ID: 1132601019

View in Genome Browser
Species Human (GRCh38)
Location 16:773009-773031
Sequence GCCGCAGCTGATCCTCCGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132601013_1132601019 20 Left 1132601013 16:772966-772988 CCGATCTCGGTGCGGGAGTAGAG 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1132601019 16:773009-773031 GCCGCAGCTGATCCTCCGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 129
1132601016_1132601019 -8 Left 1132601016 16:772994-773016 CCAGCGAGGTGATGAGCCGCAGC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1132601019 16:773009-773031 GCCGCAGCTGATCCTCCGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 129
1132601011_1132601019 27 Left 1132601011 16:772959-772981 CCACTGGCCGATCTCGGTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1132601019 16:773009-773031 GCCGCAGCTGATCCTCCGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132601019 Original CRISPR GCCGCAGCTGATCCTCCGGG AGG Exonic
902449307 1:16486502-16486524 CCCGCAGCTGCTCCTCCAGCTGG + Intergenic
902468701 1:16633217-16633239 CCCGCAGCTGCTCCTCCAGCTGG + Intergenic
902505441 1:16936775-16936797 CCCGCAGCTGCTCCTCCAGCTGG - Exonic
910609428 1:89125764-89125786 GCCGCAGCTGAGCCTGCTGTGGG - Intronic
913163994 1:116168552-116168574 GCCACCGCGGACCCTCCGGGCGG - Intergenic
914950289 1:152108068-152108090 GCAGCTGCTGTTCCTCCTGGAGG + Exonic
914950344 1:152108524-152108546 GGCGCAGCTGTTCCTCCTCGCGG + Exonic
914950356 1:152108596-152108618 GCAGCTGCTGTTCCTCCTGGAGG + Exonic
915367336 1:155323559-155323581 GCAGCAGCTGCTCCTCTGGGGGG - Intronic
920556745 1:206909709-206909731 GCTGCAGGTGAGCCGCCGGGCGG - Exonic
1063283974 10:4662767-4662789 GCCGCAGCTGATCTGACAGGAGG + Intergenic
1065102008 10:22340727-22340749 GGGGCAGCCGCTCCTCCGGGAGG + Intergenic
1068747974 10:60556885-60556907 GCCGCAGCTGATCCAACAGGAGG - Intronic
1068970901 10:62957131-62957153 GCCGCTGCTGATCTGACGGGAGG + Intergenic
1069357288 10:67601422-67601444 GCCGCAGCTGATCTGTCAGGAGG + Intronic
1071661355 10:87505546-87505568 GTCGCAGGTGACCCCCCGGGCGG + Exonic
1073196243 10:101694529-101694551 GCAGCAGCAGCTCCTCCGGCAGG + Exonic
1076135559 10:128043418-128043440 GCCGCTGCTGATCTGACGGGGGG + Intronic
1076312020 10:129515265-129515287 GCCGCAGCTGCTGCTCCTGACGG - Intronic
1077551799 11:3203714-3203736 GCAGCAGCAGGTCCTGCGGGAGG - Intergenic
1079514854 11:21255175-21255197 ACCTCAGCTTAACCTCCGGGGGG - Intronic
1083940107 11:65891158-65891180 CCCGCAGCAGCTCCTCCTGGCGG - Exonic
1084179255 11:67438399-67438421 GGCCCAGCTGCTCCTCCAGGCGG + Exonic
1084401914 11:68949118-68949140 GCCGCCGCTGATCTGACGGGAGG - Intergenic
1086064586 11:82732642-82732664 GCCGCTGCGGATTCTCCCGGCGG - Exonic
1089743106 11:120598651-120598673 GCCACAGCTGATACTGAGGGAGG - Intronic
