ID: 1132601088

View in Genome Browser
Species Human (GRCh38)
Location 16:773315-773337
Sequence TGGACCCCACACACCCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 235}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132601088_1132601092 -10 Left 1132601088 16:773315-773337 CCCTGGGGGGTGTGTGGGGTCCA 0: 1
1: 0
2: 0
3: 22
4: 235
Right 1132601092 16:773328-773350 GTGGGGTCCAGGCTGGTAACCGG 0: 1
1: 0
2: 4
3: 19
4: 248
1132601088_1132601093 -9 Left 1132601088 16:773315-773337 CCCTGGGGGGTGTGTGGGGTCCA 0: 1
1: 0
2: 0
3: 22
4: 235
Right 1132601093 16:773329-773351 TGGGGTCCAGGCTGGTAACCGGG 0: 1
1: 1
2: 1
3: 23
4: 256
1132601088_1132601096 -3 Left 1132601088 16:773315-773337 CCCTGGGGGGTGTGTGGGGTCCA 0: 1
1: 0
2: 0
3: 22
4: 235
Right 1132601096 16:773335-773357 CCAGGCTGGTAACCGGGGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 191
1132601088_1132601094 -8 Left 1132601088 16:773315-773337 CCCTGGGGGGTGTGTGGGGTCCA 0: 1
1: 0
2: 0
3: 22
4: 235
Right 1132601094 16:773330-773352 GGGGTCCAGGCTGGTAACCGGGG 0: 1
1: 0
2: 2
3: 18
4: 167
1132601088_1132601102 21 Left 1132601088 16:773315-773337 CCCTGGGGGGTGTGTGGGGTCCA 0: 1
1: 0
2: 0
3: 22
4: 235
Right 1132601102 16:773359-773381 CCAACCACCACTGCTGGCTCTGG 0: 1
1: 0
2: 2
3: 19
4: 349
1132601088_1132601103 22 Left 1132601088 16:773315-773337 CCCTGGGGGGTGTGTGGGGTCCA 0: 1
1: 0
2: 0
3: 22
4: 235
Right 1132601103 16:773360-773382 CAACCACCACTGCTGGCTCTGGG 0: 1
1: 0
2: 3
3: 22
4: 278
1132601088_1132601100 15 Left 1132601088 16:773315-773337 CCCTGGGGGGTGTGTGGGGTCCA 0: 1
1: 0
2: 0
3: 22
4: 235
Right 1132601100 16:773353-773375 CCTGGGCCAACCACCACTGCTGG 0: 1
1: 0
2: 1
3: 31
4: 243
1132601088_1132601097 -2 Left 1132601088 16:773315-773337 CCCTGGGGGGTGTGTGGGGTCCA 0: 1
1: 0
2: 0
3: 22
4: 235
Right 1132601097 16:773336-773358 CAGGCTGGTAACCGGGGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132601088 Original CRISPR TGGACCCCACACACCCCCCA GGG (reversed) Intronic
900189333 1:1346612-1346634 TGGACCCCACTCCCCACGCACGG - Intronic
900241905 1:1621238-1621260 AGGAGCCCACCCACCACCCAGGG - Intronic
900559495 1:3296652-3296674 TGGTCCACACACGACCCCCATGG - Intronic
903013257 1:20345054-20345076 TGGTCCCCACCCACCAGCCAGGG + Intronic
905145798 1:35886012-35886034 TGAGGCCCACACACCTCCCAAGG - Intronic
905492220 1:38353509-38353531 TGAACCCCAAACACACCACAAGG + Intergenic
915113268 1:153578400-153578422 GGGGCCCCACACACCCACCTGGG + Intergenic
919739304 1:200972657-200972679 TGTCCCCGACACAGCCCCCAGGG - Intronic
920052611 1:203172787-203172809 TGGACCCAGCACCCACCCCAGGG - Intronic
922573037 1:226644952-226644974 TGGGTCCCACACAGCCCCCTTGG + Intronic
922725694 1:227922084-227922106 GGGACCCCACACCCCCACCCAGG + Intronic
922933628 1:229408266-229408288 GGGACCCCACCCACCCCTCCAGG + Intergenic
923148006 1:231211205-231211227 TGGCCACCACACCCCTCCCAAGG + Intronic
