ID: 1132600997

View in Genome Browser
Species Human (GRCh38)
Location 16:772896-772918
Sequence CTGGTTCTCCAGGGCCACGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 215}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132600990_1132600997 -3 Left 1132600990 16:772876-772898 CCAGGTGCCCTCACCTCTGTCTG 0: 1
1: 1
2: 6
3: 45
4: 364
Right 1132600997 16:772896-772918 CTGGTTCTCCAGGGCCACGTCGG 0: 1
1: 0
2: 2
3: 20
4: 215
1132600987_1132600997 2 Left 1132600987 16:772871-772893 CCCACCCAGGTGCCCTCACCTCT 0: 1
1: 0
2: 2
3: 33
4: 414
Right 1132600997 16:772896-772918 CTGGTTCTCCAGGGCCACGTCGG 0: 1
1: 0
2: 2
3: 20
4: 215
1132600992_1132600997 -10 Left 1132600992 16:772883-772905 CCCTCACCTCTGTCTGGTTCTCC 0: 1
1: 0
2: 5
3: 51
4: 513
Right 1132600997 16:772896-772918 CTGGTTCTCCAGGGCCACGTCGG 0: 1
1: 0
2: 2
3: 20
4: 215
1132600984_1132600997 10 Left 1132600984 16:772863-772885 CCTGCCCGCCCACCCAGGTGCCC 0: 1
1: 1
2: 3
3: 52
4: 610
Right 1132600997 16:772896-772918 CTGGTTCTCCAGGGCCACGTCGG 0: 1
1: 0
2: 2
3: 20
4: 215
1132600989_1132600997 -2 Left 1132600989 16:772875-772897 CCCAGGTGCCCTCACCTCTGTCT 0: 1
1: 0
2: 2
3: 33
4: 354
Right 1132600997 16:772896-772918 CTGGTTCTCCAGGGCCACGTCGG 0: 1
1: 0
2: 2
3: 20
4: 215
1132600988_1132600997 1 Left 1132600988 16:772872-772894 CCACCCAGGTGCCCTCACCTCTG 0: 1
1: 0
2: 7
3: 58
4: 468
Right 1132600997 16:772896-772918 CTGGTTCTCCAGGGCCACGTCGG 0: 1
1: 0
2: 2
3: 20
4: 215
1132600985_1132600997 6 Left 1132600985 16:772867-772889 CCCGCCCACCCAGGTGCCCTCAC 0: 1
1: 1
2: 6
3: 49
4: 464
Right 1132600997 16:772896-772918 CTGGTTCTCCAGGGCCACGTCGG 0: 1
1: 0
2: 2
3: 20
4: 215
1132600982_1132600997 14 Left 1132600982 16:772859-772881 CCCACCTGCCCGCCCACCCAGGT 0: 1
1: 0
2: 3
3: 39
4: 412
Right 1132600997 16:772896-772918 CTGGTTCTCCAGGGCCACGTCGG 0: 1
1: 0
2: 2
3: 20
4: 215
1132600979_1132600997 24 Left 1132600979 16:772849-772871 CCTGGGGCCACCCACCTGCCCGC 0: 1
1: 1
2: 4
3: 58
4: 449
Right 1132600997 16:772896-772918 CTGGTTCTCCAGGGCCACGTCGG 0: 1
1: 0
2: 2
3: 20
4: 215
1132600983_1132600997 13 Left 1132600983 16:772860-772882 CCACCTGCCCGCCCACCCAGGTG 0: 1
1: 0
2: 6
3: 50
4: 506
Right 1132600997 16:772896-772918 CTGGTTCTCCAGGGCCACGTCGG 0: 1
1: 0
2: 2
3: 20
4: 215
1132600980_1132600997 17 Left 1132600980 16:772856-772878 CCACCCACCTGCCCGCCCACCCA 0: 2
1: 4
2: 53
3: 502
4: 2880
Right 1132600997 16:772896-772918 CTGGTTCTCCAGGGCCACGTCGG 0: 1
1: 0
2: 2
3: 20
4: 215
1132600986_1132600997 5 Left 1132600986 16:772868-772890 CCGCCCACCCAGGTGCCCTCACC 0: 1
1: 1
2: 3
3: 63
4: 599
Right 1132600997 16:772896-772918 CTGGTTCTCCAGGGCCACGTCGG 0: 1
1: 0
2: 2
3: 20
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132600997 Original CRISPR CTGGTTCTCCAGGGCCACGT CGG Exonic
