCCTGGGG - Intronic
1121660600 14:95632431-95632453 CAGAGGCAGAGGCTGCCATGTGG + Intergenic
1121874635 14:97440136-97440158 CAGCAGCAGCAGCAGTCATGTGG + Intergenic
1122264741 14:100541340-100541362 CCTTGCCAGGAGCAGCCATGGGG - Intronic
1122531336 14:102429584-102429606 TGGTGGCAACAACAGCCATGTGG + Intronic
1122860776 14:104581451-104581473 CAGTGGCCTCAGCGGCCCTGAGG - Intronic
1122905028 14:104797657-104797679 CAGTCCCAGCAGCAGCCGTGGGG - Intergenic
1122937692 14:104967547-104967569 CAGTGGCAGGACCAGGCACGAGG - Intronic
1123137201 14:106038945-106038967 CTGTGGCTACTGCAGCCATGTGG - Intergenic
1202853474 14_GL000225v1_random:36252-36274 CTGTGGCAGGTGCAGCCAGGAGG - Intergenic
1202860860 14_GL000225v1_random:80147-80169 CTGTGGCAGGTGCAGCCAGGAGG + Intergenic
1123758710 15:23416641-23416663 CTGTGGCAGTAGCGGCCATTTGG + Intergenic
1124204382 15:27704593-27704615 CAGAGGCATCCCCAGCCATGTGG + Intergenic
1124794313 15:32762306-32762328 CTGAGGCCGCACCAGCCATGTGG - Intergenic
1125343356 15:38696013-38696035 CAGTGGCAGGAGCTGCCACCAGG - Intergenic
1125434326 15:39629017-39629039 CAGCAGCAGCAGCAGCCAGATGG + Intronic
1125759826 15:42088827-42088849 CAGTGGGAGCCCCAGCCAGGAGG + Intronic
1126183829 15:45811339-45811361 CAGTGGTAGCAGTGGCTATGGGG + Intergenic
1126303031 15:47221291-47221313 CAGGGGGAGCTGGAGCCATGGGG - Intronic
1127768442 15:62210535-62210557 CAGTGATAGCAGGAGCCATGGGG - Intergenic
1127884506 15:63187839-63187861 CAGCAGCAGCAGCAGCCCTCTGG + Intergenic
1128513879 15:68329954-68329976 AAGGGGCAGCAGCAGACTTGTGG - Intronic
1128633783 15:69289854-69289876 CAGTGACAGTAGCAGCCACTGGG - Intergenic
1129109283 15:73328279-73328301 CCATGGCAGGAGCAGGCATGGGG + Intronic
1129763189 15:78143767-78143789 TGGTGGCAGCAGCTGCCAAGGGG + Intronic
1131092511 15:89633161-89633183 CAGTGGCAGCAACGGCTCTGTGG - Exonic
1131188100 15:90292548-90292570 CAGAGGCAGCTGCAGCCTGGGGG + Intronic
1131478438 15:92761692-92761714 CAGTAGCAGCAGAAGCCTAGTGG + Intronic
1131528332 15:93170791-93170813 CAGTGACAGGGGCAGACATGTGG + Intergenic
1131536646 15:93242529-93242551 CAATGGCACCAGCATCCATTTGG - Intergenic
1132300577 15:100773129-100773151 CACTGACTGCAGAAGCCATGTGG - Intergenic
1132413078 15:101600205-101600227 CAGTGTCAGCAGAGGCCACGTGG - Intergenic
1132590994 16:726422-726444 CAGTGGCAGCAGCAGCCATGGGG - Exonic
1133823712 16:9259144-9259166 CAGGGGAAGGACCAGCCATGAGG - Intergenic
1133871774 16:9695349-9695371 TAGTGACAGCAGCAGCCACAAGG - Intergenic
1134457624 16:14406220-14406242 CTGTGGCAGTAGCGGCCATTTGG - Intergenic
1134597483 16:15507477-15507499 CAGTGGCAGTTGGAGCCCTGGGG + Intronic
1136222044 16:28835261-28835283 CAGTGGCTGCAGCAGGAAAGAGG - Exonic
1136518441 16:30781843-30781865 CACAGAGAGCAGCAGCCATGGGG - Exonic
1136550464 16:30979920-30979942 CAGCAGCAGCAGCAGCGATGGGG + Exonic
1136693329 16:32052995-32053017 CTGTGGCTCCTGCAGCCATGTGG + Intergenic
1136773866 16:32860927-32860949 CAATGGCAGGACCAGCAATGGGG - Intergenic
1136793820 16:32996218-32996240 CTGTGGCTCCTGCAGCCATGTGG + Intergenic
1136896745 16:34000592-34000614 CAATGGCAGGACCAGCAATGGGG + Intergenic
1137671107 16:50279787-50279809 CATTGGCAGCTGGAGCCTTGGGG + Intronic
1137810672 16:51349859-51349881 CAGCAGCAGCCGCCGCCATGAGG + Intergenic
1138538026 16:57670072-57670094 CAGGGGCTGAAGGAGCCATGCGG + Intronic
1138656689 16:58495626-58495648 CCGTGACAGCACCAGCCAAGTGG + Intronic
1138886518 16:61086501-61086523 CAATGGCAGCAGCAGCCCGGGGG + Intergenic
1139693618 16:68657128-68657150 CAGAGGCAGCTGCAGCCTGGAGG - Intronic
1140210039 16:72962476-72962498 CACGGGGAGCAGCAGCCATGAGG + Intronic
1140410863 16:74739634-74739656 CCCTGGCACCTGCAGCCATGTGG - Intronic
1141065109 16:80907990-80908012 CAGTGGAACCAGCACCCAGGTGG + Intergenic
1141373625 16:83509413-83509435 CAGTTGCAGCAGCCACCATATGG - Intronic