1062769440 10:87538-87560 AGGAACCCACACACCCTCAACGG + Intergenic
1063217528 10:3938025-3938047 GGGTCGCCACAAACCCCCCAGGG + Intergenic
1065327225 10:24559901-24559923 TGCACCCCCCACCACCCCCAGGG + Intergenic
1067278672 10:44855248-44855270 TGGACCGCAAACAGCCCCCTGGG + Intergenic
1067416311 10:46106118-46106140 TGGCCCCCTCCCACCCTCCAGGG + Intergenic
1067717884 10:48703877-48703899 TGCACCCCACCCACCCTGCAGGG - Intronic
1069900116 10:71702215-71702237 TGGACCCCTCTCGCCCCTCACGG + Intronic
1069904258 10:71723229-71723251 TGGAGAACAAACACCCCCCAGGG - Intronic
1070399496 10:76040768-76040790 TGCCCCCCACACACCCCAAAAGG - Intronic
1073450432 10:103605983-103606005 TGGTCCCCACTCAGTCCCCAGGG + Intronic
1074940816 10:118234612-118234634 TGGAGTCCTCCCACCCCCCAAGG - Intergenic
1075765329 10:124888211-124888233 AGGACCCCACTCAACCCCCCAGG - Intergenic
1075789666 10:125074794-125074816 TGGACCCCACACATCACTCAGGG + Intronic
1076135766 10:128045052-128045074 TGGCCTCCCCACACCACCCAGGG + Intronic
1076399141 10:130167957-130167979 TGGAGACCACACAGCCTCCATGG - Intronic
1076404554 10:130203189-130203211 TGGTGCCCACACAGCCCGCACGG + Intergenic
1077106385 11:844227-844249 AGGCCCCCACCCACTCCCCAGGG - Intronic
1077219525 11:1409527-1409549 CGGACGCCACACAGCCTCCAAGG - Intronic
1078848608 11:15143633-15143655 TGTTCCCCACACAACCACCAGGG - Intronic
1083171564 11:60926584-60926606 TGGTCCCCACCCCACCCCCAGGG + Intronic
1083773059 11:64878945-64878967 TGGCCCCCCCACACCCCCGCGGG + Intronic
1084041049 11:66542918-66542940 TGGACCCCACCTACAGCCCAGGG - Intronic
1084592434 11:70098413-70098435 TGCACGGCACACACACCCCATGG + Intronic
1085050407 11:73377238-73377260 TTGACCCCACACGCACACCATGG - Intronic
1085529755 11:77184303-77184325 TGCACCCCACACCCCACCCCAGG - Intronic
1086231448 11:84575319-84575341 TGCCTCCCCCACACCCCCCATGG + Intronic
1089063834 11:115646992-115647014 TGGCCCCCACCCACAGCCCAAGG - Intergenic
1091291971 11:134445664-134445686 GGGACCCCACAACCCCCCGATGG - Intergenic
1096077794 12:48815733-48815755 ACGACCCCACACCCCCCCCACGG - Intronic
1096137783 12:49216974-49216996 TAGATCCCACATACCTCCCATGG + Intronic
1100865663 12:98854064-98854086 TGGTCCACACACAGCCCCAAAGG + Intronic
1102212735 12:111138862-111138884 TTCACCCCACACAGCTCCCAGGG + Intronic
1103947644 12:124535422-124535444 CAGACCCCACACGCCCCCCGAGG + Intronic
1103997991 12:124842417-124842439 TCCTCCCCACACACCTCCCAGGG + Intronic
1104142968 12:126006132-126006154 TGAACACCAGACACCCCTCAGGG - Intergenic
1105302983 13:19151965-19151987 TGAGCCCCAAACACGCCCCAGGG + Intergenic
1105883729 13:24624927-24624949 TGGACCCCACTCCTTCCCCAAGG - Intergenic
1107660830 13:42637740-42637762 TGGTCCCCACTCTCCCACCATGG + Intergenic
1107660841 13:42637778-42637800 TGGATCCCAAACTCCCCACATGG + Intergenic
1107891386 13:44917770-44917792 TGAACCTCACACCCGCCCCAGGG + Intergenic
