ID: 1132600516

View in Genome Browser
Species Human (GRCh38)
Location 16:770705-770727
Sequence ATCCCCCCAGGCGGCTCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 132}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132600516_1132600538 25 Left 1132600516 16:770705-770727 CCATGGGAGCCGCCTGGGGGGAT 0: 1
1: 0
2: 3
3: 6
4: 132
Right 1132600538 16:770753-770775 AGGGAAGCTGCCTGGGGGGACGG 0: 1
1: 0
2: 6
3: 62
4: 691
1132600516_1132600540 27 Left 1132600516 16:770705-770727 CCATGGGAGCCGCCTGGGGGGAT 0: 1
1: 0
2: 3
3: 6
4: 132
Right 1132600540 16:770755-770777 GGAAGCTGCCTGGGGGGACGGGG 0: 1
1: 0
2: 2
3: 37
4: 377
1132600516_1132600536 21 Left 1132600516 16:770705-770727 CCATGGGAGCCGCCTGGGGGGAT 0: 1
1: 0
2: 3
3: 6
4: 132
Right 1132600536 16:770749-770771 CACCAGGGAAGCTGCCTGGGGGG 0: 1
1: 0
2: 2
3: 31
4: 329
1132600516_1132600539 26 Left 1132600516 16:770705-770727 CCATGGGAGCCGCCTGGGGGGAT 0: 1
1: 0
2: 3
3: 6
4: 132
Right 1132600539 16:770754-770776 GGGAAGCTGCCTGGGGGGACGGG 0: 1
1: 1
2: 2
3: 37
4: 435
1132600516_1132600529 5 Left 1132600516 16:770705-770727 CCATGGGAGCCGCCTGGGGGGAT 0: 1
1: 0
2: 3
3: 6
4: 132
Right 1132600529 16:770733-770755 GAGGGGGGCTGGGCTCCACCAGG 0: 2
1: 0
2: 1
3: 52
4: 435
1132600516_1132600528 -5 Left 1132600516 16:770705-770727 CCATGGGAGCCGCCTGGGGGGAT 0: 1
1: 0
2: 3
3: 6
4: 132
Right 1132600528 16:770723-770745 GGGATGGGGTGAGGGGGGCTGGG 0: 1
1: 2
2: 20
3: 261
4: 2453
1132600516_1132600535 20 Left 1132600516 16:770705-770727 CCATGGGAGCCGCCTGGGGGGAT 0: 1
1: 0
2: 3
3: 6
4: 132
Right 1132600535 16:770748-770770 CCACCAGGGAAGCTGCCTGGGGG 0: 1
1: 0
2: 5
3: 27
4: 358
1132600516_1132600530 6 Left 1132600516 16:770705-770727 CCATGGGAGCCGCCTGGGGGGAT 0: 1
1: 0
2: 3
3: 6
4: 132
Right 1132600530 16:770734-770756 AGGGGGGCTGGGCTCCACCAGGG 0: 3
1: 0
2: 1
3: 28
4: 334
1132600516_1132600526 -10 Left 1132600516 16:770705-770727 CCATGGGAGCCGCCTGGGGGGAT 0: 1
1: 0
2: 3
3: 6
4: 132
Right 1132600526 16:770718-770740 CTGGGGGGATGGGGTGAGGGGGG 0: 1
1: 3
2: 22
3: 301
4: 3464
1132600516_1132600532 18 Left 1132600516 16:770705-770727 CCATGGGAGCCGCCTGGGGGGAT 0: 1
1: 0
2: 3
3: 6
4: 132
Right 1132600532 16:770746-770768 CTCCACCAGGGAAGCTGCCTGGG 0: 1
1: 1
2: 3
3: 33
4: 292
1132600516_1132600527 -6 Left 1132600516 16:770705-770727 CCATGGGAGCCGCCTGGGGGGAT 0: 1
1: 0
2: 3
3: 6
4: 132
Right 1132600527 16:770722-770744 GGGGATGGGGTGAGGGGGGCTGG 0: 1
1: 3
2: 41
3: 753
4: 11942
1132600516_1132600531 17 Left 1132600516 16:770705-770727 CCATGGGAGCCGCCTGGGGGGAT 0: 1
1: 0
2: 3
3: 6
4: 132
Right 1132600531 16:770745-770767 GCTCCACCAGGGAAGCTGCCTGG 0: 1
1: 1
2: 1
3: 28
4: 233
1132600516_1132600533 19 Left 1132600516 16:770705-770727 CCATGGGAGCCGCCTGGGGGGAT 0: 1
1: 0
2: 3
3: 6
4: 132
Right 1132600533 16:770747-770769 TCCACCAGGGAAGCTGCCTGGGG 0: 1
1: 0
2: 12
3: 29
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132600516 Original CRISPR ATCCCCCCAGGCGGCTCCCA TGG (reversed) Intronic