ID: 1132593555

View in Genome Browser
Species Human (GRCh38)
Location 16:737642-737664
Sequence GGCCCCGGTGCACACTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 116}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132593549_1132593555 1 Left 1132593549 16:737618-737640 CCATGGGGCCCTGGACGGGGTGC 0: 1
1: 0
2: 0
3: 23
4: 277
Right 1132593555 16:737642-737664 GGCCCCGGTGCACACTCACAGGG 0: 1
1: 0
2: 0
3: 12
4: 116
1132593540_1132593555 14 Left 1132593540 16:737605-737627 CCACCCCACTCACCCATGGGGCC 0: 1
1: 0
2: 4
3: 34
4: 348
Right 1132593555 16:737642-737664 GGCCCCGGTGCACACTCACAGGG 0: 1
1: 0
2: 0
3: 12
4: 116
1132593542_1132593555 10 Left 1132593542 16:737609-737631 CCCACTCACCCATGGGGCCCTGG 0: 1
1: 0
2: 2
3: 20
4: 229
Right 1132593555 16:737642-737664 GGCCCCGGTGCACACTCACAGGG 0: 1
1: 0
2: 0
3: 12
4: 116
1132593548_1132593555 2 Left 1132593548 16:737617-737639 CCCATGGGGCCCTGGACGGGGTG 0: 1
1: 0
2: 0
3: 9
4: 151
Right 1132593555 16:737642-737664 GGCCCCGGTGCACACTCACAGGG 0: 1
1: 0
2: 0
3: 12
4: 116
1132593552_1132593555 -8 Left 1132593552 16:737627-737649 CCTGGACGGGGTGCTGGCCCCGG 0: 1
1: 0
2: 3
3: 20
4: 306
Right 1132593555 16:737642-737664 GGCCCCGGTGCACACTCACAGGG 0: 1
1: 0
2: 0
3: 12
4: 116
1132593551_1132593555 -7 Left 1132593551 16:737626-737648 CCCTGGACGGGGTGCTGGCCCCG 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1132593555 16:737642-737664 GGCCCCGGTGCACACTCACAGGG 0: 1
1: 0
2: 0
3: 12
4: 116
1132593544_1132593555 9 Left 1132593544 16:737610-737632 CCACTCACCCATGGGGCCCTGGA 0: 1
1: 0
2: 3
3: 27
4: 260
Right 1132593555 16:737642-737664 GGCCCCGGTGCACACTCACAGGG 0: 1
1: 0
2: 0
3: 12
4: 116
1132593541_1132593555 11 Left 1132593541 16:737608-737630 CCCCACTCACCCATGGGGCCCTG 0: 1
1: 0
2: 1
3: 22
4: 268
Right 1132593555 16:737642-737664 GGCCCCGGTGCACACTCACAGGG 0: 1
1: 0
2: 0
3: 12
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132593555 Original CRISPR GGCCCCGGTGCACACTCACA GGG Intronic
900519843 1:3100224-3100246 GGCCCCAGTGCCCACTCTCTGGG + Intronic
901157138 1:7148584-7148606 GGCCTTGGTGCTCACTCAGAAGG - Intronic
901404577 1:9037878-9037900 GGCCCCGGGCCCCACTCACCTGG + Exonic
901464551 1:9413042-9413064 GGCACTGGAGCACACTTACAAGG + Intergenic
902644973 1:17791661-17791683 TGGCCCGGTGCCCACTCGCAGGG - Intronic
902813431 1:18902443-18902465 GGGCCCCGTGCTCACTCACCCGG + Exonic
907373490 1:54017836-54017858 TGCCCCGGGGCTCACTCCCAGGG - Intronic
911519928 1:98917165-98917187 CGCCCCAGTGCAGATTCACAAGG + Intronic
914869453 1:151460484-151460506 TGCACATGTGCACACTCACACGG - Intergenic
918983576 1:191595436-191595458 GGTCCAGCTGCAGACTCACAGGG - Intergenic
1073101593 10:101009370-101009392 GGTCCGGCTGCACTCTCACACGG - Intronic
