ID: 1132602983

View in Genome Browser
Species Human (GRCh38)
Location 16:782155-782177
Sequence CTAGGTTCACCCAGGGCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 155}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132602968_1132602983 15 Left 1132602968 16:782117-782139 CCTCCCACCCCCTGGGGTGTGGA 0: 1
1: 0
2: 4
3: 37
4: 361
Right 1132602983 16:782155-782177 CTAGGTTCACCCAGGGCAGCGGG 0: 1
1: 0
2: 1
3: 13
4: 155
1132602978_1132602983 5 Left 1132602978 16:782127-782149 CCTGGGGTGTGGAGAGGGAGGGT 0: 1
1: 0
2: 9
3: 65
4: 619
Right 1132602983 16:782155-782177 CTAGGTTCACCCAGGGCAGCGGG 0: 1
1: 0
2: 1
3: 13
4: 155
1132602969_1132602983 12 Left 1132602969 16:782120-782142 CCCACCCCCTGGGGTGTGGAGAG 0: 1
1: 0
2: 4
3: 34
4: 309
Right 1132602983 16:782155-782177 CTAGGTTCACCCAGGGCAGCGGG 0: 1
1: 0
2: 1
3: 13
4: 155
1132602962_1132602983 24 Left 1132602962 16:782108-782130 CCCGCACTGCCTCCCACCCCCTG 0: 1
1: 0
2: 9
3: 116
4: 987
Right 1132602983 16:782155-782177 CTAGGTTCACCCAGGGCAGCGGG 0: 1
1: 0
2: 1
3: 13
4: 155
1132602970_1132602983 11 Left 1132602970 16:782121-782143 CCACCCCCTGGGGTGTGGAGAGG 0: 1
1: 0
2: 3
3: 75
4: 403
Right 1132602983 16:782155-782177 CTAGGTTCACCCAGGGCAGCGGG 0: 1
1: 0
2: 1
3: 13
4: 155
1132602976_1132602983 6 Left 1132602976 16:782126-782148 CCCTGGGGTGTGGAGAGGGAGGG 0: 1
1: 2
2: 12
3: 100
4: 835
Right 1132602983 16:782155-782177 CTAGGTTCACCCAGGGCAGCGGG 0: 1
1: 0
2: 1
3: 13
4: 155
1132602961_1132602983 25 Left 1132602961 16:782107-782129 CCCCGCACTGCCTCCCACCCCCT 0: 1
1: 0
2: 13
3: 131
4: 1246
Right 1132602983 16:782155-782177 CTAGGTTCACCCAGGGCAGCGGG 0: 1
1: 0
2: 1
3: 13
4: 155
1132602974_1132602983 7 Left 1132602974 16:782125-782147 CCCCTGGGGTGTGGAGAGGGAGG 0: 1
1: 0
2: 10
3: 88
4: 570
Right 1132602983 16:782155-782177 CTAGGTTCACCCAGGGCAGCGGG 0: 1
1: 0
2: 1
3: 13
4: 155
1132602963_1132602983 23 Left 1132602963 16:782109-782131 CCGCACTGCCTCCCACCCCCTGG 0: 1
1: 0
2: 12
3: 120
4: 1014
Right 1132602983 16:782155-782177 CTAGGTTCACCCAGGGCAGCGGG 0: 1
1: 0
2: 1
3: 13
4: 155
1132602973_1132602983 8 Left 1132602973 16:782124-782146 CCCCCTGGGGTGTGGAGAGGGAG 0: 1
1: 1
2: 5
3: 70
4: 441
Right 1132602983 16:782155-782177 CTAGGTTCACCCAGGGCAGCGGG 0: 1
1: 0
2: 1
3: 13
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132602983 Original CRISPR CTAGGTTCACCCAGGGCAGC GGG Intronic
905207087 1:36349087-36349109 CGAGATTCAGCCCGGGCAGCAGG - Intronic
905339952 1:37271654-37271676 TTGGGTTGACCCAGGGCAACTGG + Intergenic
906606329 1:47174908-47174930 CTGGGCTCACCCAGCCCAGCTGG + Intergenic
907643079 1:56212245-56212267 CTAGGTTCAGCCAGGTGACCTGG - Intergenic
910560292 1:88582556-88582578 CTAGGTCCACCCAGGGCCTGGGG + Intergenic
913674697 1:121129960-121129982 CTGGGGTCATCCAGGGCAGGAGG - Intergenic
914026538 1:143917590-143917612 CTGGGGTCATCCAGGGCAGGAGG - Intergenic