900374095 1:2345455-2345477 CTTGTTGTTCAGAGCCACGTAGG - Intronic
900413514 1:2524592-2524614 CTGGTACTCCAGGGCCCTCTAGG + Intronic
900713712 1:4130678-4130700 CTGGTTCTGAAGGGCCAGGTTGG + Intergenic
900971779 1:5995944-5995966 CTGGGCCTCCAGGGCCTCTTGGG - Intronic
900977434 1:6026256-6026278 CTGGCGCGCCAGGGCCCCGTGGG - Intronic
902449318 1:16486539-16486561 CTGCTTCTCCAGGGCTGCCTTGG + Intergenic
902505430 1:16936738-16936760 CTGTTTCTCCAGGGCTGCCTCGG - Exonic
903164221 1:21509544-21509566 CTGGTTCCCCAGGGCCCCAGCGG + Intronic
903285686 1:22275420-22275442 CTGTTTCTACAGGGCCCCGGGGG - Intergenic
903503909 1:23819278-23819300 CAAGTTCTCAAGGGCCACATGGG + Intronic
904597114 1:31653919-31653941 CAGGTGCTCCAGGGTCACCTGGG - Exonic
904840684 1:33370078-33370100 CTGGGTGTCCAGGACCACCTGGG + Intronic
905521391 1:38603198-38603220 CTGGTTTTCCTGGGCCACAGGGG - Intergenic
906280620 1:44550838-44550860 ATGCTTCTCCATGGCCAGGTTGG + Intronic
907533925 1:55130590-55130612 CTGTTTCTCCAGAGCAACCTAGG - Intronic
908281303 1:62538944-62538966 TTGGTTCTGCTGGGCCACTTTGG - Intronic
914244240 1:145873761-145873783 CTGGTTCTCAAGGTCCAGATAGG + Exonic
915569328 1:156735796-156735818 ACGGTTCTCCTGGGCCACGTGGG - Exonic
915609997 1:156984202-156984224 CTGGTTCTCCATGGGTGCGTGGG - Intronic
917438462 1:175044761-175044783 GAGGTTCTGCAAGGCCACGTCGG + Intergenic
918049780 1:180964066-180964088 CTGGCTTTCCTGGGCCACATTGG + Intergenic
919743117 1:200992372-200992394 CTGCTTCATCAGGGCCACCTGGG + Exonic
922744293 1:228035647-228035669 CAGGCTCTCCAGGGGCAAGTGGG + Intronic
923762910 1:236863378-236863400 CTAGTTCTCCAGAGCCAGGCAGG - Intronic
1062787441 10:277466-277488 GTGCTCCTCCAGGACCACGTTGG + Exonic
1066335093 10:34468204-34468226 AAGGTTCTCCAGGACCACCTAGG + Intronic
1067090903 10:43265516-43265538 CTGGATGGCCAGGGACACGTGGG - Intronic
1067523667 10:47026123-47026145 ATGGTTCTGCAGGGCAGCGTGGG + Intergenic
1070818595 10:79341242-79341264 CTTGTTCTCAAGGGCCATGTGGG + Intergenic
1070818792 10:79342731-79342753 CTGTGTCTCCAGGGGCAGGTGGG - Intergenic
1073509562 10:104034706-104034728 CTGGTCCCCCAGGGCCTCGAGGG - Exonic
1074384045 10:113003314-113003336 AAGGGTCTCCAGGGGCACGTGGG - Intronic
1076190448 10:128479598-128479620 CTGGTTCTCCAGTCCCAGGGAGG - Intergenic
1076368244 10:129935912-129935934 CTGGTGCTCCAGGGCTGCTTGGG - Intronic
1076836478 10:133023620-133023642 GTGGTGTTCCAGGTCCACGTGGG + Intergenic
1076836486 10:133023646-133023668 GTGGTGTTCCAGGTCCACGTGGG + Intergenic
1076836494 10:133023672-133023694 GTGGTGTTCCAGGTCCACGTGGG + Intergenic
1077028841 11:454276-454298 CTGCTTCCCCAGGGCCAGGAGGG + Intronic
1077491827 11:2864481-2864503 CTGGTACTCAAGGCCCACCTGGG + Intergenic
1083147034 11:60767587-60767609 ATGGTTCGCCGCGGCCACGTGGG + Exonic
