ID: 1132600946

View in Genome Browser
Species Human (GRCh38)
Location 16:772719-772741
Sequence AGGACTCATCCAGCACAGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132600941_1132600946 5 Left 1132600941 16:772691-772713 CCTGGGGATGGATGGTCTGGATC 0: 1
1: 0
2: 2
3: 18
4: 111
Right 1132600946 16:772719-772741 AGGACTCATCCAGCACAGGCGGG 0: 1
1: 0
2: 0
3: 26
4: 176
1132600938_1132600946 13 Left 1132600938 16:772683-772705 CCGGAGCTCCTGGGGATGGATGG 0: 1
1: 1
2: 1
3: 21
4: 232
Right 1132600946 16:772719-772741 AGGACTCATCCAGCACAGGCGGG 0: 1
1: 0
2: 0
3: 26
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132600946 Original CRISPR AGGACTCATCCAGCACAGGC GGG Exonic
900917086 1:5646619-5646641 ATGACTCATCCAGCCCTTGCTGG + Intergenic
904055144 1:27665098-27665120 AGGAGTTATCCTGCGCAGGCCGG + Intergenic
905482130 1:38268805-38268827 AGGCTTCATCAAGCACAGGCTGG + Intergenic
907581487 1:55576294-55576316 TGCACTCATCCAGCTCTGGCAGG - Intergenic
908408792 1:63842754-63842776 AGGAACCAGCCAGCACAGGGAGG + Intronic
909913892 1:81294044-81294066 AGTACTCTTCCAGTACAGCCTGG - Intergenic
911356911 1:96833969-96833991 AGGAGTCATCAAACACTGGCTGG + Intergenic
912417042 1:109516345-109516367 TGGCCTCTTCCAGCACAGGCGGG - Intergenic
912790663 1:112646382-112646404 AGGTCTCATCATGCCCAGGCTGG - Intronic
917674111 1:177302912-177302934 ATGAGACAGCCAGCACAGGCTGG - Intergenic
919849756 1:201664750-201664772 AGGACTCAGGAAGAACAGGCTGG - Intronic
921297533 1:213718726-213718748 TGTTCTCATCCAGCACTGGCTGG + Intergenic
921456857 1:215381100-215381122 AGGTCTCATCCAGCACATAGTGG + Intergenic
921875274 1:220188576-220188598 GGGACTCATACAGAACAGGTGGG + Intronic
1067577300 10:47416784-47416806 AGCACCCATCCACCACAGGCCGG + Intergenic
1067577404 10:47417270-47417292 AGCACCCATCCACCACAGGCTGG + Intergenic
1067577486 10:47417648-47417670 AGCACCCATCCACCACAGGCTGG + Intergenic
1069777551 10:70935777-70935799 AGGACTCCTCGAGTACAGGGAGG - Intergenic
1070336932 10:75464096-75464118 AGAAATCATCCAGAACAGGATGG - Intronic
1070803104 10:79255013-79255035 AGGACCCAGCCAGCCCGGGCTGG - Intronic
1074317092 10:112370253-112370275 AGGCCTCAGCCAGCCCAGGAAGG - Intergenic
1074820628 10:117175539-117175561 AGGACGCACACAGCACGGGCAGG - Intergenic
1075219034 10:120568271-120568293 GGGTCTCAGCCAGCACAGGAAGG - Intronic
1078059779 11:8035715-8035737 TGCACTCATCCAGCCCTGGCTGG - Intronic
1080895677 11:36447361-36447383 AGGAATCATCTAGCCCAAGCTGG - Intronic
1082001808 11:47397239-47397261 AGGACTCCTCCAGGTCAGGAAGG - Intergenic
1084139779 11:67218465-67218487 AGGCCTCATGCAGCCCAGGATGG + Intronic
1084416002 11:69033369-69033391 AGGCCTCAGCCAGCACAGCAGGG + Intergenic
1085605270 11:77891879-77891901 TGCACTCATTCACCACAGGCTGG + Intronic
1086913930 11:92505762-92505784 TGGACTCTTCCTGCACAGTCAGG + Intronic
1091102343 11:132886703-132886725 ACGACTCCCCCAGCACAGGGAGG - Intronic
1091784043 12:3231592-3231614 AGGACTGAGCCAGCAGGGGCGGG + Intronic
1101063767 12:100998228-100998250 AGGAAGCATCCAGCACGGGAGGG - Intronic