1090907804 11:131092539-131092561 GCCACTGCTTCTCCTCCGGGAGG + Intergenic
1092871652 12:12810965-12810987 GCCGCAGCTGATTTACCAGGAGG - Intronic
1102114984 12:110396084-110396106 GCCGCAGCTGATCTGACAGGAGG + Intronic
1102391072 12:112549162-112549184 GCCGCAGCTGATCTGACAGGAGG + Intergenic
1102919393 12:116780437-116780459 GCCGCAGCTGATCTGATGGGAGG + Intronic
1103907599 12:124335495-124335517 GCCGCAGCTCCCCCTCCAGGTGG + Exonic
1105031556 12:132887610-132887632 CCCTCAGCTGATCCGCGGGGCGG + Intronic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1108499859 13:51060127-51060149 GGAGCAGCTGATCCTCTGGAAGG + Intergenic
1113798622 13:113074965-113074987 GCCTGAGCTGGTCCTCTGGGTGG + Intronic
1118370226 14:65131293-65131315 GCCGCAGCTGATCTGACAGGAGG + Intergenic
1121957379 14:98226642-98226664 GCCCCAACTGCTCCTCCGAGGGG + Intergenic
1122227235 14:100286847-100286869 GCCCCAGCTGATCCTGCTGAAGG + Intergenic
1125936862 15:43644606-43644628 GCCGCAGCTGATCTGACAGGAGG - Intronic
1125949670 15:43741393-43741415 GCCGCAGCTGATCTGACAGGAGG - Intergenic
1129112242 15:73344201-73344223 GCCACAGCTGACCCTCAGGGAGG - Intronic
1131047294 15:89324160-89324182 GCAGCAGCTGATGCCCCAGGAGG - Exonic
1132601019 16:773009-773031 GCCGCAGCTGATCCTCCGGGAGG + Exonic
1132934939 16:2475349-2475371 GCCGCAGCTGCAGCGCCGGGCGG - Intronic
1136083405 16:27867740-27867762 GCCGCCGGAGATCCTCAGGGTGG - Intronic
1136711489 16:32240583-32240605 GCGGGAGCTGCTGCTCCGGGAGG - Intergenic
1136811690 16:33181551-33181573 GCGGGAGCTGCTGCTCCGGGAGG - Intergenic
1136818166 16:33291631-33291653 GCGGGAGCTGCTGCTCCGGGAGG - Intronic
1136824730 16:33348160-33348182 GCGGGAGCTGCTGCTCCGGGAGG - Intergenic
1136829796 16:33446931-33446953 GCGGGAGCTGCTGCTCCGGGAGG - Intergenic
1137031213 16:35526351-35526373 GCTGGAGCTGCTGCTCCGGGAGG + Intergenic
1140239222 16:73185949-73185971 GCCGCTGCTGATCTGACGGGAGG - Intergenic
1141116569 16:81314811-81314833 GCCGCAGCTGGTCAGGCGGGCGG + Intergenic
1141836534 16:86543872-86543894 GCCGCAGCTGATCGGACAGGAGG - Intronic
1142393437 16:89816990-89817012 GCAGCCGCTGTTCCTCCCGGCGG + Intergenic
1202990268 16_KI270728v1_random:4520-4542 GCGGGAGCTGCTGCTCCGGGAGG - Intergenic
1203058565 16_KI270728v1_random:949176-949198 GCGGGAGCTGCTGCTCCGGGAGG + Intergenic
1143043315 17:4055994-4056016 GCCGCAGCTGATCGGACAGGAGG + Intronic
1145248467 17:21284800-21284822 GCCGCCGCTGCTCCTCCGCCTGG + Exonic
1147377225 17:40029774-40029796 CATCCAGCTGATCCTCCGGGCGG - Exonic
1147976358 17:44250339-44250361 GCCTCAGCTGCTGCTCCAGGAGG + Exonic
1153246982 18:3082120-3082142 GCCGCAGCTGATCTGACAGGAGG + Intronic
1157459304 18:47872636-47872658 GCCACTGCTGATCTTCCAGGAGG - Intronic