914664918 1:149825021-149825043 CTGGGGTCATCCAGGGCAGGAGG - Intergenic
914670847 1:149868799-149868821 CTGGGGTCATCCAGGGCAGGAGG + Intronic
915996940 1:160573022-160573044 CTAGGATCATCCAGGGAAACAGG - Intronic
917833018 1:178913843-178913865 CTTGGTCCACCCAGTGCAGCCGG - Intronic
920080207 1:203367534-203367556 CCAGGACCACCCAGGGCAACAGG + Intergenic
1063461484 10:6217386-6217408 CTAGCTCCATCCAGGGCAGTGGG + Intronic
1064336751 10:14450287-14450309 CTAGGCTGACAGAGGGCAGCTGG + Intronic
1065240831 10:23702456-23702478 ATAGGTTTCCCCAAGGCAGCTGG - Intronic
1066345307 10:34579420-34579442 CTAAGTTCATCTAGGGCACCTGG - Intronic
1069895992 10:71680343-71680365 TTAGGTGCCCCCAGGGCAGAAGG + Intronic
1069906589 10:71735851-71735873 CTATGCTCCCCAAGGGCAGCCGG + Intronic
1070695967 10:78563337-78563359 CTAAGGTCACACAGGGCAGGGGG - Intergenic
1071849019 10:89549866-89549888 CTAGGAAGACCCAGGGTAGCTGG + Intronic
1072730562 10:97843214-97843236 CTAGGTTGTCCCAAGGCAGCTGG + Intergenic
1074164782 10:110865534-110865556 CTATGTGCACTCAGGGCAGCTGG + Intergenic
1074291043 10:112138209-112138231 CTAGGTGCTCCCAAGACAGCAGG + Intergenic
1075383693 10:122039354-122039376 GTAGGTTCTCAGAGGGCAGCTGG + Intronic
1076181919 10:128415955-128415977 CTCGGATCACCAAGGACAGCTGG + Intergenic
1077300449 11:1844228-1844250 GTAGGGACAGCCAGGGCAGCCGG + Intergenic
1078084056 11:8223274-8223296 CTAGATTTACTCAAGGCAGCAGG - Intergenic
1078845456 11:15115285-15115307 CACAGTGCACCCAGGGCAGCAGG - Intronic
1079246060 11:18753174-18753196 CAAGGTCCCCCCAGGACAGCAGG + Intronic
1079369859 11:19842171-19842193 CTGCATTCACCCAGGGAAGCTGG + Intronic
1080641234 11:34159717-34159739 CGGGGTGGACCCAGGGCAGCAGG - Intronic
1083331573 11:61900774-61900796 CCAGCTTCATCCAGTGCAGCAGG + Intronic
1083332904 11:61907260-61907282 CTAGGTTCACCCATTCCTGCTGG + Intronic
1084117418 11:67050294-67050316 CTGAGCTCACCCAGGCCAGCAGG + Exonic
1085013547 11:73157794-73157816 CTAACTTCACCAAGGTCAGCTGG + Intergenic
1087890430 11:103531679-103531701 CTGGGCTCACCCAGGGCATCAGG + Intergenic
1089299482 11:117489977-117489999 TTAGGCTCACTCAGGGGAGCGGG + Intronic
1090449779 11:126796328-126796350 CTGGGCTGACCCAGGGCATCAGG + Intronic
1091832158 12:3557521-3557543 CTTGGCTCACCCAGCGGAGCTGG + Intronic
1096805784 12:54140441-54140463 ATAGGTACACCTAGGGCACCGGG + Intergenic
1101823294 12:108200851-108200873 CTAGGCTTCCCCAGGGCAGAAGG - Intronic
1102206354 12:111093598-111093620 TTCAGCTCACCCAGGGCAGCAGG + Intronic
1102585874 12:113922556-113922578 AGAGGTGCACCCAGGCCAGCAGG - Intronic
1103165307 12:118765277-118765299 CTAGGATCACCCAGGCCAAAGGG - Intergenic
1103700592 12:122847026-122847048 CCAGCCTCAGCCAGGGCAGCTGG - Intronic
1104820933 12:131677264-131677286 CCGGGTGCACCCAGGGCTGCCGG + Intergenic
1104960279 12:132485302-132485324 CCCTGTTCACCCAGGGGAGCAGG - Intergenic
