ID: 1132600169

View in Genome Browser
Species Human (GRCh38)
Location 16:769611-769633
Sequence GCAGCCTGTGGGCCCCCCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 280}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132600169_1132600176 -6 Left 1132600169 16:769611-769633 CCCCAGGGGGGCCCACAGGCTGC 0: 1
1: 0
2: 4
3: 38
4: 280
Right 1132600176 16:769628-769650 GGCTGCCTGTAGATGGAACAGGG 0: 1
1: 0
2: 0
3: 10
4: 170
1132600169_1132600175 -7 Left 1132600169 16:769611-769633 CCCCAGGGGGGCCCACAGGCTGC 0: 1
1: 0
2: 4
3: 38
4: 280
Right 1132600175 16:769627-769649 AGGCTGCCTGTAGATGGAACAGG 0: 1
1: 0
2: 0
3: 11
4: 170
1132600169_1132600177 -3 Left 1132600169 16:769611-769633 CCCCAGGGGGGCCCACAGGCTGC 0: 1
1: 0
2: 4
3: 38
4: 280
Right 1132600177 16:769631-769653 TGCCTGTAGATGGAACAGGGAGG 0: 1
1: 0
2: 0
3: 22
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132600169 Original CRISPR GCAGCCTGTGGGCCCCCCTG GGG (reversed) Exonic
900626321 1:3610340-3610362 ACAGCCTGAGGGCCCCTCTGTGG + Intronic
900653809 1:3745152-3745174 GGAGCCTGGGGGCCACCCGGAGG - Intergenic
900979978 1:6040745-6040767 GAAGCCTGTGGGCCCTGCTTGGG - Intronic
901089159 1:6629910-6629932 GCAGCCCCTGGGCCACACTGGGG - Intronic
901137466 1:7007379-7007401 AGAGCCTGTGGGCCACCCCGAGG + Intronic
901955170 1:12778819-12778841 CCAGCCTGTGGGACCCTCTTAGG + Intergenic
902512645 1:16974734-16974756 TCAGCCTGTGGCCACCTCTGGGG - Exonic
902822294 1:18950740-18950762 CCTGCTTGAGGGCCCCCCTGGGG + Intronic
904802037 1:33099796-33099818 CCAGGCTGTGGGCCCCACTCTGG - Intronic
905210344 1:36369745-36369767 TCAGGCTGTGGGCTCCCTTGAGG + Intronic
905633278 1:39530946-39530968 GGAGCCAGTGGGCAGCCCTGGGG + Intergenic
906035180 1:42746446-42746468 GCGGCCTGTGGAGGCCCCTGGGG + Exonic
907653352 1:56317902-56317924 GCAGGCTCAGGGCACCCCTGTGG - Intergenic
909463225 1:75943210-75943232 GCAGCCTGTGGCCTGCCCTTTGG - Intergenic
911090482 1:94013404-94013426 CCTGCCTCTGGGCCCCACTGGGG - Intronic
914393534 1:147242902-147242924 GCAGCGGGTGGGCCGCCCGGTGG + Intronic
915161190 1:153922254-153922276 GCACCCTGAGGGCACCACTGGGG + Intronic
915466094 1:156098928-156098950 ACAGCCTCTGGGCACCCCAGGGG - Intronic
915581187 1:156814278-156814300 GCAGCCTCTCTGCCTCCCTGTGG + Exonic
917980685 1:180267100-180267122 GCAGACTGTGGGCTCCTCTAGGG + Intronic
918311685 1:183289697-183289719 GCAGCCTGTGGGGGCCCCACTGG - Intronic
919690844 1:200527249-200527271 GCAGGCGGTGGGCCCCTCTCTGG - Intergenic
920045665 1:203130551-203130573 GCAGCATGTGGGCCCCTCAGTGG - Intronic
920068696 1:203287409-203287431 GGAGCCTGTGGGCGGCCCAGGGG + Intergenic
920907071 1:210181184-210181206 TCAGCCTTTGTGCCACCCTGGGG - Intergenic
921263401 1:213403348-213403370 ACAGCCTGAGGGCACCCCTCGGG - Intergenic
921319239 1:213921947-213921969 GCAGCCTGTTGGCTCCCCAAGGG - Intergenic
922215568 1:223516827-223516849 AGAGCCTGTGGGCAGCCCTGGGG + Intergenic
922617954 1:226974212-226974234 GCAGCCTGTGTTCCTGCCTGGGG + Intronic