1141622999 16:85247055-85247077 GAGCAGCAGCAGCAGCCCTGGGG - Intergenic
1141809524 16:86365696-86365718 CTGTGGCAGCAGCTGCTGTGGGG + Intergenic
1141989612 16:87602573-87602595 CGGCAGCAGCAGCAGCAATGCGG - Intronic
1142415414 16:89938591-89938613 CCGAGGCAGCAGCAGACATGAGG - Intergenic
1203076286 16_KI270728v1_random:1123038-1123060 CAATGGCAGGACCAGCAATGGGG - Intergenic
1203096082 16_KI270728v1_random:1257911-1257933 CTGTGGCTCCTGCAGCCATGTGG + Intergenic
1142470697 17:161778-161800 CAGTGCCAGGAGTAGCCAGGAGG + Intronic
1143267727 17:5652973-5652995 TAGTGGCAGCAGCAGCCACTGGG + Intergenic
1143319339 17:6057903-6057925 CAGTGGCAGAACCAGTCTTGGGG + Intronic
1143377167 17:6473617-6473639 GATTGGCACCAGCAGGCATGAGG - Intronic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144512404 17:15888310-15888332 CAGTCCCAGCCGCAGCCATGAGG - Intergenic
1144626203 17:16845590-16845612 CTATGGCAGCAGCAGCTTTGAGG - Intergenic
1144761569 17:17710390-17710412 CAGTTGCAGCTGCGGCCATGAGG + Intronic
1144880230 17:18427130-18427152 CTATGGCAGCAGCAGCTTTGAGG + Intergenic
1145254353 17:21314521-21314543 CAGGGGCAGCAGCATCCACAGGG - Exonic
1145322246 17:21773441-21773463 CAGGGGCAGCAGCATCCACAGGG + Intergenic
1146186991 17:30730665-30730687 GAGTGGCTGGAGCAGACATGGGG + Intergenic
1146683979 17:34828014-34828036 CAGTGGCACCTGAAGCCATGAGG - Intergenic
1146892649 17:36515991-36516013 CTGTGGCAGAAACAGCCCTGTGG + Intronic
1147772472 17:42877560-42877582 AAGTGTCAGCAGCAGCCCAGGGG + Intergenic
1147938710 17:44029734-44029756 CAGTGGCAGCGGAAGCAAGGAGG - Intergenic
1147939864 17:44038816-44038838 CAGTCGCATCAGCTGCCCTGGGG - Intronic
1148637046 17:49156823-49156845 CAGAAGCAGCAGCAGCCAGTGGG - Intronic
1148850761 17:50553990-50554012 CAGAGGCATCAGCAGCGAGGAGG + Intronic
1148871969 17:50663620-50663642 CAGAGGAGGGAGCAGCCATGGGG + Intronic
1151507556 17:74539547-74539569 CTGTGACAGCAGGAGCCATTGGG - Intergenic
1151509094 17:74547392-74547414 CTGTGACAGCAGGAGCCATTGGG - Intergenic
1152007387 17:77691142-77691164 CAGTGGCAGCATCAGCCTTCAGG - Intergenic
1152227975 17:79101543-79101565 CAGTGACCCCAGCAGCCTTGTGG + Intronic
1152394554 17:80024240-80024262 GGGTGGGAGCAGCAGGCATGGGG - Intronic
1152755804 17:82086542-82086564 CAGTGCCTGCACCAGCCCTGGGG + Exonic
1153240764 18:3029522-3029544 CTGTGACAGCATCAGCTATGAGG - Intergenic
1153311398 18:3680344-3680366 CAGTGGCAGCCACAGGCCTGAGG + Intronic
1153778982 18:8477950-8477972 CAGTGGAAGCAGCAGGAAGGTGG + Intergenic
1153925723 18:9833185-9833207 CAGTGGATACAGCAGCCATCCGG - Intronic
1153988257 18:10372490-10372512 AGGTGGCAGCAGAAGCCAGGGGG - Intergenic
1153994186 18:10425571-10425593 CAGTGGGGGCTGCAGGCATGGGG - Intergenic
1154097363 18:11430587-11430609 CAGTGGCAGTAGCAACCATCTGG - Intergenic
1155087557 18:22472934-22472956 GAGTGGGAGCACCAGCCAGGTGG + Intergenic
1155135070 18:22982951-22982973 CAATGGCAGGAGTACCCATGTGG - Intronic
1155249995 18:23945238-23945260 CAAAGGCAATAGCAGCCATGTGG - Intronic
1156019953 18:32588589-32588611 CAGTGACACCAGGAGCTATGGGG - Intergenic
1157732975 18:50020665-50020687 AGGTGGCAGCAGCAACCAGGTGG + Intronic
1157763665 18:50282313-50282335 CAGTTGCAACCGCAGCAATGTGG + Intergenic
1158873573 18:61711582-61711604 CAGTTGCAGCAACTGCCCTGAGG - Intergenic
1159079692 18:63723251-63723273 CGGAGGCAGCAGCAGCCACTGGG + Exonic
1159642473 18:70879551-70879573 CAGTGGTATCAGAAACCATGTGG - Intergenic
1160289009 18:77572835-77572857 GAGCGGGAGCTGCAGCCATGAGG - Intergenic
1160606808 18:80057789-80057811 CAGTGGCAGCATTAGGCATTAGG + Intronic
1161033835 19:2072995-2073017 CTGTGGCCACAGCAGCCCTGGGG + Exonic
1161302226 19:3548204-3548226 CAGGTGCAGCAGGAGCCAGGCGG + Exonic
1161800578 19:6415133-6415155 CAGGGACAGCAGCAGGCAAGTGG - Exonic
1161943016 19:7417732-7417754 CAGAAGGAGCAGCAGCCACGGGG + Intronic