1106592552 13:31110289-31110311 CTCGCTTCACTCAGGGCAGGGGG - Intergenic
1107733012 13:43367517-43367539 CAAGGATCACCCAGGATAGCCGG + Intronic
1111292138 13:86184716-86184738 CTGTCTTCACCCAGGGCTGCAGG - Intergenic
1111800598 13:92975273-92975295 GTAGCTCCACCCAGGACAGCAGG + Intergenic
1111882225 13:93971920-93971942 CTAGGCTCACGCTGGGCAGGAGG + Intronic
1116380062 14:44256102-44256124 CTAGGTTCACCAATGGCAAATGG - Intergenic
1116580644 14:46637118-46637140 CTAGGTTCCTCAAGTGCAGCAGG - Intergenic
1117267389 14:54104017-54104039 CCAGGATCACCCTGGACAGCTGG + Intergenic
1118326929 14:64787557-64787579 CTTGGTTCCTCTAGGGCAGCTGG - Intronic
1118841639 14:69517700-69517722 CTCGGTTCTTTCAGGGCAGCAGG + Intronic
1122821806 14:104350505-104350527 CTATCTTCACCCTGGGCAGCCGG + Intergenic
1124381684 15:29172806-29172828 GGAGGTTCAGCCAGGGCAGGTGG - Intronic
1124873182 15:33564166-33564188 ATAGGTTCAGCCAGGGCTTCTGG + Intronic
1125732344 15:41900288-41900310 TAAGGCTCACCCAGAGCAGCTGG - Exonic
1126274092 15:46855882-46855904 CTGGGTTTACCCAGGACTGCAGG + Intergenic
1126309696 15:47301550-47301572 CAGGCTTCCCCCAGGGCAGCTGG - Intronic
1128783565 15:70378731-70378753 CTGGGTTCACCCATGTAAGCTGG - Intergenic
1130407480 15:83614617-83614639 CCGGGTTCACCCTGGGCAGTGGG + Intronic
1131034740 15:89214872-89214894 CTAGGATGTGCCAGGGCAGCTGG - Intronic
1131511869 15:93053653-93053675 CTGGGTTCACACAAGGCTGCTGG - Intronic
1132497922 16:272639-272661 TTACCTGCACCCAGGGCAGCAGG + Intronic
1132602983 16:782155-782177 CTAGGTTCACCCAGGGCAGCGGG + Intronic
1132647394 16:1005239-1005261 CCAGGTTCACCTAGCCCAGCTGG + Intergenic
1132883506 16:2172525-2172547 CCAGGTTCATCCTGAGCAGCGGG - Exonic
1138542337 16:57695978-57696000 CTGGCTTCACCCAGGGAAGTGGG + Intronic
1139948890 16:70659801-70659823 CTGGGCCCACCCAGGCCAGCTGG + Intronic
1140785422 16:78336659-78336681 CTATGTTCCCCCATGGCAACAGG - Intronic
1143672348 17:8405460-8405482 CTATGTGCACTCAGGGCAACAGG - Intergenic
1146852234 17:36232450-36232472 TTAGGTTCACTCAGGGAAGTGGG - Intronic
1146868142 17:36356321-36356343 TTAGGTTCACTCAGGGAAGTGGG - Intronic
1147071016 17:37956939-37956961 TTAGGTTCACTCAGGGAAGTGGG - Intergenic
1147082542 17:38036465-38036487 TTAGGTTCACTCAGGGAAGTGGG - Intronic
1147098486 17:38160433-38160455 TTAGGTTCACTCAGGGAAGTGGG - Intergenic
1148161840 17:45454556-45454578 CTTGGTTCATCCCTGGCAGCAGG - Intronic
1150280732 17:63928519-63928541 CTAGCTGGACCCAGAGCAGCTGG - Intergenic
1151558779 17:74860115-74860137 CTGGGTTCGCCCAGGGCCCCCGG - Intronic
1157198918 18:45642601-45642623 CTGGGTTCCCCCATGGGAGCTGG - Intronic
1157528837 18:48405626-48405648 CTAAATTCCCCTAGGGCAGCTGG + Intronic
1163349539 19:16767271-16767293 CTGGGTTCATGCATGGCAGCAGG + Intronic
1166358565 19:42242186-42242208 CCAGCTTCACCCCGGGCGGCGGG + Exonic
1167300270 19:48673858-48673880 CTGGGGCCACCCAGGGCAGCAGG - Intergenic