1109559253 13:64025369-64025391 TGGACCCACCACACTACCCAAGG + Intergenic
1119531047 14:75361616-75361638 GGGACCCCAGACACTTCCCAGGG - Intergenic
1119666021 14:76485718-76485740 TGGAGCCAACACAGGCCCCAGGG - Intronic
1122455739 14:101849330-101849352 TGGAGCCCGAACACCACCCATGG - Intronic
1122546079 14:102523653-102523675 GGGACCACACACAGGCCCCAAGG - Intergenic
1122674897 14:103404365-103404387 TGGCCCCCACACACACTCAAAGG - Intronic
1122816299 14:104315868-104315890 CTGACACCACACACACCCCATGG + Intergenic
1122980949 14:105192233-105192255 CTGACCCCACACACCCCCGCAGG + Intergenic
1122980961 14:105192272-105192294 CTGACCCCACACACCCCCGCAGG + Intergenic
1122980973 14:105192311-105192333 CTGACCCCACACACCCCCGCAGG + Intergenic
1122980985 14:105192350-105192372 CTGACCCCACACACCCCCACAGG + Intergenic
1122981007 14:105192428-105192450 CTGACCCCACACACCCCCGCAGG + Intergenic
1122981019 14:105192467-105192489 CTGACCCCACACACCCCCGCAGG + Intergenic
1122981031 14:105192506-105192528 CTGACCCCACACACCCCCGCAGG + Intergenic
1122981053 14:105192584-105192606 CTGACCCCACACACCCCCGCAGG + Intergenic
1122981064 14:105192623-105192645 CTGACCCCACACACCCCCGCAGG + Intergenic
1122981076 14:105192662-105192684 CTGACCCCACACACCCCCGCAGG + Intergenic
1122981089 14:105192701-105192723 CTGACCCCACACACCCCCGCAGG + Intergenic
1122981101 14:105192740-105192762 CTGACCCCACACACCCCCGCAGG + Intergenic
1122981113 14:105192779-105192801 CTGACCCCACACACCCCCGCAGG + Intergenic
1123089859 14:105737708-105737730 CAGACCCCACACACCAGCCATGG - Intergenic
1126113030 15:45186801-45186823 TGGACCCCACGAAGCCCCCTTGG + Intronic
1129263458 15:74381758-74381780 TGGACACCACCCACCCTCCTGGG - Intergenic
1130015106 15:80180270-80180292 TGCTCCCCACACAGCCCCAAGGG + Intronic
1130388531 15:83434421-83434443 TGGCCCTCACACATCCCCCCAGG - Intergenic
1132284119 15:100647795-100647817 TGGAGCCCGGACACCCACCACGG - Intronic
1132346955 15:101114299-101114321 TGTCCCCCACTCTCCCCCCAGGG + Intergenic
1132468528 16:89138-89160 TGTGCCCCACAAACACCCCAAGG + Intronic
1132601088 16:773315-773337 TGGACCCCACACACCCCCCAGGG - Intronic
1133018255 16:2954881-2954903 GGCACCCCACACAGCCCCCGAGG - Intergenic
1134031457 16:10995643-10995665 TGGATCCCACACTACCCCCATGG + Intronic
1134435396 16:14252002-14252024 TGGACCTAACACACCCAACAAGG + Exonic
1135592870 16:23717130-23717152 TGGACCCCACAAACCCACATGGG - Intergenic
1137675805 16:50303405-50303427 AGGGCCCCACAAACACCCCATGG - Intronic
1137825589 16:51491831-51491853 ATGCCCCCACACACCCCTCAAGG + Intergenic
1138265043 16:55654538-55654560 TGGAGCTCACATACCACCCAAGG + Intergenic
1138786725 16:59855116-59855138 TGGACCCCCCACACCAACCTAGG - Intergenic
1139446460 16:67001290-67001312 TGAACCCCACACGCCCAGCACGG + Exonic
1139691629 16:68645464-68645486 CGGACCCCGCCCGCCCCCCAGGG - Intronic
1142308632 16:89299567-89299589 CAGACCCCACGCACCCCACACGG - Intronic
1142383312 16:89746315-89746337 TGGACCCCACTCAGACCCCACGG - Intronic