922642295 1:227246056-227246078 TCAGGCAGTGGGCCCCCCTCTGG - Intronic
922703503 1:227776135-227776157 GCGGCTTGTGGGACCCGCTGAGG - Intronic
923025269 1:230198591-230198613 GCAGTCTGTGGGACCACCTGAGG + Intronic
923438319 1:233991239-233991261 GCAGCCTGTCTGGGCCCCTGTGG + Intronic
923438499 1:233992909-233992931 GCAGCCTGTCTGGGCCCCTGTGG + Intronic
924744335 1:246818344-246818366 TCAGCCTGTGGCCACCTCTGGGG + Intergenic
1063205399 10:3826311-3826333 GCAGGCTGTGGACCCCGATGGGG + Intergenic
1064403587 10:15041106-15041128 GTAGCCTGGGAGCCCCTCTGGGG - Intronic
1066632404 10:37469898-37469920 GCTGCCTGTGGTCCTCCATGGGG + Intergenic
1066733908 10:38454768-38454790 CCAGGCTGTGTACCCCCCTGTGG + Intergenic
1067082842 10:43221400-43221422 GCAGCAGGAGGGCCACCCTGGGG - Intronic
1067155784 10:43780167-43780189 GCAGCCAGTGGGCCATCCTCTGG + Intergenic
1067760095 10:49038726-49038748 GGTGCCTGTGGGCCCTCCAGGGG + Intronic
1069565645 10:69461707-69461729 CCAGCCTCTGGCCCACCCTGTGG + Intronic
1069912405 10:71767546-71767568 CCAGCCTGTGGACCATCCTGGGG - Intronic
1070786249 10:79163791-79163813 CCAGCCTGAGGGCCACCCTCTGG - Intronic
1073323908 10:102631638-102631660 GCACCCTGTGGGCACTCCTGTGG - Exonic
1075088477 10:119429803-119429825 GCAGCCTCTGCCCCCTCCTGAGG + Intronic
1075921952 10:126220923-126220945 GAAGCCTCTGGGCCTCCATGTGG - Intronic
1076497608 10:130907216-130907238 GCAGCCTGCAGGCCCTCCTGGGG + Intergenic
1076736304 10:132460728-132460750 GCATGCTGTGGGATCCCCTGGGG + Intergenic
1076747117 10:132520028-132520050 GCTGCCTCTGGGCCCCCAGGCGG + Intergenic
1076853643 10:133104900-133104922 CCAGCCTGCTGGCCTCCCTGAGG - Intronic
1077136321 11:1001100-1001122 CCACCCTGTGGTTCCCCCTGAGG + Intronic
1077235487 11:1480174-1480196 GCACCTTCTGGGCCCCACTGGGG + Intronic
1078619503 11:12893973-12893995 GCAGCCTGCGGTGGCCCCTGGGG - Intronic
1079350128 11:19685153-19685175 GCAGTCTGTGGGGCCTTCTGAGG - Intronic
1082997769 11:59266819-59266841 TCAGCCTCTGGGCCCCTGTGGGG - Intergenic
1085329369 11:75635134-75635156 GCAGCCTCTGGGTTCCCCTGGGG + Intronic
1087136461 11:94725626-94725648 GGAGCCTGTGGGAGCCTCTGAGG + Intronic
1090128923 11:124118797-124118819 GGAGCATGTGGGACCCCCTCTGG - Intronic
1090142316 11:124277776-124277798 TCAGCCTGTGGGGCACCCTTGGG - Intergenic
1090441753 11:126730235-126730257 GGGGCCTGTGGGCCCCCATGTGG - Intronic
1090955097 11:131506563-131506585 GCAGCCTGGGGGGCCCTCTGAGG + Intronic
1091910989 12:4230582-4230604 GTAGACTGTGAGCACCCCTGAGG + Intergenic
1093043541 12:14414376-14414398 GCAGCCTGTGGGCCCTCGGCAGG - Intronic
1096264171 12:50110592-50110614 TCAGCCTTTGGGCCACCCTCTGG - Exonic
1097035561 12:56121438-56121460 GCAGACTCTGGCCCCCACTGTGG + Exonic
1097051207 12:56224380-56224402 GGAGCCTGTGGCTCCCCCTGCGG + Exonic
1097118598 12:56717014-56717036 GCAGAGTGGGGGCCCCCATGGGG + Intronic
1097270633 12:57771978-57772000 GCAGCGTGTGGTCCGCCATGGGG + Exonic