1083347042 11:62001039-62001061 CTGGTTCTCCTGGCCCAGGTGGG - Intergenic
1085962598 11:81480321-81480343 CTGGTTGACCAGGGCCATTTTGG + Intergenic
1087193591 11:95282482-95282504 CTGTTTCTCCAGAGAAACGTAGG - Intergenic
1088804069 11:113335009-113335031 GTAGTTCTTCAGGGCCAGGTTGG - Exonic
1089499434 11:118923777-118923799 CTGGCTCTCCAAGGCCAAGGAGG + Intronic
1091560123 12:1605797-1605819 CTGCTTCTCCACGCCCACTTCGG - Intronic
1091744538 12:2982672-2982694 CTGGAGCACCAGGGACACGTGGG + Intronic
1096486402 12:51984720-51984742 CTGGTTGACCAGGGCCACAATGG + Intronic
1096487653 12:51994521-51994543 CTGGTTCTTCCGGGCCACCTTGG - Intronic
1096589635 12:52649040-52649062 CTGGTTCAGCAGGTCCACCTTGG + Exonic
1096622405 12:52872902-52872924 CTGGTTCTCCAGGGACGGTTTGG - Intergenic
1098087400 12:66861580-66861602 TTTGTTCTCCATGGCCATGTGGG - Intergenic
1098534391 12:71578153-71578175 CTGCTCCTCCAGGGCCACATGGG + Intronic
1098872964 12:75837035-75837057 CTGGTTCCCCAGGGCTTCCTTGG + Intergenic
1100896237 12:99185860-99185882 CTGGTGTTCCAGGGCCACTGGGG - Intronic
1101924631 12:108960950-108960972 CTGGTGCTCCGGGGCCTGGTGGG - Exonic
1104401980 12:128483692-128483714 CTGGCTCTTCAGAGCCCCGTGGG + Intronic
1104987408 12:132604630-132604652 CTGGCTCTTCAGGGGCAGGTAGG + Intronic
1105618291 13:22041228-22041250 CTCATTCTCCAAGCCCACGTGGG + Intergenic
1105944615 13:25178462-25178484 CTGGTTATCCAAGGCCATCTGGG + Intergenic
1106477844 13:30113763-30113785 GTGTTTCTCCAGGGCCTCCTTGG - Intergenic
1106670365 13:31898589-31898611 CTTGTTATCAAGAGCCACGTGGG - Intergenic
1107549497 13:41461773-41461795 CTGGTTCTCCAGGGCCCACAAGG - Intronic
1112345212 13:98583598-98583620 GTGGTCCTCCATGGCCACCTTGG + Intergenic
1113310014 13:109122040-109122062 CTGGTGTTCCAGGGACACATGGG - Intronic
1113424700 13:110198483-110198505 CTGGTTCCCCTGGGCCCCCTGGG - Exonic
1114474195 14:22982354-22982376 CTGGTTCCCCAGGGGCACAGGGG + Exonic
1114660319 14:24339546-24339568 CTGGTTCTCCAGTTCCTCGATGG + Exonic
1115776601 14:36722088-36722110 CAGGTGCTCAATGGCCACGTGGG - Intronic
1122359950 14:101153169-101153191 CTGGTTCTTCAGTGCCCCGTAGG + Intergenic
1122401892 14:101472278-101472300 CTGGCTCTCCAGGGTCAGGATGG - Intergenic
1122623631 14:103073468-103073490 CTGGGTGTCCAAGGCCATGTAGG - Intergenic
1123946201 15:25240098-25240120 CTGGTTCCCCAGGGACAGGGCGG + Intergenic
1124790017 15:32718359-32718381 CTGGGTCTGCAGGGAAACGTAGG + Intronic
1125768544 15:42150540-42150562 CTGGCGTTCCAGGGCCACGTTGG - Intronic
1127609264 15:60621329-60621351 CTGGGTTTCCAGGGCCTAGTTGG - Intronic
1128227632 15:66013250-66013272 CTGGCTCACCAAGGCCACTTGGG - Intronic
1128498442 15:68211075-68211097 CTGGGTCTCCCGGGCAACCTCGG + Intronic
1128651874 15:69422043-69422065 CTGGTTCTCCAGGGGAAGGAGGG + Exonic