1142520372 17:500408-500430 GGGTACCCACACACCCACCATGG + Intergenic
1144768434 17:17745796-17745818 TGGACTCCACACAAGCCCCCCGG - Intronic
1147139167 17:38451968-38451990 TGGACCCCCCACCCCCACCCTGG - Intronic
1148617046 17:49008706-49008728 AGGACCCCACACACACTCCCAGG - Intronic
1148804708 17:50258319-50258341 TGGCCCTCACAGACACCCCAAGG + Intergenic
1148870866 17:50658217-50658239 TGGAGCCCCCGCACCCTCCATGG - Intronic
1151715142 17:75827477-75827499 TGGCCACCACCCTCCCCCCAGGG + Exonic
1151952485 17:77362910-77362932 TGGGCCCCTCACACCCTCCCTGG - Intronic
1152146621 17:78572442-78572464 TGCACCCCACACCCCCCGCTGGG - Intronic
1152241080 17:79161495-79161517 GGGCCTCCACACACCCCCGAGGG - Intronic
1152263164 17:79278155-79278177 TGGACCCCCGAGGCCCCCCATGG - Intronic
1152579529 17:81159948-81159970 GGGACCCCACACCCTCCCCGAGG + Intronic
1152912463 17:83013219-83013241 AGGACCTGACACACCCCCAAAGG + Intronic
1153791475 18:8583516-8583538 TGGTCCCTGCACACCCCCGATGG - Intergenic
1154068914 18:11134975-11134997 TTGACCCCCCACCCCACCCACGG + Intronic
1156059931 18:33062709-33062731 TGGGTCCCACACATTCCCCAAGG + Intronic
1160678935 19:404464-404486 TGCCCCCCCCACACCCCTCAGGG - Intergenic
1160686018 19:436897-436919 CGGACCCCACACATCCCTTAGGG - Intronic
1160968496 19:1757129-1757151 GGGAGCCCACCCCCCCCCCATGG - Intronic
1160969808 19:1762556-1762578 TGGGATCCACACACCCGCCAAGG - Intronic
1164669198 19:30063297-30063319 TGCTCCCCACTCTCCCCCCAGGG + Intergenic
1164737802 19:30554647-30554669 TGGTCGCCACAGACACCCCATGG - Intronic
1164835659 19:31353630-31353652 TGATCCCCAAACATCCCCCAGGG + Intergenic
1165111380 19:33504396-33504418 TGGACCCCAGACTCCCCACAGGG - Intronic
1165894003 19:39130769-39130791 TGGAATCCACACACCCCACCTGG - Intronic
1166043364 19:40215968-40215990 CCGACCCCACACACCCTCCCTGG + Intergenic
1166069561 19:40379205-40379227 TGGAGCCCCCATTCCCCCCAGGG + Intronic
1166328830 19:42067187-42067209 CGGACCCCACTCAGTCCCCATGG + Intronic
1166355352 19:42224219-42224241 TGAAGCCTACACACACCCCACGG - Exonic
1167622578 19:50567871-50567893 TGCCCCCCACCCACCCCCCGCGG + Intronic
1167664633 19:50817065-50817087 ATAATCCCACACACCCCCCAAGG - Intergenic
925341257 2:3138980-3139002 TGGACCCCAAACATCCCATAGGG + Intergenic
925839846 2:7980706-7980728 TGTAACACACACACCCCCCCTGG + Intergenic
926421283 2:12702188-12702210 TGCACCCCAGACCACCCCCAAGG + Intergenic
927875643 2:26653615-26653637 TGCACCCCAGCCACACCCCAGGG + Intergenic
929933711 2:46277861-46277883 TGGCCACCACTCAGCCCCCAAGG + Intergenic
931706703 2:64952204-64952226 TGGGTCCCACAGACCCCACAAGG - Intergenic
934504189 2:94878774-94878796 TCGCCCCCACCCACCTCCCATGG - Intergenic
934937573 2:98476554-98476576 TCCTCCCCACACACACCCCAGGG - Intronic
935661843 2:105473416-105473438 TGCTCCCCACACACCACCCCAGG - Intergenic
940893573 2:159058506-159058528 TGAACTCCACAAATCCCCCATGG - Intronic