1101714530 12:107298904-107298926 GCAGAGGGTGGGGCCCCCTGAGG - Intergenic
1102348087 12:112172364-112172386 GCTGCCTGGAGGCCCCGCTGAGG - Intronic
1102953473 12:117045229-117045251 GCTGCCTACGGGCCCCCATGAGG - Intronic
1103024166 12:117559925-117559947 GCAGCCTGAGGGCCACCCTCTGG - Intronic
1103752220 12:123172738-123172760 CCAGCCTGTGGGGCCACATGTGG - Intronic
1104773808 12:131381029-131381051 GGAGCCTGTGTCCTCCCCTGGGG - Intergenic
1106140374 13:27006484-27006506 GTTACCTGTGGGCCCCCCTGGGG + Intergenic
1107382534 13:39872474-39872496 GCTACCTGTGAGCCTCCCTGTGG - Intergenic
1108817751 13:54313003-54313025 GCACCATGTGGGCCCCTCTCTGG + Intergenic
1109319496 13:60792539-60792561 GCAGTCTGTGAAACCCCCTGTGG + Intergenic
1109357347 13:61247688-61247710 AAGGCCTGTGGGGCCCCCTGTGG + Intergenic
1113881152 13:113627361-113627383 GCGGCCTGTGTGAGCCCCTGGGG + Intronic
1113972022 13:114198611-114198633 GCAGCTGGTGGTCCCCGCTGAGG + Intergenic
1114472482 14:22973377-22973399 GTGGCCAGTGGGCCCCTCTGAGG - Exonic
1119383143 14:74241037-74241059 GAAGCCTGCGGGCGCCCCGGTGG - Intronic
1120155374 14:81087753-81087775 GCAGCCATTGGGTCCCCGTGAGG + Intronic
1121546754 14:94768828-94768850 GCAGCCTGCGGGCCGCCATCGGG + Intronic
1121634025 14:95441423-95441445 GCAGTCTCTGTGTCCCCCTGGGG - Intronic
1122313746 14:100813506-100813528 GCACCCTGTGGCCCTCACTGTGG + Intergenic
1122533159 14:102443167-102443189 GCAGCCTTTGGGCCTCCATCTGG + Intronic
1122580321 14:102767727-102767749 CCAGGCTGTGGGCAGCCCTGGGG + Intergenic
1123459824 15:20459606-20459628 GCTGCCTGTGGTGCCCTCTGAGG - Intergenic
1123658238 15:22540814-22540836 GCTGCCTGTGGTGCCCTCTGAGG + Intergenic
1124266054 15:28235443-28235465 GCTGCCTGTGGTGCCCTCTGAGG - Intronic
1124312103 15:28635306-28635328 GCTGCCTGTGGTGCCCTCTGAGG + Intergenic
1124340985 15:28888996-28889018 GCAGCCTGTGTGCCCAGCGGGGG + Intronic
1124407229 15:29403937-29403959 GCAGCCTGCGGGCCCTGCAGCGG - Intronic
1124897218 15:33788477-33788499 GGAGCCTGTCTGCCCCTCTGTGG + Intronic
1124966134 15:34434698-34434720 GCAGCCTGTGTGCCCATCGGGGG - Intronic
1125679743 15:41523244-41523266 GCAGCCTGTGGGATTCCCTTAGG - Exonic
1125724708 15:41862382-41862404 CCAGCCCATGGGCCCTCCTGTGG - Intronic
1125755949 15:42065190-42065212 GCAGCCTGTGGGCCCTTCCTGGG - Intergenic
1127211720 15:56780461-56780483 GCAACCTGTGGGGCCACCTGTGG + Intronic
1127313056 15:57769428-57769450 GCTGCCTGAGGGCTCCCGTGAGG - Intronic
1128378507 15:67094113-67094135 GCAGGCAGTGGGACCACCTGAGG + Intronic
1128399569 15:67264384-67264406 GCAGCCTGTGAGAGACCCTGAGG - Intronic
1129006270 15:72376089-72376111 GCAGGGTGTGGGTCCTCCTGGGG - Exonic
1129324664 15:74793829-74793851 GCAGCCTCCGCGCCCCCCTGTGG + Intronic
1129453270 15:75662611-75662633 GTGGCCTGTGGCCCCCTCTGGGG + Intergenic
1132600169 16:769611-769633 GCAGCCTGTGGGCCCCCCTGGGG - Exonic
1133098109 16:3461335-3461357 GGAGCCAGAGTGCCCCCCTGCGG + Intronic
1134057321 16:11178663-11178685 TGAGCCTGTGGGCACCGCTGAGG + Exonic
