ID: 1132603571

View in Genome Browser
Species Human (GRCh38)
Location 16:784424-784446
Sequence CCCGGTGGGGACTCCGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132603556_1132603571 22 Left 1132603556 16:784379-784401 CCACGTCTCGGCTGAGGGCACGG No data
Right 1132603571 16:784424-784446 CCCGGTGGGGACTCCGGGTCTGG No data
1132603564_1132603571 -10 Left 1132603564 16:784411-784433 CCTCCAGTCGGGCCCCGGTGGGG No data
Right 1132603571 16:784424-784446 CCCGGTGGGGACTCCGGGTCTGG No data
1132603555_1132603571 23 Left 1132603555 16:784378-784400 CCCACGTCTCGGCTGAGGGCACG No data
Right 1132603571 16:784424-784446 CCCGGTGGGGACTCCGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132603571 Original CRISPR CCCGGTGGGGACTCCGGGTC TGG Intergenic
No off target data available for this crispr