941529971 2:166655915-166655937 TGGACCCCACCCTCCACCCTTGG - Intergenic
945317260 2:208382953-208382975 CAGACCCCCCACATCCCCCAAGG - Intronic
945935673 2:215900572-215900594 TGGACTTCACAGAGCCCCCAGGG + Intergenic
947404131 2:229756992-229757014 TGGCTCCCACACAGCCGCCAGGG + Intergenic
947642736 2:231716062-231716084 TGGACTCCACACACCCTCACTGG + Intergenic
947739118 2:232476893-232476915 TGGAACCCACAGGGCCCCCAGGG + Intergenic
948992134 2:241560591-241560613 TGCACCCCACACACACTCCTGGG - Intronic
1171247590 20:23625004-23625026 TGCACCCCACCAACCCCCCGAGG - Intergenic
1172113113 20:32559118-32559140 TGGCCCCCAGGCATCCCCCACGG + Intronic
1173274392 20:41566753-41566775 GAGACACCACACACCACCCAGGG - Intronic
1173837586 20:46136008-46136030 TGGACCCCCCACCCTCCGCAGGG - Intergenic
1175544671 20:59770727-59770749 TGGTCCCCACCCTGCCCCCATGG + Intronic
1175746341 20:61459845-61459867 TTGAACCCACACACCACCCCAGG + Intronic
1175756896 20:61535792-61535814 GGGCCCCCACACTCTCCCCATGG - Intronic
1176037466 20:63046783-63046805 AGGACCCTAGACACCCCCCCAGG - Intergenic
1176108179 20:63399227-63399249 TGGACCCCACGCTCCCCTCTCGG - Intergenic
1176248129 20:64107045-64107067 AGGCCCCCACACACCCCACCAGG - Exonic
1176371640 21:6065939-6065961 TGGGCCCCACACACCTCTCATGG + Intergenic
1176388732 21:6152550-6152572 TGCACACCACACACACACCAGGG + Intergenic
1178512242 21:33215252-33215274 TGGTCCCCAAACTCACCCCAGGG - Intergenic
1179734740 21:43385698-43385720 TGCACACCACACACACACCAGGG - Intergenic
1179751879 21:43472600-43472622 TGGGCCCCACACACCTCTCATGG - Intergenic
1180137175 21:45869372-45869394 TGGACCCCACCCAGACCCCTCGG + Intronic
1182429534 22:30291675-30291697 TGGTCCTCACCCACCCACCAAGG - Intronic
1183509302 22:38225657-38225679 TGCACCACACACAGTCCCCATGG + Intronic
1185377769 22:50489961-50489983 GGGACCCCACTCACCCCCTTAGG + Exonic
951197082 3:19836333-19836355 TGAGTCCCACACACCCCCCATGG + Intergenic
952407418 3:33016830-33016852 TGAACCCCACAGATCCCCCAGGG - Exonic
952543759 3:34396331-34396353 TGGATCCCAAACACCCCCTATGG - Intergenic
952748381 3:36803342-36803364 TGGTCCCAGCACAGCCCCCATGG - Intergenic
952956956 3:38563445-38563467 TTGCCCCCACTCACCCCTCAAGG + Intronic
952958481 3:38575399-38575421 TGGACACCACACAGGCCCCAGGG - Exonic
953735335 3:45489433-45489455 TGGCCCCCACCCCCACCCCAGGG + Intronic
953931817 3:47009415-47009437 TGGGCCCCGCTCACCCCCCTGGG - Exonic
954751793 3:52818083-52818105 TGGACCCCAGACACCGCCAGGGG - Exonic
954798613 3:53174377-53174399 TCGACCCCACACAGCCTCCATGG - Intronic
958677075 3:97278799-97278821 TGGCCTGCACACACCCCTCATGG + Intronic
961522571 3:127475529-127475551 TGCACCCCACGCCCACCCCATGG + Intergenic
962677691 3:137768727-137768749 CTGCCCCCCCACACCCCCCAGGG - Intergenic
968505266 4:968433-968455 TGGGCCCGCCCCACCCCCCAGGG + Intronic
968758494 4:2428723-2428745 TGCACCCCGCACACCCGACAGGG - Intronic
