ID: 1132599313

View in Genome Browser
Species Human (GRCh38)
Location 16:766955-766977
Sequence CTTGCTTTCCAGAACATGAA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 213}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132599307_1132599313 -4 Left 1132599307 16:766936-766958 CCTCTATCCCAAGGCCCGCCTTG 0: 1
1: 0
2: 1
3: 6
4: 126
Right 1132599313 16:766955-766977 CTTGCTTTCCAGAACATGAACGG 0: 1
1: 0
2: 2
3: 24
4: 213
1132599302_1132599313 29 Left 1132599302 16:766903-766925 CCTGGACACGTGTGACCCAAGGC 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1132599313 16:766955-766977 CTTGCTTTCCAGAACATGAACGG 0: 1
1: 0
2: 2
3: 24
4: 213
1132599305_1132599313 13 Left 1132599305 16:766919-766941 CCAAGGCAGCTGGACGTCCTCTA 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1132599313 16:766955-766977 CTTGCTTTCCAGAACATGAACGG 0: 1
1: 0
2: 2
3: 24
4: 213
1132599304_1132599313 14 Left 1132599304 16:766918-766940 CCCAAGGCAGCTGGACGTCCTCT 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1132599313 16:766955-766977 CTTGCTTTCCAGAACATGAACGG 0: 1
1: 0
2: 2
3: 24
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132599313 Original CRISPR CTTGCTTTCCAGAACATGAA CGG Exonic
902006629 1:13237340-13237362 CCTGCTTTCTAGAGCATTAAAGG + Intergenic
902025686 1:13381741-13381763 CCTGCTTTCTAGAGCATTAAAGG + Intergenic
903533139 1:24047465-24047487 CTTACTTGCCACACCATGAATGG - Intergenic
903561318 1:24230200-24230222 CTTGCTTACCACACCCTGAATGG - Intergenic
909354007 1:74686273-74686295 ATTGCTTTGCAGGACTTGAAGGG + Intergenic
910672484 1:89787002-89787024 CTTGCTGGCCAGAACCTGATTGG + Intronic
912159761 1:106967472-106967494 CCTGCTTTCCAGACCATGCCTGG - Intergenic
913385812 1:118257034-118257056 CTGGCCTTCCAGATCATGAGTGG + Intergenic
916785822 1:168086457-168086479 CCTACTTTCCAGAAAATGTAAGG - Intronic
919245857 1:194982945-194982967 CTCGCTTTTCACAACATGCATGG - Intergenic
920791281 1:209095324-209095346 CTTGCATTCAATAACAGGAAGGG - Intergenic
923154390 1:231264761-231264783 CTGGCTGTCCAGAGCATGAAGGG + Intronic
924374551 1:243391605-243391627 CTTGGTTTTCAGAATATCAAAGG + Intronic
924636557 1:245793405-245793427 CATGCTTTCCAGAGCATGGCGGG + Intronic
1063018347 10:2101091-2101113 CCTTCTCTCCAGAACATGACTGG - Intergenic
1063079468 10:2751774-2751796 CTTGATTTCCAGATGGTGAATGG - Intergenic
1064021188 10:11810476-11810498 CTTGCTTTCCTGGAAATGACAGG + Intergenic
1065409328 10:25406284-25406306 CTGACTTTCCAGAAGATGGAAGG - Intronic
1069341778 10:67418153-67418175 CTTGCTTTCCAAAATAATAAAGG - Intronic
1070578583 10:77700562-77700584 CTTGCTTTCAAGAAAATTAAAGG + Intergenic
1072741253 10:97911282-97911304 CCTGCTTTGTAGAAAATGAAGGG - Intronic
1075906675 10:126087720-126087742 CTTGCTTTCCTGAAAATCAGTGG - Intronic
1077852125 11:6083455-6083477 ATTTCTTTCCAGAACTTTAAGGG - Intergenic
1078348098 11:10569340-10569362 CTGGCCTACCAGAATATGAAAGG - Intronic
1078744820 11:14102196-14102218 ATTGCTTTGGAGAACATGAGAGG - Intronic
1080178164 11:29392354-29392376 CTTCCTCTCCAGACCATGGAGGG - Intergenic
