ID: 1132603593

View in Genome Browser
Species Human (GRCh38)
Location 16:784496-784518
Sequence CCCGGTGGGGACTCCGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132603576_1132603593 24 Left 1132603576 16:784449-784471 CCCGCGTCTCGGCTGAGGACACG No data
Right 1132603593 16:784496-784518 CCCGGTGGGGACTCCGGGTCTGG No data
1132603585_1132603593 -9 Left 1132603585 16:784482-784504 CCTCCGGTCTGGGCCCCGGTGGG No data
Right 1132603593 16:784496-784518 CCCGGTGGGGACTCCGGGTCTGG No data
1132603577_1132603593 23 Left 1132603577 16:784450-784472 CCGCGTCTCGGCTGAGGACACGG No data
Right 1132603593 16:784496-784518 CCCGGTGGGGACTCCGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132603593 Original CRISPR CCCGGTGGGGACTCCGGGTC TGG Intergenic
No off target data available for this crispr