1158862901 18:61610491-61610513 GCCGCAGCTGATCTGACAGGAGG + Intergenic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1160923521 19:1531873-1531895 GCCACAACTTACCCTCCGGGGGG - Exonic
1162037440 19:7949323-7949345 GCCGCTGCTGATCTTACAGGAGG + Intergenic
1163529949 19:17843184-17843206 GCCTCAGCTGATGCTCCCTGTGG - Intronic
926561311 2:14420311-14420333 GCTGCCTCTGATGCTCCGGGTGG - Intergenic
935349663 2:102142609-102142631 GCCGCGCCTGCTCCTCCGGGTGG + Intronic
936511938 2:113155539-113155561 GCCGCAGCTGATCTGACAGGAGG - Intergenic
937455303 2:122036175-122036197 GCCGCAGCTGATCTGACAGGAGG - Intergenic
937836732 2:126478729-126478751 GCCGCAGCTGATCTGACAGGAGG - Intergenic
942512520 2:176717593-176717615 GCCTCAGCGGATCCCACGGGGGG + Intergenic
948560091 2:238846780-238846802 GCCTCCGCTGCTCCTCCGGCCGG - Intergenic
948600745 2:239106311-239106333 GCCTCAGCGGAACCTCCTGGGGG + Intronic
948895873 2:240926590-240926612 GGCGCAGCACATCTTCCGGGGGG - Intronic
1168892848 20:1305981-1306003 GCGGCAGCTGATCCTGCGGATGG - Exonic
1172160916 20:32867330-32867352 GCCACAGCTGAGGCTCAGGGAGG - Intronic
1175605887 20:60311926-60311948 GCCCCAGCTGATCTTCAGGCAGG + Intergenic
1179822255 21:43943702-43943724 GCTGCAGCTGCACCCCCGGGAGG + Intronic
1179909232 21:44439102-44439124 GCTGAAGCGGATCCTCCGGCAGG + Exonic
1180900878 22:19371226-19371248 CCCGCAGCACATCCTCCTGGGGG + Intronic
1183345142 22:37303381-37303403 CCCGCAGCTGGTCCTCGGGCAGG - Exonic
1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG + Intronic
950437226 3:12987199-12987221 GCAGCAGCTGGTCCTGCTGGGGG + Intronic
951217632 3:20040230-20040252 GCGGCAGCTGCTCCCCCAGGAGG - Exonic
952342565 3:32458152-32458174 TCCGCAGCTGCTCCTCCCTGGGG - Intronic
952500285 3:33955487-33955509 GCCTCAGCTGATCCTATGGGGGG - Intergenic
954199085 3:49013604-49013626 GCCACACGTGATTCTCCGGGAGG + Exonic
957377078 3:79372049-79372071 GCCGCAGCTGATCTGACAGGAGG + Intronic
963733207 3:148991934-148991956 GCCGCAGCTGCTCCGCCCGCCGG - Intronic
968646685 4:1744601-1744623 GCTGCAGCTTCTCCTCCGCGTGG - Exonic
968795296 4:2699733-2699755 GCCGCCTCTGCTCCTCCTGGAGG - Exonic
969316732 4:6386163-6386185 GCCGCAGCAGATGCTGCAGGCGG + Intronic
971757619 4:30722193-30722215 GCCGCAGCTGATCGTGAAGGGGG + Exonic
978527763 4:109682709-109682731 GCTGCAGCTGTTCCTTCAGGTGG - Exonic
979837289 4:125387050-125387072 GCCGCAGCTGATCTGACAGGAGG + Intronic
982745714 4:159103072-159103094 GCCGGAGCCGCTCCTCAGGGAGG - Intergenic
985777186 5:1851004-1851026 GCAGAAGCGGAGCCTCCGGGCGG - Intergenic
988130727 5:27101395-27101417 GCCACAGCTGATCTGACGGGAGG - Intronic
990002465 5:50910281-50910303 GCCGCAGCTGATCTGACAGGAGG - Intergenic
993380034 5:87196244-87196266 GCCACAGCTGACCTTCAGGGTGG + Intergenic
994671471 5:102766456-102766478 GCCGCAGCTGATCTGACAGGAGG + Intronic