1162790620 19:13060841-13060863 CAGTGGCGGCAGCAGCCGGGCGG - Intronic
1162797464 19:13094341-13094363 CTGTGCCAGCGCCAGCCATGGGG + Intronic
1162865142 19:13540267-13540289 CAGTGGCAGCTGGAACGATGAGG - Intronic
1163175939 19:15564122-15564144 CAGCAGCAGGAGCAGCCATGGGG - Intergenic
1163186259 19:15641465-15641487 CAGCAGCAGGAGCAGCCACGGGG - Exonic
1163190528 19:15673579-15673601 CAGCAGCAGGAGTAGCCATGGGG - Exonic
1163222824 19:15934337-15934359 CAGCAGCAGAAGCAGCCACGGGG + Exonic
1163290483 19:16376459-16376481 CATTGGCAGCACTGGCCATGGGG + Intronic
1164072134 19:21778009-21778031 CAGTGGCAGCAGCAGGCTCCAGG + Intergenic
1164162001 19:22633259-22633281 CAAAGTCAGAAGCAGCCATGGGG - Intergenic
1164672108 19:30078078-30078100 CAGTGGCCTCAGCAGCCCCGTGG - Intergenic
1165304662 19:34996107-34996129 CAGCGGAAGCAGCAGCCACAGGG + Intronic
1166374014 19:42316867-42316889 CAGGGGCCGCATCAGCCACGCGG + Exonic
1166420561 19:42633029-42633051 CACAGGCAGCACAAGCCATGAGG - Intronic
1166420761 19:42634149-42634171 CAGTGGCAGCAGACCCCATGTGG + Intronic
1166499541 19:43330655-43330677 CCTGGGCAGCAGCAGCCATCTGG - Intergenic
1167720123 19:51173736-51173758 CAGAGGCAGCAGCAGGCCTGGGG + Intergenic
1167762918 19:51460671-51460693 AAGTTGGAGCAGCAGCCCTGAGG + Intergenic
1167768630 19:51500359-51500381 CAGGGGCAGCAGCATCTCTGAGG + Intronic
1167859532 19:52271507-52271529 CAGGGTCAGCAACAGCCAGGGGG - Intronic
1202691672 1_KI270712v1_random:98618-98640 CCGTGGCAGGACCAGCAATGGGG + Intergenic
924971162 2:128198-128220 CAGGGGCAGCAGAGGCCCTGGGG + Intergenic
925069918 2:958148-958170 CAGGGGCTGCAGCCACCATGCGG - Intronic
925170369 2:1746466-1746488 CAGTGTGAGCTGCAGCCCTGGGG - Intergenic
925208526 2:2027113-2027135 CTGTGGCGGCAGCGGCGATGGGG - Intronic
925350023 2:3194481-3194503 GAGGGGCTGCAACAGCCATGGGG + Intronic
926246082 2:11123276-11123298 CCTTTGCAGCAGCAGCCTTGTGG - Intergenic
926305414 2:11634370-11634392 CAGAGGCGGCGGCAGCCCTGGGG + Intronic
927613670 2:24566963-24566985 CAGTTGCAGCTGCACCCAGGAGG + Intronic
927854658 2:26520450-26520472 AAGTGGTAGGGGCAGCCATGAGG + Intronic
927895443 2:26778634-26778656 CTGTGGCAGCAGCTGCCCTGGGG - Exonic
930092836 2:47543886-47543908 CAGTGGCAGAAGTAGCTATGAGG - Intronic
931861254 2:66356830-66356852 CAGTGTCAGCAACAGTCAGGTGG - Intergenic
932526486 2:72475443-72475465 CTGTGGTAGTAGCAGTCATGTGG + Intronic
933719946 2:85391409-85391431 CAGGGGCAGCAGCCGACAGGGGG + Exonic
933954716 2:87355332-87355354 CCGTGGCAGGACCAGCAATGGGG - Intergenic
934274282 2:91565152-91565174 CCGTGGCAGGACCAGCAATGGGG + Intergenic
934517827 2:94999753-94999775 CAGGCACAGCAGCAGCCAGGTGG + Intergenic
934715648 2:96541871-96541893 CAGCAGCAGCAGCAGCTATCAGG + Intronic
934996564 2:98967135-98967157 CAGTGGCAGCAGCAGCACACTGG + Intergenic
935200648 2:100853742-100853764 CAGGGGCATCTGCAGCCAGGTGG + Intronic
935433471 2:103003131-103003153 CACAGCCAGCAGCAGCCAGGGGG - Intergenic
935900789 2:107790574-107790596 CAGAGGCCTCACCAGCCATGTGG - Intergenic
936403374 2:112182676-112182698 CAGTGGCAGCTGCAGTTAAGTGG - Intronic
937318108 2:120944868-120944890 CAGCAGCAGCAGCATCCCTGTGG + Intronic
937747496 2:125431934-125431956 TGGTGGCAGCAGCCGCCATGTGG + Intergenic
937989132 2:127652715-127652737 CAGTGGCAGAGGCAGCCTCGTGG + Intronic
938701622 2:133885034-133885056 TAGTCAAAGCAGCAGCCATGGGG + Intergenic
938730244 2:134141739-134141761 CATTGCCAGCAGGGGCCATGTGG + Intronic
939948841 2:148444279-148444301 CAGTGGAAGCAGAAGCCAAAAGG - Intronic
939998827 2:148947311-148947333 CAGAGGCAGCTGCACACATGTGG + Intronic
940200107 2:151140936-151140958 CTGTGGCAGCAGCCCCCATAAGG - Intergenic
942914874 2:181293790-181293812 CAACCGCAGCAGCAGCGATGTGG + Intergenic
943093747 2:183404535-183404557 CAGCAGCAGCAGCAGCCATGTGG + Intergenic