1104292140 12:127479990-127480012 GGGAGGCATACAGCACAGGCTGG - Intergenic
1107990139 13:45812373-45812395 AGGACACAGCCAGCAGAGGCTGG + Intronic
1109219856 13:59630003-59630025 AGGACTCACCCAGCACAAGAGGG - Intergenic
1112098161 13:96158213-96158235 AGCACTCCTCCTGCACAGCCAGG - Intronic
1113578253 13:111409881-111409903 CTTACTCATCCAGCACAGTCAGG - Intergenic
1113647774 13:112011192-112011214 AGGCCTCCTCCAGCAGACGCTGG - Intergenic
1115903962 14:38186479-38186501 AGGAGCCACCCAGCAGAGGCTGG - Intergenic
1117450025 14:55840954-55840976 AGTACTGATCCAGCACTGGATGG + Intergenic
1122059709 14:99128886-99128908 AAGGCAAATCCAGCACAGGCTGG + Intergenic
1122650371 14:103222719-103222741 AGGATTCCTCCAGCCCAGCCTGG - Intergenic
1126805903 15:52349257-52349279 GGGAATGATCCAGCCCAGGCAGG - Intronic
1128769109 15:70268674-70268696 AGGACTCATTCAGCAAACTCTGG + Intergenic
1132600946 16:772719-772741 AGGACTCATCCAGCACAGGCGGG + Exonic
1133653826 16:7839769-7839791 AGGACTAGTACAGCAGAGGCTGG - Intergenic
1133840023 16:9399520-9399542 AGCCCCCATCCAGCACAGGTTGG - Intergenic
1134913001 16:18045410-18045432 AGGACTCGTTCAGCAGGGGCCGG + Intergenic
1142474925 17:183001-183023 AGGCCCCATCCAGCACAGACAGG + Intergenic
1142978923 17:3660420-3660442 AGGCCTCACCCAGCGAAGGCCGG + Intronic
1143559899 17:7687347-7687369 AGGACTCATCAAGTTCAGTCAGG + Exonic
1147661629 17:42120068-42120090 GGGACCCCTCCACCACAGGCCGG + Exonic
1149571627 17:57676314-57676336 AGGACCCATCCTGCACAAGTAGG - Intronic
1149856168 17:60084940-60084962 AAGATGCATCCATCACAGGCTGG - Intergenic
1151775977 17:76203018-76203040 GGGTCTCGTCCAGCCCAGGCTGG + Intronic
1152019350 17:77772383-77772405 AGGAGCCACCCAGCACATGCTGG + Intergenic
1152622428 17:81372105-81372127 AGGGCTCCTCCAGTGCAGGCTGG + Intergenic
1152633230 17:81420040-81420062 AGGACCCACACAGCAGAGGCTGG - Intronic
1153692207 18:7605249-7605271 AGGACACATGCAGCCCAGGAAGG - Intronic
1156172873 18:34507096-34507118 AGGATTCATGGACCACAGGCAGG + Intronic
1158569399 18:58584338-58584360 AGGAGTCACCCAGCAGATGCTGG - Intronic
1159892628 18:73966852-73966874 AGGCCTCATCCAGAAGAGCCTGG + Intergenic
1161015617 19:1981411-1981433 CGGACTCGTCCCGGACAGGCAGG - Intergenic
1161048458 19:2149813-2149835 AGGACTTTTTCTGCACAGGCAGG - Intronic
1163860008 19:19737931-19737953 AGGGCTCTTCCAGCAGAGCCTGG - Intergenic
1167411606 19:49347411-49347433 TGGGCTCAGGCAGCACAGGCTGG - Intronic
925823489 2:7823483-7823505 AGTACAAATCCAGCACATGCTGG + Intergenic
927825827 2:26309679-26309701 AGGATTCCTGCAGCACAGGCAGG - Intronic
927926478 2:27017204-27017226 AGGACTCATCCAGGGCACCCAGG - Intronic
928350780 2:30551756-30551778 AGGACTCAACCAGCCAATGCTGG - Intronic
929604979 2:43227627-43227649 AGCCCTCATCGAGCAAAGGCTGG - Intergenic
932467537 2:71933273-71933295 AGGACTGACCGAGCCCAGGCTGG + Intergenic
932467846 2:71934964-71934986 AGGACTGACCAAGCCCAGGCTGG - Intergenic
932597905 2:73105671-73105693 AGGACTCACCCAGGAGAAGCAGG + Intronic