1081562620 11:44231791-44231813 CTTGCTTTCCAAATCTGGAAAGG - Intronic
1087601048 11:100316099-100316121 CAAGCTTTTCAGAACATAAAAGG + Intronic
1088417558 11:109606370-109606392 CTTGCTTTCCAGATAATCCATGG + Intergenic
1090580054 11:128149404-128149426 CTTCAATTCCAAAACATGAAGGG + Intergenic
1090655824 11:128844489-128844511 TTTGCTTTCAAGAATTTGAAGGG - Intronic
1091925992 12:4349807-4349829 CTTGATTTTCAGACCATGCATGG + Exonic
1091948175 12:4567998-4568020 CTTGCTTTCAAAACCAGGAAGGG - Intronic
1092139360 12:6172078-6172100 CTTGCTTTCCTGCAGATGGATGG + Intergenic
1092609268 12:10154320-10154342 CTGGTGTTCCAGAACCTGAAAGG + Intergenic
1093385574 12:18549077-18549099 CTAGCTGTCCAGAATATCAAGGG - Intronic
1093553973 12:20448578-20448600 CTTGGTTTTCAAAACATGAATGG + Intronic
1094701402 12:32874072-32874094 CTGGCTTTCCAAAAGAAGAATGG - Intronic
1097737012 12:63193798-63193820 CTTTCTGTCCAGAACAGCAAAGG + Intergenic
1100379357 12:94047252-94047274 TTTGCTTTCCACAATAGGAATGG + Intergenic
1100569482 12:95833799-95833821 CTAGCTTTCTAGGAAATGAATGG + Intergenic
1102212383 12:111136796-111136818 CTTGCCTTCCAGGACTGGAAAGG + Intronic
1102623236 12:114213711-114213733 CTTGCTCTACAGAAACTGAATGG - Intergenic
1105442999 13:20430688-20430710 CTTGCTTTCTCCAATATGAAAGG - Intronic
1105792199 13:23812561-23812583 CTTGAGTTCCAGACCATGACGGG + Intronic
1106033193 13:26020810-26020832 CTTTCTTTACAGAACGAGAAGGG - Exonic
1106133367 13:26957571-26957593 CTTGCTTTCAAGATGATAAAAGG + Intergenic
1109906100 13:68844594-68844616 GTTGCTTTGCAGAAAATTAAAGG + Intergenic
1110339694 13:74374985-74375007 CTTGTTTTCTAAAACATAAATGG + Intergenic
1111668575 13:91300297-91300319 CTTGTTTTCCTGAACCTGGATGG - Intergenic
1112326875 13:98447474-98447496 CTTGCAGTCCAGATCCTGAAAGG + Intronic
1113220863 13:108100448-108100470 CTTGCTTACTAGAAGAGGAAAGG - Intergenic
1113420454 13:110167319-110167341 TGTGCTTTCCAGAACATTGAGGG - Intronic
1113679176 13:112230651-112230673 CTAGAATTACAGAACATGAAAGG + Intergenic
1115472120 14:33778875-33778897 GTTGTTCTCCAGAAAATGAAAGG - Intronic
1119178056 14:72584047-72584069 CTGGATTTCCATAACATAAATGG + Intergenic
1126231397 15:46330379-46330401 CCTGCTTTTGAGAACCTGAATGG - Intergenic
1127753686 15:62069068-62069090 GGTGCTTTCCACAACATGCATGG + Exonic
1130548372 15:84872870-84872892 CTTGATTTCCAGACCTTAAATGG - Exonic
1131387970 15:92023252-92023274 CTTTCTTTACAGAACATACAAGG + Intronic
1131861713 15:96660843-96660865 CTTGCTGTGCAGAACATGAGAGG - Intergenic
1132599313 16:766955-766977 CTTGCTTTCCAGAACATGAACGG + Exonic
1132775162 16:1589512-1589534 CTTGCTATCCAGAAGAGAAAGGG + Intronic
1137841221 16:51642602-51642624 ATTGCTTTGCAGAAAATAAAAGG - Intergenic
1137875976 16:51997175-51997197 CTTTCTTTCAAAAACATGAAGGG - Intergenic
1138173497 16:54875019-54875041 GTTACTTTCCAGAACCAGAAAGG - Intergenic
1139066466 16:63321729-63321751 ATTGTTTTCCAGAATAAGAATGG + Intergenic
1139533877 16:67559741-67559763 CTTGGTTTCTAGAAAAAGAAGGG + Intergenic
