ID: 1132592682

View in Genome Browser
Species Human (GRCh38)
Location 16:733176-733198
Sequence GAGCCCCCACACTCCAGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 16030
Summary {0: 1, 1: 5, 2: 64, 3: 1243, 4: 14717}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132592678_1132592682 18 Left 1132592678 16:733135-733157 CCTGGCTCCAAGGGGAGAGACGA 0: 1
1: 0
2: 2
3: 16
4: 152
Right 1132592682 16:733176-733198 GAGCCCCCACACTCCAGCCAGGG 0: 1
1: 5
2: 64
3: 1243
4: 14717
1132592677_1132592682 21 Left 1132592677 16:733132-733154 CCACCTGGCTCCAAGGGGAGAGA 0: 1
1: 0
2: 9
3: 26
4: 235
Right 1132592682 16:733176-733198 GAGCCCCCACACTCCAGCCAGGG 0: 1
1: 5
2: 64
3: 1243
4: 14717
1132592676_1132592682 22 Left 1132592676 16:733131-733153 CCCACCTGGCTCCAAGGGGAGAG 0: 1
1: 0
2: 4
3: 31
4: 238
Right 1132592682 16:733176-733198 GAGCCCCCACACTCCAGCCAGGG 0: 1
1: 5
2: 64
3: 1243
4: 14717
1132592680_1132592682 11 Left 1132592680 16:733142-733164 CCAAGGGGAGAGACGAAGGTACG 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1132592682 16:733176-733198 GAGCCCCCACACTCCAGCCAGGG 0: 1
1: 5
2: 64
3: 1243
4: 14717

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132592682 Original CRISPR GAGCCCCCACACTCCAGCCA GGG Intronic
Too many off-targets to display for this crispr