932774012 2:74516312-74516334 AGGGCTCCTCCACCACCGGCCGG + Exonic
933371076 2:81416297-81416319 TGCACCCAGCCAGCACAGGCTGG - Intergenic
933689648 2:85169812-85169834 CAGACTCGTCCAGCACAGACTGG + Intronic
934706585 2:96485711-96485733 AGGAGTCATCCCCCACACGCGGG + Intergenic
935234959 2:101130485-101130507 ATGACACAGCCAACACAGGCAGG + Intronic
936389293 2:112056582-112056604 ATGACTCATCCAGCACTGTTTGG + Intronic
937028854 2:118721577-118721599 AGGAGTCACCCTGCCCAGGCTGG + Intergenic
938278415 2:130048446-130048468 AGGACTCTTGCATCACAGGCTGG + Intergenic
938329391 2:130439305-130439327 AGGACTCTTGCATCACAGGCTGG + Intergenic
938360557 2:130682198-130682220 AGGACTCTTGCATCACAGGCTGG - Intergenic
938436960 2:131288906-131288928 AGGACTCTTGCATCACAGGCTGG - Intronic
938767240 2:134468526-134468548 AGGACTCAGGAAGCATAGGCTGG + Intronic
942027965 2:171929348-171929370 AGGACTCATCCAGAATATGTAGG - Intronic
945108930 2:206344389-206344411 AGGACCCATCCAACATAGGGAGG - Intergenic
945236382 2:207635611-207635633 GTGACTCATCCAGCACTGGATGG + Intergenic
945579422 2:211573761-211573783 AGTCCTCATCCAGTCCAGGCAGG - Intronic
947706799 2:232282772-232282794 AGGACGCCTCCAGAACAGCCGGG - Intronic
948468006 2:238161394-238161416 AGGAGTCATCCTCCACGGGCCGG + Intronic
948602461 2:239115211-239115233 AGGGCTCGTCCAGCAGAGCCTGG + Exonic
948702133 2:239767093-239767115 AGGCTTCATCCAGAACAGGTGGG - Intronic
948896972 2:240932195-240932217 AGGCATCACCCAGCACCGGCAGG + Intronic
1168980174 20:1997224-1997246 AGGATTCAGGAAGCACAGGCTGG + Intergenic
1169135234 20:3193342-3193364 AAGAATTAGCCAGCACAGGCTGG + Intronic
1170975245 20:21157833-21157855 ACGACTAACCCAGCACAGGGAGG - Intronic
1172048914 20:32101459-32101481 AGAAGTCATCCAGCACACTCTGG - Exonic
1175422786 20:58845844-58845866 AGTGCTCAGCCAGCAGAGGCAGG + Intronic
1175456829 20:59121715-59121737 GGGACTCATCCAGGACAATCGGG - Intergenic
1178578529 21:33816548-33816570 AGTCCACATCCAGCCCAGGCTGG + Intronic
1180065423 21:45409861-45409883 AGGAGACAGCCAGCCCAGGCAGG + Intronic
1181166245 22:20984771-20984793 AGGGGGCACCCAGCACAGGCTGG + Intronic
1183126179 22:35784072-35784094 AGGACTTTTTCTGCACAGGCAGG - Intronic
1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG + Exonic
1184383265 22:44159765-44159787 AGGACTCACCCACTTCAGGCTGG + Intronic
1184449128 22:44572605-44572627 AGGACACACCCAGCTCAGCCTGG - Intergenic
1185192758 22:49448971-49448993 AGGACTCCTCCACCCCGGGCAGG + Intronic
949297381 3:2541446-2541468 AGGAATCATATAGGACAGGCAGG + Intronic
950108951 3:10406211-10406233 AGGGGGCATCCAGCCCAGGCTGG + Intronic
951608183 3:24460692-24460714 AGGATTCATCCAGAACTGCCTGG + Intronic
955339805 3:58116549-58116571 ATCACTCATCCACCCCAGGCAGG - Intronic
955551319 3:60088181-60088203 AGAACTCATCCCCCAAAGGCAGG + Intronic
955670901 3:61401514-61401536 AGGAGTTATCCAGGAAAGGCTGG - Intergenic
956342817 3:68245901-68245923 AGGGCTCATCTAGGACAGCCAGG + Intronic
961339418 3:126207597-126207619 AAGAATCATCCAGCACATACAGG + Intergenic