1076406345 10:130214633-130214655 GGCCCCGGAGCACGCTCTGAAGG - Intergenic
1077335066 11:1999777-1999799 GGCCCCGGGTCACACTCCGAGGG - Intergenic
1081010896 11:37811650-37811672 GGCCCAGCTGCAGCCTCACATGG - Intergenic
1084152062 11:67292276-67292298 GGCCTCTGGGCTCACTCACAAGG + Intronic
1084649710 11:70482003-70482025 GGCCACGGGACACACTGACAAGG - Intronic
1084741082 11:71140010-71140032 GGCCTCGGTGCAGACTCACTCGG + Intronic
1084765398 11:71305148-71305170 GGCCTCTGTCCTCACTCACATGG - Intergenic
1087534304 11:99424560-99424582 GGCCCAGCTGCAGCCTCACATGG - Intronic
1202818049 11_KI270721v1_random:54959-54981 GGCCCCGGGTCACACTCCGAGGG - Intergenic
1103048805 12:117761324-117761346 GGCCCCTGTGTACACCCACGTGG - Exonic
1104671944 12:130686642-130686664 GGCCCCGGGCCACGCGCACATGG + Intronic
1109288008 13:60434840-60434862 GGTCCCTGTGCACACCCACCTGG - Intronic
1115191602 14:30752822-30752844 TGCCCCTGTGCACACTGACTGGG + Intergenic
1118823399 14:69359790-69359812 GGCCGCGGTGGGCAATCACAAGG + Intergenic
1118892163 14:69919606-69919628 GGCCCAGCTTCACATTCACAAGG - Intronic
1119351451 14:73969124-73969146 GCCCCAGGGGCACACACACATGG - Intronic
1122688993 14:103522747-103522769 GGCCCCCGGGCCCACTCACCGGG + Exonic
1122984120 14:105204372-105204394 GGCCGCAGTCCACACCCACATGG - Intergenic
1129120641 15:73394344-73394366 GGGCCAGCTGCACAGTCACAGGG + Intergenic
1130648953 15:85751427-85751449 GGCCCGGGGGGACACCCACAGGG - Intergenic
1132593555 16:737642-737664 GGCCCCGGTGCACACTCACAGGG + Intronic
1136691475 16:32034398-32034420 GGCCCTGCTGGACACTCACATGG + Intergenic
1136792064 16:32977963-32977985 GGCCCTGCTGGACACTCACATGG + Intergenic
1136877753 16:33875945-33875967 GGCCCTGCTGGACACTCACATGG - Intergenic
1141676980 16:85523188-85523210 GGCACACGTGCACACACACAGGG - Intergenic
1203094273 16_KI270728v1_random:1239427-1239449 GGCCCTGCTGGACACTCACATGG + Intergenic
1144627617 17:16852341-16852363 AGCCCGGGTGCACACTCACTGGG + Intergenic
1144878825 17:18420381-18420403 AGCCCGGGTGCACACTCACTGGG - Intergenic
1145153411 17:20524013-20524035 AGCCCGGGTGCACACTCACTGGG + Intergenic
1145170683 17:20653868-20653890 TGCCCCCGTGGGCACTCACAGGG + Intergenic
1146164163 17:30575029-30575051 TACCCGGGTGCACACTCACTGGG + Intergenic
1151224897 17:72640641-72640663 TGCCCCGGTGCACGTTCCCAGGG - Intergenic
1151589838 17:75035928-75035950 GGGCTCTGTCCACACTCACACGG + Intronic
1151947334 17:77326864-77326886 GGCCTCCGTGAACACTCAGAAGG + Intronic
1152388886 17:79991526-79991548 GGCTGGGGTGCACACTCACTTGG - Intronic
1153564064 18:6401695-6401717 GCGCCCTGTGCACACCCACAAGG + Intronic
1154235057 18:12597348-12597370 GGCTCCAGAGCACACACACAGGG + Intronic
1157510184 18:48265844-48265866 GGGCCCAGTGCAGAATCACATGG - Intronic
1160343543 18:78110477-78110499 GACCTCCGTGCACACTCACCAGG + Intergenic