1136229994 16:28880265-28880287 GCAGCATGTGAGCCTCGCTGGGG + Intronic
1138389972 16:56663056-56663078 GCAACCTGGTGGGCCCCCTGGGG + Intronic
1138418427 16:56884502-56884524 GCAGCCTGCTGGCCCCTCTTGGG - Intronic
1138658043 16:58501849-58501871 GCAGCGTGCGGGTCCGCCTGAGG - Intronic
1139963320 16:70730360-70730382 TCAGCCTGTGGGCCACAGTGAGG - Intronic
1140519428 16:75568566-75568588 GGAGCCTGTGGGCCCTGCTGAGG + Intronic
1141692714 16:85605658-85605680 ACAGCCGGTGGCCCCCCCGGGGG - Intergenic
1141694052 16:85611717-85611739 CCAGCCTGTGTGCCCTCCGGGGG - Intronic
1141833032 16:86520202-86520224 GCAGCCTCTGACCCACCCTGGGG + Intergenic
1142130230 16:88428821-88428843 GCAGCCAGGGGGCCCCCAGGAGG - Exonic
1142289663 16:89187782-89187804 GCAGCCCATGGGACCCTCTGAGG + Intronic
1142412883 16:89925014-89925036 GCAGCCCTGGGGCCCACCTGGGG + Intronic
1144521977 17:15958774-15958796 GAACCCTGTGTGCCCCCCAGAGG - Intronic
1144703281 17:17352050-17352072 TCAGACTGTGTGACCCCCTGGGG - Intergenic
1144849799 17:18238319-18238341 GCAGCCCCTGGGCCCTCCAGAGG + Intronic
1145993996 17:29095302-29095324 GCAGTCTGTGGGTCCCTCTTAGG - Intronic
1147550338 17:41437440-41437462 ACCACCTGTGGGCCCACCTGTGG - Exonic
1148746372 17:49920466-49920488 GCAGCCTGTCCTCCCTCCTGGGG - Intergenic
1151479542 17:74362043-74362065 GCTGCCTGTGGGCCCCCAAGGGG + Intergenic
1151599760 17:75099002-75099024 GCAGCCTGAGGGCCCGCCTGAGG + Intronic
1152057649 17:78043275-78043297 GCAGCCTCGGGGCCACACTGTGG - Intronic
1152214673 17:79025156-79025178 GGAGCCTCTGAGCCGCCCTGGGG + Intronic
1152286467 17:79415883-79415905 CCAGTGTGTGGGCTCCCCTGGGG - Intronic
1152292432 17:79447756-79447778 GCAGGCTGTGGGCCGTGCTGAGG + Intronic
1152538389 17:80963158-80963180 GCAGCCAATGGGCCCCACTGTGG - Intronic
1152644169 17:81461191-81461213 GCAGCTTGTGGGCTCCCCTGGGG - Exonic
1152705617 17:81842004-81842026 GGTGTCTGTGGGTCCCCCTGAGG - Intergenic
1152865849 17:82722492-82722514 GCAGCCTGCGGGCACCTCTCAGG - Intronic
1155022859 18:21912527-21912549 GCAGCCTGTGGGGGTCACTGTGG + Intergenic
1156585153 18:38423812-38423834 GCAGCATGTCGACCCCTCTGGGG + Intergenic
1157029072 18:43882505-43882527 GCTGCCAGTGGGCCCCGCAGAGG - Intergenic
1160548591 18:79679163-79679185 GCAGGCGGTGGGCCCGTCTGGGG - Intergenic
1161056557 19:2193562-2193584 GGAGACTGTGGCCTCCCCTGTGG + Intronic
1161232285 19:3180256-3180278 GCAGCCTGGGAGCCCTACTGAGG - Exonic
1161374720 19:3933528-3933550 GCAGCCTGGAGGCCGCCCCGGGG - Exonic
1161582534 19:5088618-5088640 GCAGCCTCAGGGGCCCCCTCAGG - Intronic
1161677420 19:5659782-5659804 GCAGCCTGGGGGGCCCCCACAGG + Intronic
1161736465 19:5995067-5995089 GCAGCCTGTGGACCCCACCTCGG + Intronic
1163688667 19:18726366-18726388 GCCGCCTGAGGGCTCCTCTGGGG - Intronic
1164433367 19:28207602-28207624 GCAGCATGTGTGCCCCTCTTGGG - Intergenic
1164558321 19:29270069-29270091 GCTGCCTGTGTGCCCCACAGTGG - Intergenic
1164756626 19:30694785-30694807 GCAGCCACTTGGCCCCCATGGGG + Intronic