1128707202 15:69845243-69845265 CTGCTTCTCCATGCCCACCTTGG + Intergenic
1132600997 16:772896-772918 CTGGTTCTCCAGGGCCACGTCGG + Exonic
1132804143 16:1767981-1768003 GTGGCTCTGCAGGGCCACCTTGG + Intronic
1134625688 16:15721010-15721032 CTGGGTCTCCAGGGCCCGCTTGG + Exonic
1135131078 16:19854394-19854416 CTGGGTCTCTAGGGACAAGTTGG - Intronic
1136283648 16:29229093-29229115 CTGCTTCGCCAAGGCCAGGTGGG - Intergenic
1136887111 16:33936617-33936639 CTGCTTCTCCTGGGGCACCTTGG - Intergenic
1137387282 16:48053506-48053528 TTGGCTCTCCAGGGCCAGATGGG - Intergenic
1137887736 16:52125022-52125044 CAGGTTTTCCAGAGCCATGTGGG + Intergenic
1138660197 16:58512129-58512151 CTGGTGCTGTAGGGCCACGCAGG + Exonic
1138752627 16:59442222-59442244 CTGCTTCTACAGGGCCACCCTGG - Intergenic
1141127956 16:81414565-81414587 CTGGTTCTCCTGGTATACGTGGG + Intergenic
1141643015 16:85352457-85352479 CATGTTCTCCAGGGCCCCCTGGG + Intergenic
1142088680 16:88198604-88198626 CTGCTTCGCCAAGGCCAGGTGGG - Intergenic
1203085340 16_KI270728v1_random:1181221-1181243 CTGCTTCTCCTGGGGCACCTTGG + Intergenic
1143141562 17:4744388-4744410 CTGCAGCTCCAGGGCCACATGGG - Exonic
1143177827 17:4966856-4966878 CTGGTCCCCCTGGGGCACGTGGG + Intronic
1143713035 17:8746594-8746616 CAGGTGGTCCAGGGCCAGGTTGG + Intergenic
1143741045 17:8954319-8954341 CTTGTCCTCCAGGGTCAAGTAGG + Intronic
1144670160 17:17128292-17128314 CTGGGTCTCCAGGGCAAGCTGGG + Intronic
1145004828 17:19331985-19332007 CAGGTTCACCAGGGCCGCGTTGG - Exonic
1145392463 17:22466238-22466260 TTGGTTTTCCTGGGCCACATTGG + Intergenic
1147121392 17:38337321-38337343 CTGGGGCTCCAGGGACAAGTGGG + Intronic
1149781195 17:59397824-59397846 CTGGTTCTCCTGGGCTGAGTGGG + Exonic
1150623115 17:66823116-66823138 TTGGTTCTCCAGGGGCATGGAGG - Intergenic
1151330015 17:73401129-73401151 ACGGTACTCCAGGGTCACGTTGG + Exonic
1152684964 17:81689419-81689441 CTAGTTCTCCACGGCCACAATGG - Intronic
1152720897 17:81923406-81923428 CTGGTTCTCTAGGGGCAGGGTGG - Intronic
1157177960 18:45468192-45468214 ATGGTTCTCCAGGGGCTGGTGGG + Intronic
1157706548 18:49812737-49812759 TTGGTGCTCCAGGGCCCTGTGGG - Intronic
1158729728 18:60010121-60010143 GAGGTTCTGCAAGGCCACGTCGG + Intergenic
1158887099 18:61838898-61838920 CAGGTTCTCCAGGGACAAGGAGG - Intronic
1159189979 18:65028523-65028545 TTGGTACTCCTGGGCCACATAGG + Intergenic
1160086040 18:75778310-75778332 CTGGGTGTCCAGTGCCAGGTGGG + Intergenic
1160411391 18:78677693-78677715 CGGGTTCACCAGGGGCACGGAGG + Intergenic
1160913685 19:1487055-1487077 CTGGTTTCCCAGGGCCGCGGCGG - Exonic
1161262468 19:3345465-3345487 CAGGTTGTGCAGGGCCTCGTAGG - Intergenic
1161288035 19:3478813-3478835 CTGGTGTTCCAAGGCCAGGTGGG - Exonic
1161452645 19:4355022-4355044 GTGGGTATCCAGGGCCAGGTGGG + Intronic
1163850381 19:19659717-19659739 CTTCTTCTCCAGGGCATCGTAGG + Exonic