1160761712 19:788825-788847 GGCCCCGCTGCACGCTCCCCCGG - Intergenic
1160841150 19:1147557-1147579 GGCCCCGCTGCACATACAGAGGG + Intronic
1161256744 19:3314108-3314130 GGCCTTGGAGCACGCTCACAGGG + Intergenic
925345787 2:3171013-3171035 TGCCACGGTGCACACACGCAGGG + Intergenic
927472461 2:23386025-23386047 AGCCCCGGTGCATACACACCCGG - Intronic
932860726 2:75288568-75288590 GGCCCCGTTGCACACTGAATTGG + Intergenic
937360449 2:121225766-121225788 TGCCACGGTGCCCACACACACGG + Intronic
937360457 2:121225807-121225829 TGCCACGGTGCCCACACACACGG + Intronic
937360465 2:121225848-121225870 TGCCACGGTGCCCACACACAAGG + Intronic
937360486 2:121225971-121225993 TGCCACGGTGCCCACACACACGG + Intronic
947792604 2:232876704-232876726 GGCCCCGGCGCACGCGCACCGGG - Intronic
1171069155 20:22049524-22049546 GGCCCTGGTGCAGGCTCATAGGG + Intergenic
1173314888 20:41934125-41934147 GGGCCCTGTGCAGTCTCACATGG - Intergenic
1176297760 21:5083282-5083304 GACCCCTGTGCACAGTCACTCGG + Intergenic
1176382231 21:6119237-6119259 GGCCCCCGGGGACACTTACATGG - Exonic
1177568047 21:22848533-22848555 GCCCCCTGTGCACAATCACCTGG + Intergenic
1178943268 21:36925363-36925385 GGCCACGATGAACACCCACAAGG + Intronic
1179442833 21:41407655-41407677 GGCCCTGGTGCATACCCAGAAGG + Intronic
1179575334 21:42305006-42305028 GGCCCCAGTGCTGACTCACAAGG - Intergenic
1179741241 21:43419002-43419024 GGCCCCCGGGGACACTTACATGG + Exonic
1179859269 21:44178667-44178689 GACCCCTGTGCACAGTCACTCGG - Intergenic
1180954467 22:19735478-19735500 GGCCCAGGAGGACACTGACAAGG - Intergenic
1180994687 22:19959642-19959664 GGCTTCAGTTCACACTCACAAGG + Intronic
1182255407 22:29034079-29034101 GGCCCAAGTGAACACTCACTTGG + Intronic
1182295828 22:29310912-29310934 AGCCCCGGCGCTCACTCCCAGGG - Exonic
1182526856 22:30925960-30925982 GGCCCTGCTGCACCCACACATGG + Intronic
1183105791 22:35614149-35614171 GGCCCAATTGGACACTCACATGG + Intronic
1184089161 22:42283442-42283464 GGCCCCGGGTCACAGTCCCAGGG - Intronic
1184502985 22:44885210-44885232 GGCCCCGGTGCACACCTGCAGGG + Intronic
1184684976 22:46092242-46092264 GGCCCACGTCCACACGCACACGG + Intronic
1184996434 22:48210660-48210682 AGCCCAGCTGCACACCCACAGGG + Intergenic
949981124 3:9502218-9502240 TGCCCCGTGGCTCACTCACAGGG - Exonic
950907075 3:16548765-16548787 GGCACCGCTGCACACTCATTAGG + Intergenic
953198443 3:40755327-40755349 GGATCCTGTGCACACTGACAAGG + Intergenic
954385697 3:50242721-50242743 GGCCTCTGTGCACATTTACAAGG + Intronic
954457982 3:50610357-50610379 TGCCCAGGTACACACTCACCAGG - Exonic
957292891 3:78300083-78300105 GGCCCCTGTGAGCCCTCACAGGG + Intergenic
959437548 3:106335207-106335229 GGACCCTGTGCATAGTCACATGG + Intergenic
961111735 3:124289896-124289918 GGCCCGGGTGGATATTCACATGG + Intronic