1168081202 19:54011952-54011974 CCAGGCTCACCAAGAGCAGCAGG - Exonic
1168366428 19:55792023-55792045 CTATGTCCACCCGGGGCAGGGGG + Intronic
925210783 2:2043741-2043763 CTGGGTTCCTCCAGGGTAGCAGG - Intronic
926247776 2:11133422-11133444 ATAGGGCCACCCCGGGCAGCTGG - Exonic
926677821 2:15641063-15641085 CTAGCTTAACCCAGGACAACTGG + Intergenic
927869804 2:26616284-26616306 CTTCGCTCACCCAGGGCTGCAGG - Intronic
928951314 2:36815568-36815590 CTGGATGGACCCAGGGCAGCAGG - Intergenic
930952193 2:57156301-57156323 CTGGGCTTGCCCAGGGCAGCGGG + Intergenic
932465982 2:71924611-71924633 ATAGGTACATGCAGGGCAGCAGG + Intergenic
932943493 2:76197885-76197907 CTAGGTTCACATAGGACAGCGGG + Intergenic
936986439 2:118315366-118315388 CTGAGTTCAGCCAGGGCAACAGG - Intergenic
937125992 2:119475340-119475362 GTGGGCTCGCCCAGGGCAGCAGG + Intronic
938412653 2:131077658-131077680 CTAGGTTCTCCCTGGACAGAAGG + Intronic
942715414 2:178886146-178886168 CCTGGTTCTCCCAGGTCAGCAGG - Intronic
944826903 2:203493316-203493338 CCTAGTTCACCCAGAGCAGCTGG + Intronic
946016249 2:216606554-216606576 CAAGGTCCAGCCAGGGAAGCAGG - Intergenic
1169128469 20:3148772-3148794 CTGGGCTCACCCAGGGCCACAGG - Exonic
1171147488 20:22798132-22798154 CTGGGTTAACCCTGGGAAGCAGG - Intergenic
1171253528 20:23668620-23668642 CCAGCTTCACCCTGGGGAGCAGG + Intergenic
1171260007 20:23723913-23723935 CCAGCTTCACCCTGGGGAGCAGG + Intergenic
1171269077 20:23799446-23799468 CCAGCTTCACCCTGGGGAGCAGG + Intergenic
1173684251 20:44911588-44911610 CCAGGTTCACCCAGGCGACCTGG - Intronic
1182064342 22:27419917-27419939 TTATATTCACCCAGAGCAGCTGG + Intergenic
1182085347 22:27557357-27557379 CTAAGTTCCCCCAAGGCAGAGGG - Intergenic
949118996 3:362807-362829 CAATGTTCTCCCAGGACAGCAGG + Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
952931744 3:38365890-38365912 CTGGGAACACACAGGGCAGCAGG - Intronic
953552189 3:43912171-43912193 CTAAACTCACCCAGAGCAGCTGG + Intergenic
956678154 3:71754127-71754149 CTAGGCTCACGCACAGCAGCAGG - Exonic
962505770 3:136045266-136045288 CTTGGCTCACCCAGCACAGCTGG + Intronic
968507373 4:977108-977130 CAAGGATCACCGAGGGCTGCTGG + Intronic
968510971 4:995792-995814 CTGGGCTCACCCAGGGCTGTGGG - Intronic
968607985 4:1544591-1544613 CAAGGATCACCGAGGGCTGCTGG + Intergenic
968663934 4:1810543-1810565 CTGGGGTCACCAAGGGCACCTGG + Intergenic
968801479 4:2745989-2746011 CCAGGCCCACCCTGGGCAGCTGG - Intronic
968890690 4:3367005-3367027 CTGGGTCCAGCCAGGGCAGCAGG - Intronic
969256710 4:6007404-6007426 CTAGGTCCTCACAGGGCAGGAGG - Intergenic
979945925 4:126830820-126830842 CTATGTTCACCCAAGGCCCCAGG - Intergenic
982263206 4:153514129-153514151 CTACGGTCACCCAGGGCAAGAGG - Intronic
986264887 5:6182799-6182821 CAAGGTCCTCCCAGGGCAGTGGG - Intergenic
986386936 5:7243805-7243827 CTAGTGTCACCCAGTGCAGGTGG + Intergenic
991016700 5:61940861-61940883 CTAGGCTCAGCCATGGCTGCTGG + Intergenic