1164566527 19:29329730-29329752 CTGTTTCCCCAGGGCCATCTTGG - Intergenic
1165421395 19:35723792-35723814 CTGGTCCTCCAGGCCCACGCCGG + Exonic
1165802814 19:38563215-38563237 CAGGTGCTCCAAGGCCACATGGG - Intronic
1167476837 19:49706219-49706241 CGGGCCCTCCAGGGGCACGTGGG + Exonic
1167550124 19:50154692-50154714 CTGGTACTGCAGGGCCACGCGGG + Exonic
1168350162 19:55671006-55671028 CTGGCTCTGCAGGGCCAGATCGG + Intronic
1168377202 19:55890367-55890389 TTGGTTTCCCTGGGCCACGTTGG + Intergenic
925583260 2:5436045-5436067 GTGGTTCTCCAGGACCACGTGGG + Intergenic
926388561 2:12363192-12363214 GTGGTTCTCCAGGGCCTCTCAGG + Intergenic
926690203 2:15727847-15727869 TTGGTTTCCCTGGGCCACGTTGG + Intronic
927061959 2:19431671-19431693 CTGCAGCTCCAGGGCCACATGGG - Intergenic
932560618 2:72864718-72864740 CTGGTTCTCCAGAGCCACCCTGG + Intergenic
933950241 2:87322941-87322963 CAGGATCTCCAGGGCCACCCAGG + Intergenic
934036251 2:88091079-88091101 ATGGTTCACCAGGCCCAGGTTGG - Exonic
934476697 2:94598441-94598463 CTGGTTTTCCAGGGCCCGGATGG - Intronic
934858203 2:97741891-97741913 CTGGACCTCCAGGGCCCAGTGGG - Intergenic
936329946 2:111538655-111538677 CAGGATCTCCAGGGCCACCCAGG - Intergenic
937133920 2:119535995-119536017 TTGGTTCTCCCCGGCCAAGTTGG - Intergenic
941483351 2:166045952-166045974 CTGGTTCTTAAGGGGCACATGGG + Intronic
941666232 2:168246793-168246815 CTGGGTTTCCAGGGCCCCGGGGG - Intronic
942517379 2:176768240-176768262 CTGTTTCTCCAAGGGCAGGTTGG + Intergenic
948706075 2:239793271-239793293 CTGGTACTCCTGGGCCTCCTGGG + Intronic
948826123 2:240574145-240574167 GGGGTTCTCCATGGCCACGATGG - Exonic
948860790 2:240751737-240751759 CTGGACCCCCAGGGCCACATGGG - Intronic
948911677 2:241008146-241008168 GTGCTGCTCCAGGGCCACCTGGG + Intronic
948912408 2:241011137-241011159 CTGGTTCTCCTGGGTCTCCTGGG + Intronic
1168830825 20:844502-844524 CTGGTTCTCCCGGGGCAGGAGGG + Intronic
1170130800 20:13017695-13017717 TTGGCTTTCCAGGGCCACATTGG - Intronic
1171484745 20:25478601-25478623 CCGCTTCTCCAGGGCCAGGCAGG - Intronic
1173870309 20:46337723-46337745 CTGGATATTCAGGGCCACGAAGG - Intergenic
1174406497 20:50306429-50306451 CGGATCCTGCAGGGCCACGTGGG + Intergenic
1174412286 20:50343869-50343891 CTGGGTGTTCTGGGCCACGTTGG + Intergenic
1174860739 20:54088762-54088784 CTTGTGCTCCAGGGACACCTTGG + Intergenic
1175119372 20:56706543-56706565 CAGGAGCTCCAGGGCCACATGGG + Intergenic
1175388810 20:58613762-58613784 CTGGTTCTCCCGGGACACAGTGG + Intergenic
1175749535 20:61485642-61485664 CTGGTTCTCCATGGCGATGATGG + Intronic
1178832656 21:36069789-36069811 ATGGTTCTTCACTGCCACGTGGG + Intronic
1179976694 21:44872617-44872639 CTGGGCCTCCAGGGCCTGGTGGG - Intronic
1180600562 22:17012645-17012667 CTGGTCCTCCAGTGGCAGGTAGG - Intergenic
1181610838 22:24010847-24010869 TTGGTTTCCCTGGGCCACGTTGG - Intergenic