1144417935 17:15069462-15069484 CTTGGGTTCCAGAATATGAATGG - Intergenic
1146634581 17:34494608-34494630 CTTGCAGTCCAGACCATGGATGG + Intergenic
1149836913 17:59921336-59921358 CTTGCTTTCAAGGACAAGGAAGG - Intronic
1150119969 17:62592821-62592843 CTTGCTTTCCTGCAGTTGAACGG + Intronic
1151378241 17:73706529-73706551 CATGCATCCCAGAACAGGAACGG - Intergenic
1152700003 17:81814009-81814031 CCTGCTTTCCAGGACATGCACGG - Exonic
1154150276 18:11901108-11901130 CTGGCTTTTCAGAAGATGAAAGG + Intronic
1154335119 18:13458836-13458858 CTGGCTTTCCAGATGATGAAGGG + Intronic
1156426664 18:37020698-37020720 ATTGCTTTCCAGAAGGTGTATGG + Intronic
1159514748 18:69444213-69444235 CGTGCTCTCCAAAACATCAAAGG - Intronic
1160849906 19:1185669-1185691 GGTCCTTTCCAGAACATCAACGG - Intronic
1160890262 19:1373963-1373985 CTGGCTTACCAAAACAGGAAAGG + Intronic
1162593633 19:11610218-11610240 CGTTCTTTCCTGGACATGAAGGG + Intronic
1162619806 19:11833109-11833131 CTTCCTTTCGATATCATGAAAGG + Exonic
1162629076 19:11911983-11912005 CTTCCTTTCCATATCATGAAAGG + Intronic
1162637332 19:11980019-11980041 CTTCTTTTCGATAACATGAAAGG + Intergenic
1162641714 19:12015457-12015479 CTTTCTTTCAAATACATGAAAGG - Exonic
1162649514 19:12076417-12076439 CTTCCTTTCGATATCATGAAAGG + Exonic
1162649530 19:12076585-12076607 CTTCCTTTCGATATCATGAAAGG + Exonic
1162653802 19:12113259-12113281 CATCCTTTCAAAAACATGAAGGG + Exonic
1164967456 19:32497662-32497684 GTTACTTTGCAGAACGTGAAAGG - Intergenic
1165549364 19:36570777-36570799 CTTGATTTACAGAAAATGTATGG + Intronic
1165686871 19:37829472-37829494 CATGCTTTCAAGAATATCAAGGG + Intergenic
1165802213 19:38559662-38559684 CATGCTTTGCAAATCATGAAGGG - Intronic
1165804040 19:38569570-38569592 CCTGCTTTACAGAAGATGAAAGG - Intronic
1167219049 19:48185434-48185456 CTTTCTTTCAAGAGCATTAAGGG - Intronic
1167769464 19:51505310-51505332 CTGGCTTTCCAGGACTGGAAGGG + Intergenic
926225350 2:10963188-10963210 TTTTCTTTCCAGAACAGGAATGG + Intergenic
928075758 2:28263034-28263056 CTTGCCTTCCAGTAGATGAAAGG + Intronic
928101315 2:28439133-28439155 AATGCTTTCCAGAACAGGGAAGG - Intergenic
928892511 2:36220111-36220133 CTTCCTTTTCAAAATATGAATGG - Intergenic
929651736 2:43686601-43686623 TTTGCTTTCCATATAATGAAGGG - Intronic
929750876 2:44712000-44712022 CTTTATTTCCAGAGCATGTAAGG - Intronic
931922654 2:67037874-67037896 TTTGTTTTCCACAACCTGAAAGG - Intergenic
934910974 2:98254111-98254133 CTTGCTTTTCAGAACCTGGAGGG + Intronic
935430909 2:102974613-102974635 CTTGCTTTCTGGAAACTGAAAGG + Intergenic
936159138 2:110070863-110070885 CCTGCTCTCCAGAACCTGGAAGG - Intergenic
936185523 2:110300469-110300491 CCTGCTCTCCAGAACCTGGAAGG + Intergenic
937627613 2:124061048-124061070 CTTGATTTCCAGAAAAAAAACGG - Intronic
938068050 2:128292490-128292512 CTTGCTTCCCAGAAGCTGGAAGG + Intronic
938291500 2:130153161-130153183 CTGGCTTTCTAGATCATCAATGG - Exonic
940112016 2:150165472-150165494 CTTACTTTCCGGAACAATAAAGG + Intergenic
940349491 2:152665970-152665992 CTTGCTTTCCATAATGTAAAAGG - Intronic