944155340 2:196601700-196601722 CAGCAGCAGCAGCAACTATGAGG - Intergenic
944312496 2:198249233-198249255 TAGTGGTAGTGGCAGCCATGTGG + Intronic
945213005 2:207403034-207403056 TACTGACAGCAGAAGCCATGAGG + Intergenic
946826738 2:223687011-223687033 CAATTGCAGCATCAGCTATGTGG - Intergenic
947147739 2:227083872-227083894 CAGTGGCATCAGCAATCATCAGG + Intronic
947889474 2:233604365-233604387 CAGTGGTACCAGCTGCCATCAGG + Intergenic
948003935 2:234591978-234592000 CAGTGGATGTAGCAGCCATGGGG + Intergenic
948006852 2:234616804-234616826 CAGTAGCAGCAGAAGCGAGGAGG + Intergenic
948240584 2:236429743-236429765 CTGTGGCAGGAGCAGTCATGTGG + Intronic
948482754 2:238260848-238260870 CAGCGACAGCAACGGCCATGAGG - Exonic
948584385 2:239009771-239009793 CAGTGGCCGCAGCAGTAACGTGG + Intergenic
948648260 2:239422593-239422615 AAGTGGGAGCAGGAGCCCTGTGG - Intergenic
949058607 2:241943550-241943572 GAGAGGCAGCAGCTGCCCTGAGG + Intergenic
1169130908 20:3166021-3166043 TAGTGGCGGCAGCAGCGGTGGGG - Exonic
1169195917 20:3681951-3681973 TAGTAGCAGCAGCAGCAACGGGG + Exonic
1169244555 20:4015447-4015469 CGGTGGCAGCGGCAGACGTGCGG + Intronic
1170629726 20:18056788-18056810 CAGCGGCAGCAGCAGCGCGGGGG - Exonic
1170784751 20:19457876-19457898 GAGTGGCAGCTCCAGCTATGAGG + Intronic
1171348604 20:24485850-24485872 CGGGGGCAGTAGCAGCCATCTGG - Intronic
1171361354 20:24588582-24588604 TGATGGCAGCAGCATCCATGAGG - Intronic
1172096707 20:32463999-32464021 CTGTCACAGCAGCAGCCAGGCGG + Intronic
1172196608 20:33096161-33096183 CAGTGGCAGCTCCAGCCAGCAGG + Intronic
1172222702 20:33284699-33284721 CAGGGGCAGGAGCTTCCATGGGG + Intronic
1172792073 20:37512589-37512611 CTGTGGCAGCAGCTCACATGTGG - Intronic
1173250709 20:41362899-41362921 CAGGGACAGCAGGAGCCCTGGGG + Exonic
1173282889 20:41645056-41645078 CAGCAGCAGCAGTAGCTATGGGG + Intergenic
1173603340 20:44311308-44311330 CAGAGGCAGCAGCGGCCACGAGG - Intergenic
1173889722 20:46496964-46496986 AAGTACCAGCATCAGCCATGAGG + Intergenic
1173955628 20:47030365-47030387 CAGTGGCAGGTTCAGGCATGGGG + Intronic
1174369452 20:50076776-50076798 CAGGGCCACCAGCAGCAATGAGG + Intergenic
1174387229 20:50194335-50194357 CAGTAGCAGCGACAGCAATGTGG + Intergenic
1174660207 20:52205798-52205820 CCAAGGCGGCAGCAGCCATGTGG + Intergenic
1175598691 20:60255582-60255604 CAGTGGCAGCAGCTGGAATTAGG + Intergenic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1175842723 20:62040426-62040448 CAGTGACAGCAGCAGCTCAGTGG + Intronic
1176093404 20:63328865-63328887 CGGAGGAAGCAGCAGCCAGGAGG - Intronic
1176273141 20:64246835-64246857 CAGGGGCAGCGGGAGGCATGAGG + Intergenic
1176383090 21:6123108-6123130 CAGCAGCAGCAGCAGGAATGGGG - Exonic
1176674814 21:9768173-9768195 CAGAGGAAGCCGCAGCCCTGGGG - Intergenic
1177278943 21:18952602-18952624 CAGTAAGAGCAGCAGCCAGGTGG - Intergenic
1178995285 21:37393764-37393786 CAGTGCCAGCAGATGCCACGTGG - Intronic
1179078980 21:38152488-38152510 CAGTGGGAGAACAAGCCATGGGG + Intronic
1179740379 21:43415131-43415153 CAGCAGCAGCAGCAGGAATGGGG + Exonic
1180752808 22:18136786-18136808 GAGTGGCAGGAGCAGCCAGCGGG + Intronic
1181165570 22:20981216-20981238 CAGTGGCAGCAGAGGCCTTGAGG - Exonic
1181376878 22:22465722-22465744 CACTGGAAGCAGCAGCAATAAGG + Intergenic
1181517941 22:23426716-23426738 TGGTGGCAGCAGCAGGCATCGGG + Intergenic
1181541364 22:23574767-23574789 CAGTGGGAGCAGCCGCCTTCAGG - Intronic
1181551253 22:23640101-23640123 CAGTGGGAGCAGCCGCCTTCAGG - Intergenic
1181797019 22:25318555-25318577 CAGTGGGAGCAGCCGCCTTCAGG + Intergenic
1183334235 22:37237484-37237506 CAGCGGCAGGAGCAGGGATGGGG + Intronic
1183450807 22:37893907-37893929 CAGTGTCGGCAGCAGGCATGAGG + Intergenic
1183488269 22:38101992-38102014 CAGTGTGACCAGCATCCATGTGG + Intronic
1184383249 22:44159664-44159686 CCTTGCCAGCAGCTGCCATGAGG - Intronic
1184926324 22:47642291-47642313 CAGTGCCAGCAGAGACCATGTGG + Intergenic