995912259 5:117202217-117202239 ATAGGTGCACCCCAGGCAGCGGG - Intergenic
997240215 5:132301306-132301328 CAAGGTTCCCCCAGGGCCTCTGG - Intronic
997376920 5:133403903-133403925 CCAGCGTCACACAGGGCAGCAGG + Intronic
998260329 5:140626047-140626069 GTAAGTTCACCCAGGCCAGGAGG - Intergenic
999194027 5:149769892-149769914 CTAGGCCCACCCAGGTCATCCGG + Intronic
999483553 5:151971023-151971045 CTATGTGCTCCCAGGGCAACTGG - Intergenic
1001081277 5:168669415-168669437 GTAGGCTAACCCAAGGCAGCAGG - Intronic
1001186235 5:169575641-169575663 CTAGGTACAGCCTGGGCATCAGG + Intergenic
1006416700 6:33908606-33908628 CTGGGTGGATCCAGGGCAGCTGG - Intergenic
1006445306 6:34076651-34076673 CCAGCCTCACCCAGGGCAGCAGG + Intronic
1006981905 6:38154097-38154119 CTAGGGCAACCCAGGGCAGAGGG + Exonic
1007108357 6:39298460-39298482 CTAGGTTCACCTGGGGCAGCTGG - Intergenic
1012998114 6:105993506-105993528 CTAGGTTCATCTAGGCCAGCAGG + Intergenic
1014920992 6:127214517-127214539 CTAGCTTCACCCAGTGGATCCGG + Intergenic
1021180232 7:17497461-17497483 CCAGGTTCAGCCTGGGCATCAGG + Intergenic
1021450241 7:20777924-20777946 CTAGGATGGCGCAGGGCAGCGGG + Intergenic
1021583752 7:22185766-22185788 TGAGGCACACCCAGGGCAGCTGG + Intronic
1022033575 7:26514109-26514131 CCAGGTTAACCCTGTGCAGCAGG + Intergenic
1022795858 7:33730950-33730972 CTGGGGTCACTCAGGGCACCCGG + Intergenic
1023845724 7:44119120-44119142 CTTTGTTTACCCAGGGCACCTGG + Intronic
1029585620 7:101468923-101468945 CAAGGTCCACCCGGTGCAGCAGG - Intronic
1029603649 7:101584964-101584986 CTGGGGTGGCCCAGGGCAGCAGG + Intergenic
1033200639 7:139366276-139366298 CAAGATTCAGCAAGGGCAGCTGG - Intronic
1039896919 8:41723460-41723482 CAAGCCTCACCCAGAGCAGCGGG - Intronic
1043301282 8:78736490-78736512 TGGGCTTCACCCAGGGCAGCTGG + Exonic
1045459988 8:102417118-102417140 CTAGTTTCACCCAATGCAGTGGG + Intergenic
1045510325 8:102807986-102808008 CTCGGTTCCCCAGGGGCAGCGGG - Intergenic
1047510838 8:125513966-125513988 CGAGGATTACCCAAGGCAGCCGG + Intergenic
1049356613 8:142192392-142192414 CTAGGTCCACCCAGGAAAGGGGG - Intergenic
1049807166 8:144546298-144546320 CCAGGTTCTCTCAGAGCAGCAGG - Intronic
1052593006 9:30522686-30522708 CTAGCTTACCCCAGGCCAGCTGG + Intergenic
1060414311 9:123419907-123419929 AGAGCTTCAGCCAGGGCAGCTGG + Intronic
1061054233 9:128213921-128213943 CTAGGGTCCCCTGGGGCAGCAGG + Intronic
1061226699 9:129284690-129284712 CTAGGTCCACCCAGGGGTGCTGG - Intergenic
1061389204 9:130307809-130307831 CCAGGGTCACCCAGGGAAGCCGG - Intronic
1061744879 9:132732436-132732458 CTAGTTTGCCCCAGGGCTGCAGG + Intronic
1061969488 9:134036191-134036213 CCAGCTTCTCCCCGGGCAGCCGG + Exonic
1190033002 X:46992310-46992332 TTAGGCTCACACAGGGAAGCTGG - Intronic
1190776941 X:53560292-53560314 CTCGTCTCACCCAGGGCATCGGG - Exonic
1196002057 X:110796270-110796292 CTAGGTGCATCCAGTGCAGAGGG - Intergenic