1165094654 19:33403538-33403560 GCTGCCTGTGCGCCTGCCTGTGG + Intronic
1165420122 19:35718260-35718282 GCCGCCTGTGGGCCGGCCCGCGG + Exonic
1166216062 19:41335890-41335912 GAGGCCTCTGGGCTCCCCTGGGG - Intronic
1166295339 19:41886689-41886711 CCACCCTGTGGGTCCACCTGGGG - Intronic
1166732809 19:45068268-45068290 GCAGGCTGTGGACAGCCCTGAGG - Intronic
1166812538 19:45522728-45522750 GGGGGCTGTGGGCCCCCCTGAGG - Exonic
1168121384 19:54254215-54254237 GGAGCCTGTGGCCCCTCCTCTGG + Intronic
1168132926 19:54332366-54332388 GGAGCCTGTGGCCCCTCCTCTGG + Intergenic
1168725374 19:58578345-58578367 GCAGCCTCTGAGCCCCCCAAAGG + Intergenic
926157735 2:10466885-10466907 TCAGCCTGTGGGGCCCCCTCTGG - Intergenic
927449889 2:23199511-23199533 TCAGGCTGTGCGCCCCCTTGTGG - Intergenic
929120458 2:38480060-38480082 GCAGCCTTTGTGACACCCTGTGG - Intergenic
932698319 2:73975642-73975664 GCTTCCTGTGGGCACTCCTGGGG - Intergenic
934966384 2:98727568-98727590 GCATCCTGTGGCACCTCCTGAGG - Intronic
936081585 2:109436085-109436107 GCAGCCTGTTCTCCCACCTGTGG + Intronic
940365401 2:152843465-152843487 GCAGCCTCTGAGCCCCCAGGTGG - Intergenic
944586955 2:201181040-201181062 CCAGCCTGGGGCTCCCCCTGTGG - Intergenic
946842890 2:223836168-223836190 GCACCCTGTGGGCCCACCGGAGG - Intronic
947719923 2:232364015-232364037 GGAGCCTGTGGGCTCTCCTGAGG - Intergenic
948061329 2:235044991-235045013 GAAGCCTCCGGGCCCCCATGTGG + Intronic
948548004 2:238746214-238746236 CCAGCCTGTGCCCCCCACTGTGG + Intergenic
948643276 2:239388594-239388616 CCACCCTCTGGGCCCCCCTTTGG + Intronic
1169091859 20:2865732-2865754 GCCCCCTGTGGCCCTCCCTGGGG - Intronic
1170999392 20:21397271-21397293 CCGGCCTGGGGGCGCCCCTGGGG - Exonic
1172623953 20:36336889-36336911 GCGGGCTGGGGGCCCCTCTGGGG - Intronic
1173595673 20:44257390-44257412 TGAGCCTGTGGGGACCCCTGAGG - Intronic
1173944995 20:46943481-46943503 CCAGCCTGAGGGCCTCTCTGGGG + Intronic
1175174510 20:57102832-57102854 GCAGCCTGCGTGCTCCTCTGGGG - Intergenic
1175263702 20:57690144-57690166 TCAGCCTGGGGGCCTCCATGTGG + Intronic
1175282476 20:57813313-57813335 CCAGCCTCTGCGCCCCTCTGAGG + Intergenic
1175872950 20:62216988-62217010 GTAGCCTGTGGGCCCCTATGTGG + Intronic
1176109399 20:63404595-63404617 CCTGCCTGTGGGCCCCGCTATGG + Intergenic
1176366054 21:6033651-6033673 GGAGGCTGTGGGTCCCCATGTGG - Intergenic
1179725408 21:43338957-43338979 ACAGCCTGTGGCCCCTGCTGGGG - Intergenic
1179757463 21:43504894-43504916 GGAGGCTGTGGGTCCCCATGTGG + Intergenic
1179902577 21:44401693-44401715 GCAGGATGTGGGCACCCCCGCGG + Exonic
1180259943 21:46662120-46662142 GCAGCCTGTGTGCCCCCTTCCGG + Intronic
1180865822 22:19119129-19119151 GCAGTCTGTGGCTCCACCTGGGG + Intronic
1181041973 22:20196570-20196592 GCAGCCTGTGGCCAGCGCTGGGG + Intergenic
1182289882 22:29268731-29268753 GCAGCCTGCGGGCCCCCCGGCGG - Intronic
1182472563 22:30557444-30557466 GCAGCCTTGGGGGCTCCCTGGGG - Intronic
1183355801 22:37358751-37358773 GCAGCCAGTGGGCCCACATCTGG - Intergenic