961466214 3:127083190-127083212 ACGATTCCTCCTGCACAGGCAGG + Intergenic
961701184 3:128745874-128745896 AGGACTCAACCAGCAGAGGATGG - Intronic
962259094 3:133891921-133891943 AAGACTCTTCCAGCAAAAGCAGG - Intronic
966538849 3:181066346-181066368 AGGACTCATCCACCCCAAGTGGG + Intergenic
966794299 3:183698518-183698540 AGGACTCCTGCAGGAAAGGCTGG + Intronic
968984788 4:3869239-3869261 AGGACCCAGCCACCACAGGGAGG - Intergenic
969669852 4:8583634-8583656 AGCAGTCATCCTGGACAGGCTGG - Intronic
970648173 4:18147046-18147068 AGGAATCAGCTAGCACAAGCAGG - Intergenic
972925642 4:44003021-44003043 AGAACTCATCCAGGAGAGGTGGG - Intergenic
975796873 4:78015391-78015413 AGGACTCCTCCAGCAGCTGCTGG + Intergenic
976967636 4:91064391-91064413 AAGACACATCCAGCAAAGTCTGG + Intronic
979885387 4:126021627-126021649 TGGGATCATTCAGCACAGGCTGG - Intergenic
981614536 4:146633401-146633423 AGGACGCAGCCAGCCCAGGTTGG - Intergenic
984652898 4:182288789-182288811 ACGACTCATGGAGCACAGGGTGG + Intronic
984723056 4:182994393-182994415 AGGCCTCATGCAGCCCAGGATGG + Intergenic
985366599 4:189237580-189237602 GGGACTCCCCCAGCACAGCCTGG - Intergenic
987596805 5:20011801-20011823 AGGGCTCATCCACCACAATCAGG - Intronic
987696545 5:21341338-21341360 AGGCCTCAGCCAGCACAGGGAGG - Intergenic
987805994 5:22769341-22769363 AGGAAGCATCCAGCACAGGACGG - Intronic
987829635 5:23078302-23078324 AGGACTCAGCCAGTACAAGGAGG + Intergenic
988755656 5:34245232-34245254 AGGCCTCAGCCAGCACAGAGAGG + Intergenic
990466175 5:56073939-56073961 AGAGCCCATCCAGCAAAGGCAGG - Intergenic
991657082 5:68914814-68914836 AGGAATCATCCTACACAGGCTGG + Intergenic
991700552 5:69312931-69312953 AGGAACCAGCCAGCACAGGGAGG + Intronic
991743907 5:69711003-69711025 AGGCCTCAGCCAGCACAGAGAGG + Intergenic
991753802 5:69844239-69844261 AGGCCTCAGCCAGCACAGAGAGG - Intergenic
991795479 5:70290735-70290757 AGGCCTCAGCCAGCACAGAGAGG + Intergenic
991803419 5:70400966-70400988 AGGCCTCAGCCAGCACAGAGAGG - Intergenic
991823277 5:70586271-70586293 AGGCCTCAGCCAGCACAGAGAGG + Intergenic
991833118 5:70719352-70719374 AGGCCTCAGCCAGCACAGAGAGG - Intergenic
991887846 5:71290254-71290276 AGGCCTCAGCCAGCACAGAGAGG + Intergenic
992057084 5:73000801-73000823 AGGTCTCATGTTGCACAGGCTGG + Intronic
993379754 5:87192793-87192815 AGGACTGAACCATCAGAGGCTGG - Intergenic
993595514 5:89849963-89849985 AGGACCCTTGCAGCACAGGCAGG - Intergenic
997444105 5:133928807-133928829 AAGCCTCATCCAGCATAGGCCGG - Intergenic
998997668 5:147883272-147883294 TGGACTCACCCAGCAAAAGCTGG - Intronic
999121270 5:149211297-149211319 AGGAGTCATACATCAAAGGCTGG - Intronic
999240641 5:150125436-150125458 AGGACTGACCCAGCACAAGCTGG + Exonic
1001930428 5:175669007-175669029 GGGTCTCCTCCAGCTCAGGCTGG + Intronic
1002533604 5:179863979-179864001 AGTTCTCAGCCCGCACAGGCAGG - Exonic
1003864094 6:10347870-10347892 AGGACTCAGCAAGCACATGCTGG + Intergenic
1003881453 6:10483143-10483165 AGGCCTCAGCCAGCCCAGGGAGG + Intergenic
1005554295 6:26957007-26957029 AGGCCTCAGCCAGCACAGAGAGG + Intergenic