997297668 5:132777751-132777773 GCCCCACCTGATGCTCCGGCCGG + Intronic
998142921 5:139709959-139709981 GCCGCACCTGACCCACCGGATGG - Intergenic
999193902 5:149769185-149769207 GCCGCTGCTGATCTTACAGGAGG + Intronic
1000621235 5:163489183-163489205 GCCGCAGCTGATCTGCCAGGAGG + Intronic
1005260144 6:24050214-24050236 GCCGCAGCTGATCCGACAGGAGG - Intergenic
1007152633 6:39709435-39709457 GCCGCAGCTGATCTGACAGGAGG + Intronic
1007373601 6:41442365-41442387 GCCCCAGCTAACCCTCAGGGTGG - Intergenic
1008130248 6:47713019-47713041 GCTGCAGCTGATCCAACAGGAGG - Intronic
1008277997 6:49563190-49563212 GCCGCTGCTGATCTGACGGGGGG - Intergenic
1008283326 6:49621431-49621453 GCCTCAGCTGACCCTTCAGGAGG - Intronic
1008335693 6:50302100-50302122 GCCTCAGCTGATCTGCCAGGAGG - Intergenic
1009958306 6:70484696-70484718 GCCGCTGCTGATCCCACAGGAGG + Intronic
1015957606 6:138614765-138614787 GCCGCCGCTGATCCGACAGGAGG - Intronic
1016714005 6:147203766-147203788 GCTGCCGCTGCTGCTCCGGGCGG + Intergenic
1019263131 7:93476-93498 GCCGCCGCCGATCCGACGGGAGG - Intergenic
1019695342 7:2442803-2442825 GCCGCCGCTGATCTGACGGGAGG - Intergenic
1020120795 7:5502119-5502141 GCAGCAGCTGCTCCACCGGGAGG + Intronic
1023030305 7:36085004-36085026 GCCTCAGGTCATCCTCCTGGCGG + Exonic
1029489328 7:100861793-100861815 GCCCCAGCTGCTGCTCCTGGTGG + Exonic
1031051990 7:116953900-116953922 GGCGCAGCTCTTCCTCCGCGGGG - Exonic
1033109170 7:138559665-138559687 GACCCAGCTGATCCTACGGTGGG - Intronic
1034386892 7:150747707-150747729 GCTGCTGCTGATCCTCCTGGTGG - Intronic
1034790268 7:153961846-153961868 GCTGCAGCTGATCTGACGGGAGG + Intronic
1035015050 7:155758498-155758520 GCCGCTGCTGATCCGACAGGAGG + Intronic
1035227766 7:157443036-157443058 GCTGCAGCTGATCTGCCGGGAGG + Intergenic
1037810126 8:22081954-22081976 GCCCCAGCTCAGCCTCCGGCAGG + Exonic
1045324317 8:101106447-101106469 GCCGCTGCTGATCCGACAGGAGG + Intergenic
1045650788 8:104340116-104340138 CCCTCAGCTAATCCTCCTGGTGG + Intronic
1045758597 8:105575123-105575145 GCCTCTGCTGATATTCCGGGAGG + Intronic
1048587045 8:135783725-135783747 GCCGCTGCTGATCCGACAGGAGG - Intergenic
1049393054 8:142381871-142381893 GCCGCAGCTCATCCTGCGTGTGG + Intronic
1049647119 8:143740439-143740461 GGCGCTGCTGAGCCTCAGGGCGG - Intergenic
1060826086 9:126688853-126688875 GCCCCATCTGATCCTCAAGGGGG - Intronic
1061505243 9:131028135-131028157 GCCGCAGCTGATCTGACAGGAGG - Intronic
1061543281 9:131289741-131289763 GCACCAGCAGAGCCTCCGGGAGG - Exonic
1062461605 9:136664728-136664750 GCAGGAGCTGCTCCTCCGGGTGG - Exonic
1203774673 EBV:66077-66099 GCTGCCGCAGAGCCTCCGGGAGG - Intergenic
1190059336 X:47200914-47200936 CTCGCAGCTGGTCCTCCAGGGGG - Exonic
1190304489 X:49074265-49074287 GCCGCAGGGGCTGCTCCGGGCGG + Intronic