969512521 4:7627466-7627488 AGGGCCCCATTCACCCCCCATGG - Intronic
970055382 4:11965411-11965433 TGCACCCCACACCCTCCCCATGG - Intergenic
972335635 4:38105164-38105186 AGCACCCCACACTCTCCCCATGG + Intronic
974818485 4:67036112-67036134 TGACCCCCACACAACCCACATGG - Intergenic
977482144 4:97592819-97592841 TGGAGACCCCACAACCCCCAAGG + Intronic
978232976 4:106423363-106423385 TGCAGCCCACTCACCTCCCAGGG - Intergenic
982098195 4:151942537-151942559 TGGGCCCCACACACTCTCAAGGG - Intergenic
983998378 4:174213245-174213267 TGCACCCCACCCACCCACCCCGG + Intergenic
985532141 5:440006-440028 TTGTCCCCACACCCTCCCCACGG - Intergenic
985698361 5:1355946-1355968 TGGAGCTCACACATCCCCCAAGG - Intergenic
985717388 5:1470293-1470315 CAGACCCCACTCAGCCCCCAGGG + Intronic
985745185 5:1642765-1642787 TGGCCCTCCCACAGCCCCCAGGG - Intergenic
985745205 5:1642834-1642856 TGGCCCTCCCACAGCCCCCAGGG - Intergenic
985817188 5:2135703-2135725 TGGGCTCCACACTCCCCACAAGG - Intergenic
985943898 5:3162166-3162188 CAGACGCCACACACACCCCAAGG + Intergenic
986438318 5:7757110-7757132 GAGACCCAACACATCCCCCAGGG + Intronic
988438797 5:31208374-31208396 TGGACCCCGGACATCCTCCAAGG + Intronic
990450117 5:55925652-55925674 TGCACCTCACACATCTCCCAGGG + Intergenic
991215504 5:64154382-64154404 TGGACCACACACACACTCAAGGG + Intergenic
997941965 5:138166062-138166084 TGGATCCCCCACAGCCTCCATGG + Exonic
998186112 5:139981340-139981362 TGTAGCCCACTCACCCCACATGG + Intronic
1001289763 5:170448485-170448507 TGCAGCCCACACTTCCCCCAGGG - Intronic
1001455229 5:171855100-171855122 TCGACCCCACACAAACCACACGG - Intergenic
1001678350 5:173536923-173536945 TGGACCTCTCACACTCCACAGGG + Intergenic
1003102835 6:3190378-3190400 TTGACCACACACCGCCCCCATGG - Intergenic
1003613176 6:7631207-7631229 TGGTCCCCAAACTCCCCACAGGG - Intergenic
1004346043 6:14850206-14850228 TGCTCCCCACCCACACCCCAAGG + Intergenic
1005574635 6:27179804-27179826 TTGACACCACACACCCCCGTTGG + Intergenic
1018024072 6:159790201-159790223 TGGTCCACACACACCCCACCTGG - Intronic
1018992967 6:168688027-168688049 GGGACCCCCCACCCCCCCCATGG + Intergenic
1019175407 6:170156984-170157006 TGGGCCCTGCAGACCCCCCAAGG + Intergenic
1019318821 7:405688-405710 CTGAACCCCCACACCCCCCATGG + Intergenic
1020280502 7:6647769-6647791 TAGCCCACACACACCACCCATGG - Intronic
1021318564 7:19182413-19182435 GGCACCCCACATACCACCCAGGG + Intergenic
1022287324 7:28966235-28966257 TGGACCCCACATACACCACATGG - Intergenic
1022514253 7:30965390-30965412 TGGACCCCACCCACCCCTGAGGG - Intronic
1023028912 7:36076291-36076313 TGCGCACCACACACCCCCCTGGG - Intergenic
1023733860 7:43217975-43217997 TGGACCCCACAGGCCTCCCTGGG - Intronic
1023865737 7:44237528-44237550 TGCACCCCACACTGCGCCCAAGG - Intronic
1023983271 7:45081698-45081720 AGGGCCCCACACCCCACCCATGG - Intronic
1024579803 7:50792902-50792924 TGGACTCCACACCTCCCCCCAGG + Intronic
1025026900 7:55523824-55523846 TTCACCCCACCCACCCTCCACGG - Intronic