1185075621 22:48680575-48680597 CAGGGGCAGCAGCAGTGCTGGGG - Intronic
1185173221 22:49305348-49305370 CAGAGGCGGCAGCAGCCACCAGG - Intergenic
950609484 3:14116854-14116876 CTGTGGCCGCATCAGCTATGTGG - Intronic
950718619 3:14866889-14866911 CAGAGGCAGGAGCATCCATCCGG + Intronic
951189276 3:19749625-19749647 CAGAGGCCGCAGCTGTCATGCGG - Intergenic
951871611 3:27368624-27368646 CAAGAGCAGCAGCAGACATGGGG + Intronic
952857222 3:37782297-37782319 AAGTGCAAGCAGCAGCCATCTGG - Intronic
953382902 3:42487423-42487445 CAGAAGCAGCAGTGGCCATGTGG + Intergenic
954289726 3:49643238-49643260 CTGGGTCTGCAGCAGCCATGGGG + Intronic
954404359 3:50337244-50337266 CAGTGGCTACTGCAGCCAAGAGG - Intronic
954419869 3:50413112-50413134 CAGCGGCAGCAGCAGCTGGGTGG - Intronic
954636928 3:52076061-52076083 CAGTGGCTGAGGCAGCCAAGTGG - Intronic
958075952 3:88678867-88678889 GAGTGCCAGCACCAGCCATCAGG + Intergenic
958760204 3:98297272-98297294 CTGGGGCAGTAGTAGCCATGAGG + Intergenic
959118453 3:102205848-102205870 CTGTGGCGGCAGTGGCCATGGGG - Intronic
959530622 3:107431138-107431160 CAGTGGCAGCAGCAGAACCGGGG + Intergenic
960492540 3:118334265-118334287 CTGAGGCATCACCAGCCATGTGG + Intergenic
960718796 3:120604893-120604915 CAGTGTAAGCAGCAGCCACTTGG - Intergenic
961412537 3:126733180-126733202 CGAAGGCAGCATCAGCCATGAGG + Exonic
961427332 3:126858469-126858491 GAGGGGCAGCAGAGGCCATGGGG - Intronic
961671437 3:128534533-128534555 CAGTGGGAGCAGAATCCAGGTGG + Intergenic
961678534 3:128583369-128583391 CAGTGGCCTCAGCATCCCTGTGG + Intergenic
963135000 3:141894698-141894720 CAGGGGCAGCAACACGCATGGGG + Intronic
963973269 3:151452918-151452940 CAGGGGCAGCAGCAGGTACGAGG + Intronic
964237160 3:154545192-154545214 CAGTGAGAGCTGCAGCCATGCGG + Intergenic
964574266 3:158147005-158147027 CAGCAGCACAAGCAGCCATGGGG - Intronic
966808861 3:183826021-183826043 CAGGGGCAGGTGCAGCAATGAGG + Intergenic
968066968 3:195764128-195764150 CAGCGGCAGCACCAGCTCTGTGG + Exonic
968688392 4:1976730-1976752 GAGCGGCAGCAGCCGCCATCAGG - Intronic
969643321 4:8412123-8412145 CAGGAGGAGAAGCAGCCATGGGG + Intronic
969651457 4:8470662-8470684 CAGTGGCTGCTCCAACCATGGGG - Intronic
971148562 4:24006391-24006413 CAAAGGCTGCAGCACCCATGTGG + Intergenic
971609101 4:28699177-28699199 CATTGGCAGCAGCAGACACTAGG - Intergenic
972878992 4:43400207-43400229 CAGTGTTATCAGCAGCCCTGTGG + Intergenic
975233036 4:71957021-71957043 GAGTTGCAGGAGCAGCCAGGTGG - Intergenic
976140997 4:81991491-81991513 TAGAGGCAGCAGCAGCAGTGGGG + Intronic
977009096 4:91613114-91613136 CTGTGGTGGCAGCTGCCATGTGG - Intergenic
977696577 4:99972237-99972259 CAGAGGCAGCAGCAGCACAGGGG - Intergenic
978008782 4:103652429-103652451 CATCCCCAGCAGCAGCCATGTGG - Intronic
981495371 4:145385769-145385791 CAGTGTCAGCAGAGACCATGTGG - Intergenic
981518300 4:145634328-145634350 CTGTGGCAGTGGCAGTCATGGGG - Intronic
981615456 4:146639365-146639387 CAGTGGCAGCAGCGGCGGCGGGG + Exonic
982737105 4:159018241-159018263 CAGGGGCTGCTGCAGCCACGTGG - Intronic
983523679 4:168737922-168737944 CAGAGACAGCAGCAGCTGTGAGG + Intronic
984260038 4:177434414-177434436 CAGGGGCAGCCGCAGCCACTGGG - Exonic
985677627 5:1240384-1240406 GACTGGCAGCAGCAGCCCTTGGG + Intronic
985886439 5:2683831-2683853 CAAGGGCAGCAGCAGCCAACAGG + Intergenic
986151494 5:5133956-5133978 ACGTGGCAGAAGCAGTCATGTGG + Intergenic
986229888 5:5853413-5853435 CACTGACTGCAGCTGCCATGTGG - Intergenic
986673971 5:10167725-10167747 AAGTGGCAGGAGCAGCCAGGTGG + Intergenic
989165385 5:38428698-38428720 CAGTGGCAGCTCCAGCTGTGGGG + Intronic
990626922 5:57623991-57624013 CAGTGGGGGCAGAGGCCATGAGG + Intergenic
993870628 5:93249881-93249903 CAGCGGCATACGCAGCCATGCGG + Intergenic
997118278 5:131149044-131149066 CAGTGGCAGCAGCATCAAGTTGG - Intergenic
997512812 5:134465197-134465219 CAGTGGCAGTGGCAGCGACGAGG + Intergenic