1183674125 22:39290421-39290443 CCCTTTCTCCAGGGCCAGGTGGG + Intergenic
1183828636 22:40406562-40406584 CTGAGTCTCCACGGCCACATCGG - Exonic
1184150853 22:42637676-42637698 CTGGGATCCCAGGGCCACGTCGG + Intronic
1184659692 22:45960158-45960180 CTGCTTCTCCTTGGCCACTTTGG + Intronic
1184774771 22:46617672-46617694 CTGTCTCTCCTGGGCCACGCTGG + Intronic
1185249700 22:49794242-49794264 CTGCTCCTCCAGGCCCAGGTGGG + Exonic
949640439 3:6030141-6030163 CTGGATCTCCAGGGCCCTGGTGG + Intergenic
951205541 3:19922564-19922586 CTGGCTTTCCAGGGCCCAGTGGG - Intronic
953381928 3:42478567-42478589 CTGGTTGTCTAGGACCACTTAGG + Intergenic
962232358 3:133676630-133676652 CTGGCTCAGCACGGCCACGTGGG + Intergenic
963123922 3:141798004-141798026 CTGGTTGTCCAGAGCCACACTGG + Intronic
967991324 3:195133275-195133297 CTGGTACTCCAGGGCCATTCAGG - Intronic
968491736 4:893802-893824 CGGGGTCTCCAGAGCCACGCGGG + Intronic
968576281 4:1367716-1367738 CTGCTTCTCCAGGGGCAGGCAGG + Intronic
968904991 4:3446909-3446931 CAGGTTCTGCAGGGCCACGCAGG - Intronic
968973605 4:3809872-3809894 CTGGTCTTCCAGGGCGATGTTGG + Intergenic
969657274 4:8505492-8505514 CTGCCTGTCCAGGGCCACGGAGG - Intergenic
970261670 4:14231233-14231255 TTGGTTTCCCAGGGCCACATTGG + Intergenic
970481809 4:16483719-16483741 CAGGTTCTCAACGGCCACGTGGG - Intergenic
974756818 4:66220316-66220338 CTGGTTCTTTAGGGCCTCTTTGG - Intergenic
980022962 4:127730949-127730971 CTGCTTTTCCAGGGCCGCGTTGG + Intronic
981069024 4:140515551-140515573 CTTTTTCTCCTGGGCCACATAGG + Intergenic
982206240 4:152999184-152999206 CTGGTTCTCCAGGGCTAAACTGG - Intergenic
982548362 4:156763132-156763154 ATGGTGCTCCAGGGCCACGTCGG + Exonic
983236017 4:165180213-165180235 CTGATACTCCATGGCCAAGTAGG + Intronic
990632726 5:57688489-57688511 CTGGTTCCCCAAGGCCGGGTTGG + Intergenic
995841512 5:116447168-116447190 CTGGTCCTCCAGCGCCATCTGGG + Exonic
996365942 5:122701600-122701622 CTGTTTCTCCCTGGACACGTGGG + Intergenic
996515735 5:124367230-124367252 CTGGTTGCCTAGGGCCATGTGGG - Intergenic
996757444 5:126949609-126949631 CTGTCTCTCCAGGGCCTCCTAGG - Intronic
997590803 5:135071070-135071092 CTGGTTCCCCAGAGCCACAGAGG + Intronic
997690462 5:135824551-135824573 CAGGTACTCCAAGGCCACCTGGG - Intergenic
1001065231 5:168530244-168530266 CTGGTCCGGCTGGGCCACGTCGG - Exonic
1001746841 5:174098864-174098886 CTAGTTCTCCAGCGCTACATTGG - Intronic
1006650089 6:35544521-35544543 CTGGTTTTCCTGGGGCACCTTGG - Intergenic
1011558553 6:88592659-88592681 CTGCTCCTCCAAGGACACGTTGG - Intergenic
1013980125 6:116120583-116120605 CTGGTCTTCCAGGGCCCCCTGGG - Exonic
1015536007 6:134268317-134268339 CTGGGCCTCCTGGGCCACCTGGG + Intronic
1018182940 6:161240499-161240521 CTGGTTAACCTGGGCCACTTGGG - Intronic