1183543785 22:38444739-38444761 GCAGCCCGTGGCCCCCCCCATGG - Intronic
1183933760 22:41250241-41250263 GCTCCCTGAGGGCCCGCCTGTGG - Intronic
1184098253 22:42328313-42328335 GCATCCTGTGGGCTCCCCTGAGG + Intronic
1185078086 22:48694011-48694033 GAAGCCCGTGGGCCCCTCTGAGG + Intronic
1185082617 22:48718250-48718272 GCAGACACTGGGCCCCGCTGTGG + Intronic
1185201148 22:49506240-49506262 GCAGCATGGTGGCCCCCCTTTGG - Intronic
1185242238 22:49752774-49752796 GCAGCCTGTGGGCCCAGCAGAGG + Intergenic
1185264003 22:49888664-49888686 GGAGCCGGTGGGCAGCCCTGAGG + Exonic
949125991 3:445657-445679 GCTGCCTGAGGCCTCCCCTGAGG - Intergenic
950429914 3:12944804-12944826 GCAGCCTGTGGGCCACCAAGGGG - Intronic
953027586 3:39153743-39153765 GCGGCCTGGGGGCCTCCCTGCGG + Intronic
954141050 3:48605711-48605733 GCTGCCTGTTGTCCCTCCTGAGG - Intronic
954628284 3:52034778-52034800 GCACCCTGTGTGCCCCCAGGTGG - Intergenic
954712862 3:52513587-52513609 CCAGCTTGTGGGCCAGCCTGCGG + Intronic
955613705 3:60783797-60783819 AGAGCCTGTGTGCTCCCCTGTGG - Intronic
957241916 3:77670903-77670925 GTATCCTCTGGGCCCTCCTGGGG - Intergenic
958471309 3:94524149-94524171 GGTGCCTGTGGGGCCACCTGTGG + Intergenic
958655235 3:96993028-96993050 GCAGCCTGTTGGTGCTCCTGTGG + Intronic
960139636 3:114139680-114139702 GCAGACAGTGGGGTCCCCTGTGG + Exonic
960938560 3:122918719-122918741 GCAGCCTGAGGGGACCCCTGAGG + Intronic
961035341 3:123637981-123638003 GCAGCCTGGGGACCCTCCTGTGG + Intronic
961051501 3:123750948-123750970 ACAGCCTGTTGGCCCTTCTGTGG + Intronic
961589993 3:127971705-127971727 GCTGCCAGTGGGACCCGCTGTGG + Intronic
962284877 3:134077208-134077230 GCAGCCTGTGAGCTGCCCTGTGG - Intronic
963401274 3:144802505-144802527 GCAGCCTGTGTGGACCCCAGAGG - Intergenic
963861502 3:150315047-150315069 GCAGTCTTTGAGCCCCCTTGCGG - Intergenic
965757803 3:172041953-172041975 CCAGCCTGTGGGTGCCCCTCTGG - Intronic
968509412 4:988792-988814 GCAGCCTCTGCTCCCTCCTGGGG - Exonic
968622758 4:1611097-1611119 GGGGCCTCTGGGCCACCCTGAGG + Intergenic
968904627 4:3445646-3445668 GCAGCGTGCAGGCCCCCCAGAGG + Intronic
969196090 4:5565189-5565211 GCTGCCTGTGGGCCAGGCTGGGG - Intronic
971055795 4:22910952-22910974 GCGGCCTGTGGCCCCTTCTGTGG - Intergenic
973968467 4:56187290-56187312 GGAGCCTGCGGGCCTCCCAGAGG + Intronic
977437679 4:97020024-97020046 GCAGCCTGTGGCCTTCCCAGAGG - Intergenic
979260257 4:118637757-118637779 CCAGGCTGTGTACCCCCCTGTGG + Intergenic
981083008 4:140653866-140653888 GCAGCCTGAGGGCCACCATTAGG + Intronic
984868953 4:184310378-184310400 GCAGGCTGCGGGCCCACGTGCGG - Intergenic
985548352 5:520990-521012 GCAGGCTGGGGGCCCCCAAGGGG + Intronic
985628115 5:1000598-1000620 GCTGCCTGTGGGCGCCCATCAGG + Intergenic
985988767 5:3538445-3538467 GTCCCCTGTGTGCCCCCCTGTGG - Intergenic
986316482 5:6592080-6592102 GCACCCCGTGGGACCCGCTGGGG + Intergenic
989732586 5:44665435-44665457 GCAGCCAGTGTGCCTCGCTGTGG + Intergenic
992957232 5:81922457-81922479 GCAGGCAGTGGGGCCCCCCGTGG + Intergenic