998225521 5:140323427-140323449 CAGTGGCCCCAGCAGCCGGGTGG - Intergenic
998594273 5:143511959-143511981 CAGTGGCAGCAGCATCATTTAGG - Intergenic
999939689 5:156528612-156528634 CAGTGGCACGAGCAGCTATGTGG + Intronic
1000426094 5:161093314-161093336 CAGTGGGAGCAGGAGACAAGTGG + Intergenic
1000859817 5:166443898-166443920 CAGTAGCAGCAGAAGGCAAGAGG - Intergenic
1001906731 5:175479008-175479030 CGGGGGCAGCGGCAGCCAGGTGG + Intronic
1002048305 5:176554335-176554357 CAGTGGGAGGAGCAGCCATAAGG + Intronic
1002180416 5:177428274-177428296 CAGTGCCATCAGCAGGCCTGAGG - Intronic
1002934176 6:1657666-1657688 CTGTGGGAGCAGCAACCATGTGG + Intronic
1003385225 6:5661201-5661223 CAATGGCAGCATCATCCATCTGG - Intronic
1003727164 6:8777957-8777979 CAGGGACAGCAGCAGCCAAAAGG - Intergenic
1003960132 6:11201201-11201223 CAGCGGCAGCAGAGGCCATGTGG + Intronic
1004158367 6:13191133-13191155 CAGAGGCAGAAGTAGCCAGGTGG - Intronic
1004612054 6:17251594-17251616 TAGTGGCAGTAGAAGTCATGTGG - Intergenic
1005040300 6:21595014-21595036 CAGTGGCGGGGGCGGCCATGGGG + Exonic
1005088738 6:22034269-22034291 CAGGGGCAGCAGCAGTCCTGAGG - Intergenic
1005565745 6:27092225-27092247 CAGTGGCACCAGCAGCACTTGGG - Intergenic
1006091103 6:31629578-31629600 CAGTGGCAGCAGCATCAACAGGG + Exonic
1006259004 6:32853175-32853197 CACTGCCCGCAGCAGCCCTGTGG - Exonic
1006864952 6:37201841-37201863 CAGTGGCAGCAGCTCTCCTGGGG - Intergenic
1007132731 6:39491687-39491709 CAGTGTTAGCAGAAGCCTTGAGG + Intronic
1007239257 6:40413416-40413438 CAGTGGCTGCAGTAGCTCTGGGG + Intronic
1007581649 6:42963506-42963528 CAGAGGCCCCAGCAACCATGAGG - Intronic
1007654920 6:43446124-43446146 CACTGGCATCTGCAGCCCTGAGG + Intronic
1007791794 6:44313291-44313313 CAGTGGCAGCTGCAGCCCGGAGG - Exonic
1007986734 6:46214869-46214891 TAGTGCCAGAAGCTGCCATGTGG - Intergenic
1008017970 6:46542257-46542279 GAGTGACAGAAGCACCCATGTGG - Intergenic
1008071832 6:47105984-47106006 CAGAGGCAGCAGCAACAATGAGG + Intergenic
1009785548 6:68333563-68333585 CAGTGGCAGCTAGAACCATGGGG + Intergenic
1010230019 6:73526217-73526239 TATTGGCAGCATCTGCCATGTGG + Intergenic
1010815712 6:80355837-80355859 CTGTGGCAGTAGCAGCCCTTAGG - Intergenic
1012668917 6:102015650-102015672 CAGTAGCAGCAGCAGCACGGTGG - Intronic
1013373979 6:109496345-109496367 CAGTGCCTGCAGCAGCCAGGAGG - Intronic
1014494177 6:122100140-122100162 CGGAGCCAGCAGCAGCAATGTGG + Intergenic
1016030899 6:139336790-139336812 CAGTGGCTGCTGTAGCCGTGAGG + Intergenic
1016486309 6:144543436-144543458 CAGTGGCAACAGTGGCTATGGGG - Intronic
1016988586 6:149913235-149913257 CATCAGCAGTAGCAGCCATGTGG - Intergenic
1016994384 6:149951413-149951435 CATCAGCAGCAGCAGCCATGTGG + Intergenic
1017443779 6:154489137-154489159 CAGATCCAGAAGCAGCCATGTGG - Intronic
1017525025 6:155234879-155234901 CAGAGGCAGCAGGAGGCGTGAGG + Intronic
1017778166 6:157695656-157695678 CAGAGGCAGAAGGAGCCCTGTGG - Intergenic
1017840905 6:158222295-158222317 CAGCAGCAGAAGCAGTCATGGGG - Intergenic
1018029033 6:159827491-159827513 CTGTTCCAGCTGCAGCCATGTGG + Intergenic
1018064882 6:160117921-160117943 CTGGGACAGCAGCAGGCATGGGG - Intergenic
1018228330 6:161652178-161652200 CAGGGGCAGCATTAGCCATGAGG + Intronic
1019401527 7:856821-856843 CAGGAGCAGCAGCAGAGATGAGG - Intronic
1019484193 7:1281144-1281166 CAGCAGCAGCAGCAGCCAGGAGG + Intergenic
1019527688 7:1488046-1488068 CAGAGGCAGCAGCAGCCGTAGGG - Intronic
1019556707 7:1635158-1635180 CAGTGGCCCCAGCAGTCATGGGG + Intergenic
1019929886 7:4216347-4216369 GAGTGGGAGCAGCGGCCGTGGGG - Intronic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1021459276 7:20867159-20867181 CAATGGCAGCTGAAGCCATCAGG - Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1021702114 7:23329715-23329737 GAGTGTATGCAGCAGCCATGTGG + Intronic