941018148 2:160380300-160380322 TGGGCTTTCCAGAACAGGAAAGG + Intronic
941093983 2:161214187-161214209 GTTGCTTTCCTTAACATGACAGG + Intronic
941161175 2:162035994-162036016 CTTGCTTTCCAGTACATTGTCGG + Intronic
942495291 2:176533819-176533841 CTTTCTTTGCAGGAAATGAAGGG - Intergenic
945572983 2:211493908-211493930 CTGGCTTTTCAGAACATCATAGG - Intronic
947326411 2:228983579-228983601 AGTGCTTTCCAGAGCATTAAAGG - Intronic
948244944 2:236472966-236472988 CTTCCTTCCCAGGACATGTAGGG + Intronic
948722979 2:239912982-239913004 CTTGCTTTCCACAGAAGGAAAGG - Intronic
949012598 2:241689826-241689848 GTTGCCTTCCAGAGGATGAAGGG + Intergenic
1169917516 20:10698329-10698351 CTTCCCTCCCAGAACATGCAAGG - Intergenic
1170149541 20:13215412-13215434 TTTGCTTTCCAGAATTTGCACGG + Intergenic
1171017923 20:21558380-21558402 GTGGTTTTCCAGGACATGAATGG + Intergenic
1171062342 20:21977972-21977994 ATTGCTTTTCAGAACATGACTGG + Intergenic
1171091356 20:22288469-22288491 CCTGCTTTCCAGAACAACGATGG + Intergenic
1175791125 20:61740545-61740567 CCTGCTTTCCAGGAGAAGAAAGG - Intronic
1176677961 21:9798699-9798721 CCTGCTTTCCAAAACATGTGTGG + Intergenic
1178558139 21:33612225-33612247 CTTACACTCCAGCACATGAAAGG + Intronic
1179950779 21:44707796-44707818 CATTCATTTCAGAACATGAATGG + Intronic
1181787272 22:25236244-25236266 CTTGCTTTCCAAAACTTGTTGGG + Intergenic
1182973383 22:34598911-34598933 CTGCCTTCCCAGAGCATGAATGG + Intergenic
1183073717 22:35413468-35413490 CTTGCTCCCCAGCACATGCAGGG + Intronic
1183780019 22:39993679-39993701 CATTTTTTCCAGAGCATGAAAGG + Intergenic
949848801 3:8400029-8400051 GATTCTTTCCACAACATGAAAGG + Intergenic
951209667 3:19961339-19961361 AGTACATTCCAGAACATGAATGG - Intronic
951711056 3:25585165-25585187 CATGCTTTCTAGAGCCTGAAAGG - Intronic
952330633 3:32361507-32361529 CTTGCTTTTCAGAGCATTTAGGG + Intronic
952818080 3:37462880-37462902 CTTGTTTTACAGAAAAGGAAAGG + Intronic
953021824 3:39119378-39119400 CTTCCTGTCCAACACATGAAAGG - Intronic
954342465 3:49966259-49966281 CTTGCCTCCCAGAACATACAGGG - Intronic
954408269 3:50357586-50357608 CTTGGTTTACAGATAATGAAAGG + Intronic
956199548 3:66692090-66692112 TTTGCTTTCCATAACATTTATGG + Intergenic
957856899 3:85891171-85891193 CTTGCTATGCAGAAGATTAAAGG - Intronic
960392684 3:117098368-117098390 CTTCCTTTTCAGAACAGTAATGG + Intronic
960957217 3:123041600-123041622 CTTGGGTTCAACAACATGAAGGG - Intergenic
961207391 3:125095809-125095831 CTTGCTTTACAGTGCAAGAAGGG - Intronic
963554308 3:146768524-146768546 CTTGTCTTGCATAACATGAAAGG - Intergenic
967155503 3:186688036-186688058 CTTCATTTCCAGAAAATGAGAGG + Intergenic
967156780 3:186700179-186700201 CTTCATTTCCAGAAAATGAGAGG + Intergenic
968085292 3:195871389-195871411 CCTGCTTTCCAGAACCAGAGTGG - Intronic
971678868 4:29671211-29671233 CTTGCTTTCCAAAACAATAATGG - Intergenic
973705213 4:53574114-53574136 TTTGCTTCCCAGCACATGAAAGG + Intronic
973850210 4:54954538-54954560 CTTCCTTTCAAGACCATGAGTGG - Intergenic
974650944 4:64753648-64753670 CTTATTTTCCTGAACATAAAAGG - Intergenic