1026275350 7:68871466-68871488 TGGACTCCACCCACCGTCCAAGG - Intergenic
1034012748 7:147547756-147547778 TGCACCCCACACACCCCAACAGG + Intronic
1034224997 7:149475062-149475084 TGGACCCCAGCCAGGCCCCAAGG - Exonic
1034472317 7:151261889-151261911 TAGACCCCACACTTCCCGCAGGG - Intronic
1038692516 8:29775899-29775921 TGGAACCCACTCACTCCCAATGG + Intergenic
1044125940 8:88457805-88457827 TGGGTCCCACACACACCCCATGG + Intergenic
1044137826 8:88609459-88609481 GGCATCCCACACAACCCCCAAGG - Intergenic
1046674300 8:117091587-117091609 TGGACCCCACAGAGCCACAATGG + Intronic
1047338255 8:123956226-123956248 TGGGCCCAAGACAACCCCCAAGG + Intronic
1048767801 8:137863119-137863141 TATAACCCACCCACCCCCCACGG + Intergenic
1049326823 8:142025903-142025925 TGGGCCTCACACACCCCAGAGGG + Intergenic
1049337220 8:142092780-142092802 TTCACACCAGACACCCCCCAGGG - Intergenic
1049575357 8:143387267-143387289 TGGTCCCCTCACCCCCACCATGG + Intergenic
1049828398 8:144685088-144685110 GGGTCCCCTCACACCCCCCTCGG + Intergenic
1049830537 8:144698885-144698907 TGGACCCCCCAACCCCCCCAAGG - Intergenic
1055208395 9:73761551-73761573 TGGGTCCCACACACTCCCAATGG + Intergenic
1056127846 9:83554553-83554575 TGGGTCCCACACACCCTCCATGG - Intergenic
1056751343 9:89353567-89353589 TGGACCCCAGAATCCCCCAAAGG - Intronic
1057719511 9:97520697-97520719 TGCACCACATACACACCCCAAGG - Intronic
1059367383 9:113797146-113797168 TGGACCCCGCTCCCCCACCAGGG - Intergenic
1060789476 9:126476303-126476325 TGGGCCCCACCAACTCCCCAGGG + Intronic
1061325785 9:129863320-129863342 CAGTCCCCACACACCGCCCAAGG - Intronic
1061378121 9:130238125-130238147 TGCAGCGCACACACCTCCCAGGG - Intergenic
1061624702 9:131834898-131834920 TGGGCCCTCCACACCCCCCGGGG + Intergenic
1062198390 9:135287242-135287264 TGGACCCCCCCCACCACCCAAGG + Intergenic
1062357277 9:136170844-136170866 AGGACCCCACACTGGCCCCAGGG + Intergenic
1062359161 9:136179231-136179253 TGTACCCCAGACACCCCCCGGGG + Intergenic
1062461019 9:136662634-136662656 TCCACCCCACACTCTCCCCAGGG + Intronic
1062554299 9:137107051-137107073 CGGCCCCCACACACCGCCCGAGG - Intronic
1192200395 X:69062888-69062910 TAGACCCCACTCACTCCCTAGGG + Intergenic
1192213348 X:69141566-69141588 TGGATTCCATACACCCCCGATGG + Intergenic
1192784335 X:74322413-74322435 TAGACCCCACTCTCCCACCATGG + Intergenic
1192804300 X:74495895-74495917 TAGACCCCACTCTCCCACCATGG - Intronic
1195696961 X:107674440-107674462 TGGACCCCTGACACCCTCCTGGG + Intergenic
1196785962 X:119421849-119421871 TGTCCCCCACCCAACCCCCAAGG + Intronic
1196892128 X:120301569-120301591 TAGACTCCCCCCACCCCCCACGG + Intronic
1197607991 X:128606973-128606995 TGGGCCCCACCTACCACCCAAGG + Intergenic
1198205523 X:134460787-134460809 TGGTCCCCACACGCCCTCCCAGG - Intronic
1199428786 X:147735084-147735106 TGGACCCCACAAAACCCCTGAGG + Intergenic
1200040489 X:153362528-153362550 TGGGCACCACACTCACCCCAAGG + Intergenic