1022142993 7:27509361-27509383 GTGTAGCAGCAGAAGCCATGAGG + Intergenic
1023795855 7:43791336-43791358 CAGTGAGAGCTCCAGCCATGAGG + Exonic
1025082951 7:56000387-56000409 CAGTGGCAGAAGCAGACATGAGG + Intergenic
1025973820 7:66353713-66353735 CACTGACAGCAGCAGCCTGGAGG - Intronic
1026268543 7:68816620-68816642 CAGAGCCAGCAGCAGACAGGAGG + Intergenic
1026502888 7:70957982-70958004 TTATTGCAGCAGCAGCCATGGGG + Intergenic
1026601047 7:71777426-71777448 CAGTGGCTGCCGCAGACCTGTGG - Intergenic
1027405527 7:77855836-77855858 CATTCCCAGCAGCAGCCACGTGG - Intronic
1027951865 7:84826486-84826508 CTGTGGCTGAAGCAGCCCTGAGG + Intergenic
1030243699 7:107359097-107359119 CAGCTGCAGCTGTAGCCATGAGG - Intronic
1031318599 7:120290605-120290627 CAGTGGAAGCAATAGCCATATGG + Intronic
1031991311 7:128201066-128201088 CGGTGGCAGGAGCAGCCAGGAGG + Intergenic
1032487259 7:132297188-132297210 GAGTGGCAGCAGCGGCCATGAGG - Intronic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1033282486 7:140015922-140015944 CAGTGGAGGCAGCAGCCGGGAGG + Intronic
1033469528 7:141632398-141632420 CAGGGGCATCAGCAACCAAGAGG - Intronic
1033619550 7:143049860-143049882 CAGGGGCAGCAGCATTGATGTGG - Intergenic
1033765693 7:144488052-144488074 CAGCAGCAGCAGCATCCCTGGGG + Intronic
1034426346 7:151016201-151016223 CAGCAGCAGCAGGAGCCGTGGGG - Exonic
1034998566 7:155593845-155593867 CAGTGGCAGCACCAGCCAGAGGG - Intergenic
1035004398 7:155644576-155644598 CCGAGGCCGCAGCAGCCCTGAGG - Intronic
1035232119 7:157471510-157471532 CACGGGCAGCCTCAGCCATGCGG - Intergenic
1035355466 7:158273804-158273826 CAGGGGGAGCCGCAGGCATGGGG + Intronic
1035719062 8:1777738-1777760 CAGGGGCAGTAACAGACATGGGG + Intronic
1035724690 8:1817277-1817299 GAAGGGCAGCAGCTGCCATGCGG - Intergenic
1035983692 8:4401995-4402017 CAGTGGTAGCAGCAGGAATGTGG - Intronic
1036445836 8:8821149-8821171 CAGAGGGAGCAGCTGCCAGGTGG + Intronic
1036931061 8:12955863-12955885 CAATGACAGCAGCAACCCTGGGG - Intronic
1036946571 8:13100095-13100117 CAGCAGCAGCAGCAGCCAGTCGG - Exonic
1037260186 8:17000269-17000291 CAGTGGAAGCTGCAAACATGTGG + Intronic
1037434174 8:18845536-18845558 CAGTGTCAGCCACACCCATGAGG + Intronic
1037618672 8:20543920-20543942 CAGTGGCACGAGGAGCCGTGGGG + Intergenic
1038437317 8:27545263-27545285 AAATAGCAGCAGCTGCCATGAGG + Exonic
1038748388 8:30273941-30273963 CTGAGGCAGCCCCAGCCATGTGG + Intergenic
1039447981 8:37647938-37647960 CAGGGCCAGCAGCAGCTCTGAGG - Intergenic
1039467982 8:37797303-37797325 CAGCGGCAGCAGCAGGCGCGCGG - Exonic
1039630542 8:39107528-39107550 CAGTGGCTCCAGCAACCACGCGG + Intronic
1040611006 8:48982253-48982275 CAGAGGCAGTAGCAGCAATTGGG - Intergenic
1041427701 8:57741414-57741436 CAGTGTCAGCATGAACCATGGGG + Intergenic
1041477709 8:58284053-58284075 CAGTGGCAACTGTATCCATGAGG + Intergenic
1041869370 8:62615821-62615843 CCCTGGCAGCAGCAGCAGTGTGG - Intronic
1042898260 8:73694746-73694768 CACTCCCAGCAGCAGCCATGTGG + Intronic
1044124310 8:88438399-88438421 CTGTGGTAGCAGTGGCCATGGGG + Intergenic
1044313882 8:90727060-90727082 CAGCGGCAGCAGCAGCATGGTGG - Intronic
1044826923 8:96207670-96207692 CAATGGCAGCAGGGGCTATGCGG - Intergenic
1045263632 8:100599964-100599986 CTTTGGCAGCAAGAGCCATGAGG - Intronic
1046556507 8:115779694-115779716 CGGCGGCAGCAGGAGCCCTGGGG - Intronic
1047337294 8:123948988-123949010 CACTAGCACCAGGAGCCATGTGG + Intronic
1047401480 8:124552164-124552186 CAGAGGCAGCAGCATGCATGGGG + Intronic
1047493071 8:125390222-125390244 CAGCGGCAGCAGCAGCGTGGGGG - Intergenic
1047819931 8:128507726-128507748 CAGTGGCAACTGTAGTCATGTGG - Intergenic
1048267068 8:132997205-132997227 AATTGGCACCACCAGCCATGGGG - Intronic
1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG + Intronic
1049108401 8:140627900-140627922 CAGTGGGGGCAGCAGCCCTGGGG - Intronic
1049237238 8:141518483-141518505 CAGGGGCCGCAGCAGCGCTGGGG - Exonic