975605828 4:76153552-76153574 CTTTCTTTTCAGTACATAAAGGG - Intergenic
977227123 4:94405885-94405907 CTTGCTTGTAAGAAGATGAAAGG - Intergenic
978200207 4:106016844-106016866 TTTCCTTTCCAGAACACCAAAGG + Intergenic
980723140 4:136722963-136722985 CTTTCTTGATAGAACATGAATGG - Intergenic
981115543 4:140986229-140986251 TCTGCTTTCTAGAACCTGAACGG + Intronic
981727519 4:147862643-147862665 CTGGATTTTCAGAACATTAAGGG + Intronic
982086171 4:151838627-151838649 TTTGCTTTCAATAACATTAAAGG + Intergenic
982298984 4:153859719-153859741 CTCCCTTTCCAGGGCATGAACGG + Intergenic
984122784 4:175767036-175767058 ATTGCCTTTCAGGACATGAAAGG + Intronic
986444081 5:7806284-7806306 AATGTTTTCCAGAACATTAAAGG - Intronic
986766126 5:10929329-10929351 GTTGCTTTCCAGAAGATAATAGG + Intergenic
987161753 5:15152033-15152055 CTTGCTTTTCAAAACACTAATGG + Intergenic
987867340 5:23562095-23562117 CTTTCTTTCTAGCAAATGAAAGG + Intergenic
989528939 5:42484062-42484084 CTTGCTGGCCAGCACATGGATGG + Intronic
990304846 5:54483801-54483823 CTTGCTTTCAAAAAAATAAAAGG - Intergenic
991272434 5:64800236-64800258 CATTCTTTGCAGAGCATGAAGGG + Exonic
992204111 5:74413621-74413643 GTTGATTTCCTGAACATGCATGG - Intergenic
995172796 5:109137248-109137270 CTTGGTTTCCAGAAGAAAAAAGG + Intronic
995384608 5:111574977-111574999 CCTACTGTCAAGAACATGAAGGG + Intergenic
996219331 5:120910407-120910429 TCTGCTTTGAAGAACATGAAGGG + Intergenic
996258071 5:121429769-121429791 CTTGTTTTCCACATCATGTAAGG - Intergenic
996542144 5:124641431-124641453 GTTGATTTTCAGAGCATGAAGGG - Intronic
996857061 5:128020093-128020115 CTTGCTATCCAAAATATGAATGG + Intergenic
1000974924 5:167754264-167754286 AGTGCTTTCCAGTACAGGAAAGG + Intronic
1001248380 5:170123877-170123899 CTTGTTTCCCTGAACAAGAAAGG - Intergenic
1001796180 5:174504218-174504240 CTTTCTTTGCAGGAAATGAAGGG + Intergenic
1002776752 6:334559-334581 CTTGCTTTTCAGGACAATAAAGG - Intronic
1005429118 6:25735778-25735800 CTTGCTCTTCAGAACAAGATTGG + Intergenic
1007961070 6:45960175-45960197 CTTGGTTTCCAGATAATGAAGGG + Intronic
1009723667 6:67508010-67508032 CTTCCTTTCTCGAAAATGAAAGG + Intergenic
1014024509 6:116629830-116629852 CTATCATCCCAGAACATGAATGG - Intronic
1015284555 6:131470604-131470626 CTTGCTTTCAAGAATCTGAAGGG + Intergenic
1015588228 6:134797744-134797766 CTTGCTTTGTAAAAGATGAAAGG - Intergenic
1017871828 6:158493478-158493500 CTGGCTGTCCAGAAAAAGAAAGG + Intronic
1018215009 6:161518284-161518306 CCTGCTTTCCAGAAGATGAGAGG + Intronic
1018777838 6:167034609-167034631 CTTGCTTTCCAGAACATGGTGGG + Intronic
1021405507 7:20262805-20262827 CTTGCTTTCCTGGGCATAAATGG - Intergenic
1021474049 7:21040610-21040632 TTTGCTTTCCAAAACATTAGAGG - Intergenic
1022234592 7:28448655-28448677 CTTGCCTTCCAGAACATGTAAGG + Intronic
1022957074 7:35390811-35390833 TTTGCTTTTGAGAACATGGATGG + Intergenic
1022975121 7:35549656-35549678 CTTGCTTTGCAGGGCATGAAGGG - Intergenic
1023113442 7:36837684-36837706 CTTCTTTTCCAGAATTTGAAGGG + Intergenic
1023515787 7:41000032-41000054 TTTCCTTTCCAGAACAAGATGGG + Intergenic