993520068 5:88889520-88889542 GCAGGCTCTGGGCCCTCCTGGGG + Intronic
994147492 5:96411187-96411209 CCAGTCTCTGGGCCCTCCTGGGG + Intronic
997839323 5:137224756-137224778 GCTGCCTGCGGGTCTCCCTGGGG - Intronic
999373256 5:151068987-151069009 GCAGCCCCAGGGCCCCTCTGGGG - Intronic
999696330 5:154190968-154190990 GCAGCCCGACGGCACCCCTGGGG + Exonic
1000282462 5:159793911-159793933 GAAGCCTGTGGGGGCACCTGCGG - Intergenic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1002718817 5:181245943-181245965 GCAGCCTGTGGACCATCCTAAGG + Intronic
1002895826 6:1379552-1379574 GCAGGCTCTGGGCCGCCCTGTGG - Intergenic
1002945627 6:1758588-1758610 GCAGGCTGCTGGCCCCCTTGAGG + Intronic
1003995778 6:11538105-11538127 GCAGCCGGAGGGCCTCCGTGGGG - Intergenic
1006452061 6:34110994-34111016 GCAGCCTGAGGGTGCCCATGGGG - Intronic
1006495338 6:34418988-34419010 GCTGCCTGTAGTCCCACCTGAGG - Intronic
1007145521 6:39626061-39626083 GCAGGCTGAGGGCCCAGCTGAGG + Intronic
1007289613 6:40775526-40775548 GCAGCCTGTGAGCACTCCTGGGG + Intergenic
1011639852 6:89408628-89408650 GCAGCCTGTGCGCACCCTTAGGG - Intronic
1012306394 6:97663340-97663362 GCTGCCAGTGTGCCCCCATGGGG - Intergenic
1017131116 6:151108969-151108991 GCAGCCTGAGGCCAGCCCTGGGG + Intergenic
1018456774 6:163960463-163960485 GCACCTTGTGGGGCCACCTGGGG + Intergenic
1019148635 6:169989429-169989451 CCAGCCCGTCGGCCCCTCTGTGG + Intergenic
1019351240 7:554978-555000 GCAGCCTCTGTGCCCCCATGAGG - Intronic
1019578843 7:1750273-1750295 CCAGCCTGTGAGCTCCCCGGGGG - Intergenic
1023294313 7:38699207-38699229 GCAGCCGGTGGGCTCCAATGAGG + Intergenic
1023401976 7:39797358-39797380 CCAGGCTGTGTACCCCCCTGTGG + Intergenic
1023851434 7:44152453-44152475 CCAGCCTGTGGGTGTCCCTGAGG - Intronic
1024045806 7:45584782-45584804 CCAGCCTGTGGGGGCACCTGTGG + Intronic
1025615332 7:63112867-63112889 GCTGTCTGGGGGCCCTCCTGGGG + Intergenic
1025973652 7:66352339-66352361 GCAGCCAGTGGGCAGCACTGAGG - Intronic
1026796278 7:73368025-73368047 GCAGCCTGCAGGCCTGCCTGGGG - Intergenic
1026960631 7:74405218-74405240 GCAACCTGTTGGTCCCCCAGCGG - Exonic
1026977333 7:74506690-74506712 GCAGCCTGTGGGTGCCCCCTGGG + Intronic
1027133654 7:75609340-75609362 GCAACCTGTAGGTCCCCCAGGGG + Intronic
1029540561 7:101179935-101179957 GCAGCCGCTTGGTCCCCCTGAGG + Intronic
1029972721 7:104805044-104805066 GCAGCCAGAGGGCTCCCCTCAGG + Intronic
1032549525 7:132771587-132771609 GCACCCTGGTGGCCCACCTGGGG + Intergenic
1033312741 7:140273619-140273641 CAGGGCTGTGGGCCCCCCTGGGG + Intergenic
1034282038 7:149861326-149861348 GCAGCCGGTGGGCCACGCAGTGG - Exonic
1034969489 7:155410249-155410271 GCACCCTTTGGGACTCCCTGAGG + Intergenic
1035362884 7:158325071-158325093 GGGGCCTGGGGGACCCCCTGTGG - Intronic
1035690804 8:1558112-1558134 GCATCCTGGGGGCTCCCATGTGG + Intronic
1036296185 8:7540063-7540085 GCATCCTGTGGCCTCCACTGTGG - Intronic
1036326381 8:7780956-7780978 GCATCCTGTGGCCTCCACTGTGG + Intronic