1049670791 8:143868952-143868974 CAGTGGCAACAGCAACAATCCGG + Exonic
1049836407 8:144738370-144738392 GAGTGGAAGCAGCACCCCTGTGG + Intronic
1049852537 8:144840769-144840791 AGTTGGCAGCAGCAGCCAGGAGG + Intronic
1050607767 9:7318976-7318998 CACTGCCAGCAGCAGACATTGGG - Intergenic
1050881011 9:10700704-10700726 CAGTGTGAGCAGCAGCACTGTGG - Intergenic
1051376171 9:16404969-16404991 CAGTGGCAGCAGGAACCGTCAGG - Intergenic
1051797262 9:20886543-20886565 CAGTGGCATCAGAAGTTATGAGG + Intronic
1051898013 9:22008905-22008927 CAGTGGGGGCGGCAGCGATGAGG - Exonic
1051991961 9:23162648-23162670 CTGTCCCAGCAGCAGCCATTCGG + Intergenic
1053329498 9:37190210-37190232 CAGTGACAGCAGCAGCAGTGGGG - Intronic
1053399993 9:37810411-37810433 CAAAAGCAGCAGCAGCAATGAGG + Intronic
1055563179 9:77542603-77542625 CAATGGCAGTAGCAGTGATGGGG + Intronic
1055687732 9:78795531-78795553 CAAGGTCACCAGCAGCCATGAGG - Intergenic
1056126967 9:83543917-83543939 CCCTGGCGGCAGCAGCTATGCGG - Intergenic
1057274202 9:93667612-93667634 CGGGGGCTGCAGCTGCCATGGGG + Intronic
1059369582 9:113816522-113816544 CAGTGGCAGAAGAAGACATATGG - Intergenic
1060409696 9:123391976-123391998 CAGAGGCGGGAGCAGCCGTGGGG - Intronic
1060547572 9:124470172-124470194 CAGTGGGACCAGCAGGGATGGGG - Intronic
1061867429 9:133500066-133500088 CGCCGGCAGCAGCAGCCAAGGGG - Intergenic
1061909318 9:133714417-133714439 CAGAGGCCGGAGCAGCCATCTGG + Intronic
1061915790 9:133752926-133752948 CAGTGGCAGCAAAAACCACGGGG - Intergenic
1062016021 9:134291793-134291815 CAGAGGCAGCCGCAGCCTTTTGG + Intergenic
1062145044 9:134984461-134984483 CAGCAGCAGCAGGAGCCCTGTGG - Intergenic
1062403702 9:136383536-136383558 CAGCAGCAGCAGCAGCGAGGAGG - Exonic
1203793912 EBV:166086-166108 CAGTCGCTGCTGCAGCTATGGGG + Intergenic
1185445757 X:257242-257264 CAGTTGCAGCAGCAACCAGCCGG - Intergenic
1185846805 X:3445400-3445422 CAGTGCCAGCAGCATGCAGGTGG + Intergenic
1186180228 X:6966920-6966942 CTGTGGGAGCAGCACACATGAGG - Intergenic
1186581563 X:10825326-10825348 CAGTGAAAGCTGCAGCCATAGGG - Intronic
1187846313 X:23541335-23541357 CAGGGGCAGCAGTGGCTATGAGG + Intergenic
1188707892 X:33357806-33357828 CAGTGGCAGGAGCAGCAAGGTGG - Intergenic
1189023789 X:37370579-37370601 CAGTTGCAGCTGCACCCAGGAGG - Intronic
1189381807 X:40507476-40507498 CTGCGGAAGCAGTAGCCATGAGG + Intergenic
1189558047 X:42165718-42165740 CAGTGGCAGCAGCAGCACGGTGG + Intergenic
1190028151 X:46945493-46945515 CAGTGGTAGCAGCAGCACTGGGG - Intronic
1190124023 X:47687491-47687513 ACGTGGCAGCATCAGCCATGTGG - Intergenic
1190919509 X:54839050-54839072 CTGTGGTTGCAGCGGCCATGGGG - Intergenic
1191755059 X:64583828-64583850 AAGTGTCTGTAGCAGCCATGAGG - Intergenic
1191800349 X:65072738-65072760 CAGTGGCAGCAGCAACATGGTGG + Intergenic
1192017470 X:67347069-67347091 AAGTGGCAGCAGCAGCTAGTAGG + Intergenic
1193168401 X:78307768-78307790 GAGTGGCAGCAGCAGAAGTGTGG + Intronic
1193644274 X:84047633-84047655 CAGTGTCAGCAGCAGCCCCAGGG + Intergenic
1193790145 X:85807835-85807857 CAGTGGGAGCGGCAGCCCAGCGG + Intergenic
1193915046 X:87353746-87353768 CAGAGGCAGCAGGAGCCAAGTGG - Intergenic
1194268603 X:91782510-91782532 CAGGCGAAGCAGCAGCCACGGGG - Intronic
1195687988 X:107602686-107602708 CTGCAGCAGCAGCAGCCCTGAGG + Exonic
1195703816 X:107724225-107724247 CAGTGGCAGGAGGAGGCAGGGGG + Intronic
1195809896 X:108817639-108817661 CTGAGGTAGCAGCAGCCAAGTGG - Intergenic
1196986853 X:121282725-121282747 CAGTGGCAGCATCAGCTCTGGGG + Intergenic
1197241997 X:124129872-124129894 CAGTGGCTGCAGCAGTCAAAGGG - Intronic
1197348371 X:125351168-125351190 GAGTGGCAGAAGCACCCTTGTGG - Intergenic
1199610937 X:149612968-149612990 CAGTGGAAGCAGAAGCGATATGG - Intronic
1200585803 Y:5003425-5003447 CAGGCGAAGCAGCAGCCACGGGG - Intronic
1200817697 Y:7550517-7550539 CAGTGCCAGCAGCATGCAGGTGG - Intergenic