1026108519 7:67439828-67439850 CTTGATGTCCTGAGCATGAATGG + Intergenic
1028733233 7:94177473-94177495 CTTGTTTTCTTGAGCATGAATGG + Intergenic
1029874644 7:103737232-103737254 CTTGCTGTTGAGAAAATGAAAGG + Intronic
1030818151 7:114061966-114061988 CTTCATTACCAGAAGATGAAAGG + Intronic
1031668411 7:124514121-124514143 TTTGCCTTCCAGTACATGAAAGG - Intergenic
1034001443 7:147417342-147417364 CTTGCTTCCCAGGTCATGGATGG + Intronic
1034368039 7:150569015-150569037 CTAGATTTCCAGAACATTGAGGG + Intronic
1034832961 7:154325381-154325403 CTTGCTTTCCAGAGTATTCATGG + Intronic
1036001758 8:4612887-4612909 TATGCTTTCCTGAACATGATAGG + Intronic
1037343442 8:17872248-17872270 ATAGCTTTCCAGAACTTGGATGG + Intronic
1037526983 8:19734990-19735012 CTTGCTATCCAGGAAATCAATGG + Intronic
1041029425 8:53720998-53721020 CTTGTTTTCCACAACAGGATAGG - Intronic
1048862218 8:138731935-138731957 CTTGATTTCCAGAAGAAAAAAGG - Intronic
1048980381 8:139700578-139700600 CTTTCTTTCCAGAAAATCAGTGG + Intronic
1049653599 8:143788146-143788168 CCTGCTTCCCAGAGCAGGAAGGG + Intergenic
1050321329 9:4455700-4455722 GTTTCTTTCCAGATCCTGAAAGG + Intergenic
1051478782 9:17537648-17537670 CTGGCTTTCCTGCACATGGAGGG + Intergenic
1053310983 9:37019556-37019578 CTTGAATTCCAGCAGATGAAAGG + Intronic
1055556974 9:77484057-77484079 TTTTCTTTGGAGAACATGAAAGG + Intronic
1058622238 9:106895751-106895773 CTAGCTTTCAAGAACATTCATGG + Intronic
1059047182 9:110881635-110881657 CTGGCTTTTCAGCACCTGAATGG - Intronic
1059189486 9:112310872-112310894 CTGTTTTTCCAGAACATGCAAGG - Intronic
1059787860 9:117606018-117606040 TTAGCATTCCAGAACATGCAAGG + Intergenic
1060607510 9:124929400-124929422 CTAGCTTTCCTTAACAGGAATGG - Intronic
1060877828 9:127095990-127096012 CTTCCTCCCCAGAAGATGAAGGG - Intronic
1060886267 9:127154600-127154622 CTTGTTTTCCAGAGAATGCAGGG + Intronic
1061590681 9:131595666-131595688 CCTCCTTTCCAGAGCATGACTGG + Intronic
1203663109 Un_KI270754v1:1191-1213 CCTGCTTTCCAAAACATGTGTGG + Intergenic
1186096059 X:6103342-6103364 CTTTCCTTCCAGAAAATGGAGGG - Intronic
1186224913 X:7388255-7388277 CTTTCCTTCCAGAACTTGATGGG - Intergenic
1188698074 X:33222010-33222032 ATTCTTTTCCAGAACATGGAAGG + Intronic
1188978973 X:36709231-36709253 CTTGTTTTGAAGAACATGAGAGG + Intergenic
1191078835 X:56487364-56487386 CTTGCTTTGGAGAACACAAATGG - Intergenic
1191086377 X:56571819-56571841 CATGGTTTCCAGAACAAGGAAGG + Intergenic
1191937667 X:66442565-66442587 CTCTCTTTCCAGAAAAAGAAAGG - Intergenic
1193314448 X:80047752-80047774 ATTGCTTTGCAAAACATAAAAGG + Intergenic
1194975620 X:100393647-100393669 TCTGATTTCCAGAGCATGAAGGG - Intronic
1196188077 X:112765622-112765644 CATGATTTCCAGGAAATGAAAGG - Intergenic
1200954945 Y:8934752-8934774 CTTGTCCTCCACAACATGAAAGG - Intergenic
1200985529 Y:9299684-9299706 CTTGTTCTCCATAACATGAAAGG + Intergenic
1201303376 Y:12529527-12529549 CTTGCTTTCCATATTATTAAAGG - Intergenic
1201866676 Y:18663219-18663241 CTTGCCTTCCACACCATGACAGG + Intergenic
1201900147 Y:19040724-19040746 CTTTCTTTCCCCAAGATGAAAGG + Intergenic