1005771468 6:29077192-29077214 AGGGCTCCTCCAGCAAAGGTGGG + Intergenic
1006981383 6:38150982-38151004 AGGAGCCAGCCAGCACTGGCAGG + Intronic
1007838530 6:44696806-44696828 CTGACACATCCAGCACAGGGAGG + Intergenic
1010958047 6:82113872-82113894 AAGTCTCAGTCAGCACAGGCTGG - Intergenic
1014081110 6:117286793-117286815 AGGAATTACCCAGCACAGGAAGG + Intergenic
1015137654 6:129891666-129891688 AGGACACACCCAGCCCACGCAGG - Intergenic
1016193314 6:141298097-141298119 AGGACTCATCCATGACATACAGG - Intergenic
1018485019 6:164232360-164232382 AGGACACATCCATCACAGTCAGG - Intergenic
1019148543 6:169988971-169988993 AGGGCTCATCCCGCCCAGCCAGG - Intergenic
1019152660 6:170019161-170019183 AGGACCAAGCCAGCACAGGCAGG - Intergenic
1023849347 7:44141428-44141450 AGGCCTCCCCCAGCCCAGGCGGG - Intergenic
1023967331 7:44969794-44969816 AGGCCTCGTCCAGCACGGCCAGG + Exonic
1024246090 7:47471532-47471554 AGGGCTCTTCCAGGAAAGGCTGG - Intronic
1024969099 7:55052524-55052546 AGGACACAGCCAGCACGGGCAGG - Intronic
1031368610 7:120935845-120935867 AGGAGACATGAAGCACAGGCTGG + Intergenic
1034680460 7:152924480-152924502 GAGACTCATCCATCCCAGGCTGG - Intergenic
1035283428 7:157791990-157792012 GGGACTCCTCCATGACAGGCTGG - Intronic
1035349985 7:158238918-158238940 AGGACGCCCCCAGGACAGGCTGG + Intronic
1037899146 8:22677397-22677419 AAGACTCTTCCTGCAAAGGCAGG + Intergenic
1038473652 8:27846178-27846200 AGGACACCCCCAGCACAGTCAGG - Intergenic
1038619765 8:29130532-29130554 AGGAATCTTCCAGCTCCGGCAGG - Exonic
1041187257 8:55314093-55314115 AGGATTCATCCAGCACCAGATGG + Intronic
1041512573 8:58668023-58668045 AGACCTCATCCAGCCCAGGCTGG + Intergenic
1044841846 8:96343645-96343667 AGGACCCAACCACCACATGCAGG - Intergenic
1048834786 8:138509001-138509023 AGGTCTCACTCTGCACAGGCTGG + Intergenic
1049262240 8:141645989-141646011 AGGACTCAGGGAGCACAGCCTGG - Intergenic
1051813549 9:21077570-21077592 AAGATTCATCTAGCACTGGCTGG - Exonic
1054762513 9:69015645-69015667 AGCACTCAGCCATCACAGGGTGG + Intergenic
1057042137 9:91855611-91855633 AGCATTCCTCCAGCAAAGGCAGG - Intronic
1058961826 9:109998983-109999005 AGGCCTCAGTCAGCACAGTCTGG - Intronic
1061502966 9:131014119-131014141 AGGACTAATCCAGGAGATGCAGG + Intronic
1062114319 9:134799555-134799577 AGGACTCTCCCAGCAAAAGCAGG + Intronic
1062406380 9:136398687-136398709 AGGCTGCAACCAGCACAGGCAGG + Exonic
1186465938 X:9785195-9785217 AGTACGCATCCAGGACAGGCCGG - Intronic
1186493419 X:9992895-9992917 AGGGCTCAGCCAGGACAGCCTGG - Intergenic
1186508369 X:10111690-10111712 AGGCTTCCCCCAGCACAGGCTGG + Intronic
1188981612 X:36731963-36731985 AGGGAGCATCCAGCACAGGTAGG - Intergenic
1194833711 X:98657008-98657030 AGCACTCAACCATCAAAGGCAGG + Intergenic
1195232723 X:102867371-102867393 AAGACTTTTTCAGCACAGGCTGG + Intergenic
1200241380 X:154496279-154496301 AGGAATGAACCAGCCCAGGCTGG - Intergenic
1200254158 X:154570577-154570599 AGGCCTCCTCCAGCTCAGTCAGG + Intergenic
1200263611 X:154633831-154633853 AGGCCTCCTCCAGCTCAGTCAGG - Intergenic