1019436224 7:1023572-1023594 CATGTTCTCCAGGGCCCAGTGGG - Intronic
1019510908 7:1416825-1416847 CTGGTTCCCCAAGGCCACTGAGG - Intergenic
1019682257 7:2357273-2357295 CTGCACCTTCAGGGCCACGTGGG - Intronic
1019701210 7:2475752-2475774 CCGGTTCTCCAGCGCCACTGTGG - Exonic
1022482927 7:30755694-30755716 CTCTTTCTCCAGGGCCACGCAGG - Exonic
1023144979 7:37141726-37141748 CTGTTTCTCCAGGGCAATTTTGG + Intronic
1026690989 7:72549781-72549803 TTGGTTCTCCAGGACAAAGTTGG + Intergenic
1033330238 7:140411458-140411480 CTGGTTTCCCTGGGCCATGTTGG + Intronic
1034274784 7:149819352-149819374 CTGGACCTCCTGGGCCCCGTGGG + Intergenic
1034282119 7:149861784-149861806 GAGGCTCTCCAGTGCCACGTAGG - Exonic
1035241124 7:157529941-157529963 TTGGCTTTCCTGGGCCACGTGGG + Intergenic
1036502357 8:9325497-9325519 CTGGTTCTCCAGGCCCACTGTGG - Intergenic
1037831717 8:22193869-22193891 CTGGCTCTCCAAAGCCAAGTTGG + Intronic
1039517522 8:38146147-38146169 CTGGTTCCCCATGGCCTGGTAGG - Exonic
1040023605 8:42762080-42762102 CTGGTGCTCCAGAGCCAAGCTGG + Intronic
1041391245 8:57349282-57349304 CTTGTTCCCCAAGGCCATGTGGG + Intergenic
1049207922 8:141372005-141372027 CTGGGTCTCCAGGCCCACCCAGG + Intergenic
1049820503 8:144630394-144630416 CTGGTTCTCCAGCCCTACGGTGG + Intergenic
1052853333 9:33391464-33391486 CTGGTTTTCCAGGGCCCGGATGG + Intronic
1053346702 9:37383472-37383494 CTGGTTATCCAGAGCTACCTAGG + Intergenic
1053681365 9:40487636-40487658 CTGGTTTTCCAGGGCCCGGATGG + Intergenic
1053931355 9:43115966-43115988 CTGGTTTTCCAGGGCCCGGATGG + Intergenic
1054282348 9:63137298-63137320 CTGGTTTTCCAGGGCCCGGATGG - Intergenic
1054294454 9:63323152-63323174 CTGGTTTTCCAGGGCCCGGATGG + Intergenic
1054392475 9:64627640-64627662 CTGGTTTTCCAGGGCCCGGATGG + Intergenic
1054427123 9:65132849-65132871 CTGGTTTTCCAGGGCCCGGATGG + Intergenic
1054503252 9:65888690-65888712 CTGGTTTTCCAGGGCCCGGATGG - Intronic
1057630993 9:96719078-96719100 CTGGTTCCCCTGGGCCACTTTGG - Intergenic
1059186582 9:112278383-112278405 CTGGTTGAGCAAGGCCACGTTGG - Intronic
1060193775 9:121609767-121609789 CTGGATCTCCAGGGCTATCTTGG + Intronic
1060846192 9:126839440-126839462 CTGGTTAACCAGGGCCTCGGTGG - Intergenic
1062249002 9:135584738-135584760 CAGGGTCCCCAGGCCCACGTAGG - Intergenic
1062249857 9:135588604-135588626 CTGGTACTCCATGGCCATGGTGG + Intergenic
1062407573 9:136404090-136404112 GAGGTTCTGCAGGGCCACGTCGG + Exonic
1062516493 9:136939559-136939581 ATGGTTCCCCTGAGCCACGTGGG - Intronic
1062523763 9:136970138-136970160 AGGGTTCTCCAGGGCCATGAGGG - Intronic
1194766497 X:97848596-97848618 CCGGTTCTGCATGGCCACCTTGG - Intergenic
1196523029 X:116695888-116695910 CTCGTTCTCCAAGCCCATGTGGG + Intergenic
1197728868 X:129793941-129793963 CTGCTTCCCCAGGGACACTTAGG + Exonic
1198312068 X:135433757-135433779 CTGCTTCTCCAGGGCCGCTTCGG - Intergenic