1038241204 8:25809252-25809274 GCAGCCTGTTGGCCACAGTGAGG + Intergenic
1039484301 8:37899244-37899266 GCAGCCTGGGCGCGCCCGTGTGG - Exonic
1039742930 8:40398545-40398567 GCACCCAGAGGGCCTCCCTGAGG + Intergenic
1040444578 8:47480655-47480677 ACAGCCTGTGTGCTCCCATGTGG + Intronic
1040812215 8:51466753-51466775 GCTGCCTGTGTGCCTTCCTGTGG - Intronic
1044316172 8:90751753-90751775 GCTGCCTGTTGGGCTCCCTGTGG + Intronic
1048533610 8:135273000-135273022 GCTGCCTGTGGTCCCACCTGTGG + Intergenic
1049221095 8:141429304-141429326 CCAGCCTGTGGCCACGCCTGAGG + Intronic
1049343824 8:142128023-142128045 GCAGCCTGGGGCTCCCCTTGAGG - Intergenic
1049424525 8:142532202-142532224 GCGGGCTGTGGGGCCTCCTGCGG + Intronic
1049436831 8:142590303-142590325 GCAGCCTGACGGCCCTCCTAGGG + Intergenic
1049496688 8:142938958-142938980 GGGGCCTGTGGGCGCCCCTGAGG + Intergenic
1049522667 8:143102250-143102272 ACTGCCTGAGGGGCCCCCTGGGG + Intergenic
1049623659 8:143610584-143610606 GCAGCCTCTGGGCCCTGCTCTGG + Intergenic
1049690077 8:143954439-143954461 GCTGCCTGTGGGGCATCCTGAGG - Intronic
1049709418 8:144056931-144056953 GCACCCTGGGAGCCCACCTGGGG + Exonic
1049714292 8:144082661-144082683 GCAGCCTGTGGGCACCGCGGCGG + Exonic
1050282611 9:4066828-4066850 GCAGCATGTGGGACGCCCAGTGG + Intronic
1051910899 9:22154017-22154039 GCTGTCTGGGGGCCCTCCTGGGG - Intergenic
1052740069 9:32384513-32384535 GGAGCCTGCGGGCGCCCCCGCGG - Intergenic
1056706634 9:88957748-88957770 GCAGTGGGTGGGCCACCCTGTGG - Intergenic
1056799848 9:89683446-89683468 GCAGCCTGTAGGCCCTGCTACGG - Intergenic
1057224788 9:93287219-93287241 GCAGCCTCTGAGCACCCCTAGGG - Intronic
1057271028 9:93651588-93651610 GGTCACTGTGGGCCCCCCTGAGG - Intronic
1058417820 9:104806264-104806286 GCTGCCTGTGTGTCCCCCAGGGG - Exonic
1060300088 9:122369963-122369985 CCATCCTGTGGGCCCCACAGTGG - Intergenic
1061578807 9:131524217-131524239 GCACCTTGGGGGCTCCCCTGAGG + Exonic
1061904182 9:133688215-133688237 GCTGCCTGTGGGCCAGGCTGGGG + Intronic
1062117621 9:134817872-134817894 CCACCCTCTGGGCTCCCCTGGGG - Intronic
1062141033 9:134959332-134959354 GGAGCCTGTGTGCTGCCCTGGGG + Intergenic
1062289660 9:135788865-135788887 GCAGGCTCTGAGCTCCCCTGAGG - Intronic
1062545969 9:137063894-137063916 GCTGTCTGGGGGCCCTCCTGGGG + Exonic
1187174413 X:16883029-16883051 GGAACCTGTGGCTCCCCCTGTGG - Intergenic
1192319928 X:70082423-70082445 GTAGTCTGTGGGCCACACTGAGG + Intergenic
1199991429 X:152989735-152989757 GGACCCTGTGGCCTCCCCTGCGG + Exonic
1200037908 X:153345312-153345334 GCAGCCTCTGGGCCCACCTTGGG - Intronic
1200122731 X:153798738-153798760 GGAGCCTGTGGGGCCACCTGGGG - Intergenic
1200164030 X:154023884-154023906 GCAGCCTCTGGGCCCACATCCGG - Intronic
1200404016 Y:2790219-2790241 TCACCCTGTGGGGCACCCTGTGG + Intergenic
1200735502 Y:6789502-6789524 GCATCCTGTAGCCCCTCCTGTGG + Intergenic
1202381743 Y:24280127-24280149 CCAGGCTGTGTACCCCCCTGTGG + Intergenic
1202489042 Y:25389999-25390021 CCAGGCTGTGTACCCCCCTGTGG - Intergenic