963062975 3:141240245-141240267 TGCCCCACTACACACTCACATGG - Intronic
963338131 3:144000955-144000977 GGACTGAGTGCACACTCACAGGG + Intronic
968899421 4:3424022-3424044 GCCCCCAGTGCACGGTCACATGG + Intronic
977714061 4:100161036-100161058 AGCCTGGGGGCACACTCACATGG + Intergenic
985630448 5:1011294-1011316 GGCCCAGGTGCGCCCTCACCTGG + Intronic
991520312 5:67490069-67490091 CACACCTGTGCACACTCACATGG + Intergenic
1001090295 5:168735185-168735207 AGCCCCAGTGCAAACACACAAGG + Intronic
1001823108 5:174725035-174725057 TGCCCCGGCGCGCACTCACTTGG - Exonic
1002198773 5:177515167-177515189 GTCCACAGTCCACACTCACATGG + Exonic
1002254049 5:177945745-177945767 GGCCCAGGTGCAGACACGCAGGG - Intergenic
1003017872 6:2482545-2482567 GGCCTAAGTGCACACTCACCTGG + Intergenic
1003033208 6:2620672-2620694 GGCCCGGGTTCACACTGACCAGG + Intergenic
1004567434 6:16812058-16812080 GGCCCCACAGGACACTCACAAGG - Intergenic
1006300111 6:33189440-33189462 GGGCCCGGAGCACATCCACAGGG + Exonic
1011284071 6:85705529-85705551 GGTCCAGATGCAGACTCACACGG - Intergenic
1013619309 6:111872982-111873004 GGCTCCGGAGCCCACTCACATGG + Exonic
1017194838 6:151688383-151688405 GGCCAGGGTTCAAACTCACATGG - Intronic
1017567986 6:155709319-155709341 GACCCCAGGGCACATTCACAGGG - Intergenic
1019358277 7:592208-592230 GGCCCGTGTGCACCCTCACTCGG - Intronic
1019656553 7:2199053-2199075 GGCCCCAGTGCACTCTGGCAGGG - Intronic
1019771060 7:2883772-2883794 TGCCACGGTGCACACTGGCAGGG - Intergenic
1027187131 7:75979380-75979402 GGCTCCGGTGAACACCCACTGGG - Intronic
1029707102 7:102281917-102281939 CGCCCGTGTGCACACTCACCAGG - Intronic
1031532050 7:122886877-122886899 AGCCCCGGTGGACGCTTACACGG - Intergenic
1033518081 7:142129432-142129454 GGGCCCGGTGCAGAATGACATGG + Intronic
1033946487 7:146725121-146725143 GGCCTCCATGCTCACTCACATGG + Intronic
1035752890 8:2008385-2008407 GGGCTCTGTGCTCACTCACAGGG - Intergenic
1036712052 8:11086040-11086062 TGCCCCGGAGGACACTCTCACGG + Intronic
1040859468 8:51984213-51984235 GGCCCCGGGGTGCACTCAGAAGG - Intergenic
1048986374 8:139737282-139737304 GGACCCGCTGCTCAATCACAAGG + Intronic
1049389798 8:142361795-142361817 GGGACGGGTGCACACACACAGGG + Intronic
1049734786 8:144199229-144199251 GGCATCTGTGGACACTCACAGGG + Intronic
1049790341 8:144469536-144469558 GGCCAGGCTCCACACTCACAAGG - Exonic
1050424902 9:5502530-5502552 GCCCCCTGTGCACATTCACATGG - Intergenic
1057667924 9:97061108-97061130 GGACCAGGTGCACACACTCAGGG - Intergenic
1059061272 9:111037822-111037844 GGCCCCGGGGCGCACTGACCTGG + Exonic
1061000463 9:127899531-127899553 GGCCCCCGAGCCCCCTCACATGG + Exonic
1061848988 9:133403641-133403663 GGCCCCCCTGCACACACCCAAGG + Intronic
1186977279 X:14921440-14921462 AGCCACTGTGCACACACACAGGG - Exonic
1187281294 X:17860490-17860512 GGCGCCGACGCACACTCACCCGG + Intronic