ID: 1132604025

View in Genome Browser
Species Human (GRCh38)
Location 16:786150-786172
Sequence GCGACTGCAGCAGTGTGTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 212}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132604014_1132604025 28 Left 1132604014 16:786099-786121 CCTCGGGGTCAGGGTCGGGGGTG 0: 1
1: 1
2: 0
3: 18
4: 263
Right 1132604025 16:786150-786172 GCGACTGCAGCAGTGTGTGGGGG 0: 1
1: 0
2: 3
3: 17
4: 212
1132604019_1132604025 3 Left 1132604019 16:786124-786146 CCGTAAGGCCTGCACGAGCTGGT 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1132604025 16:786150-786172 GCGACTGCAGCAGTGTGTGGGGG 0: 1
1: 0
2: 3
3: 17
4: 212
1132604020_1132604025 -5 Left 1132604020 16:786132-786154 CCTGCACGAGCTGGTCCAGCGAC 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1132604025 16:786150-786172 GCGACTGCAGCAGTGTGTGGGGG 0: 1
1: 0
2: 3
3: 17
4: 212
1132604017_1132604025 4 Left 1132604017 16:786123-786145 CCCGTAAGGCCTGCACGAGCTGG 0: 1
1: 0
2: 0
3: 14
4: 81
Right 1132604025 16:786150-786172 GCGACTGCAGCAGTGTGTGGGGG 0: 1
1: 0
2: 3
3: 17
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132604025 Original CRISPR GCGACTGCAGCAGTGTGTGG GGG Exonic
900622143 1:3592372-3592394 GGGACTGCGGGAGTGTCTGGGGG - Intronic
900653916 1:3745744-3745766 GGCACTGCTGCAGAGTGTGGTGG - Intergenic
902234587 1:15049250-15049272 GGGACAGGACCAGTGTGTGGGGG - Intronic
902250425 1:15151520-15151542 GAGTCTGCAGCAGAGTGGGGCGG + Intergenic
902881659 1:19375526-19375548 GGGTCTGCAACAGTGTGTAGTGG - Intronic
902897027 1:19485838-19485860 GGGCCTGCAGCAGCGAGTGGCGG + Intergenic
903474038 1:23607254-23607276 GCGTGGGCAACAGTGTGTGGAGG - Intronic
904445493 1:30570347-30570369 GCCACTGCAGGAGGGTGGGGAGG + Intergenic
905004080 1:34696310-34696332 GTGACTGGAGCAGTGTGAGCCGG - Intergenic
905301553 1:36989465-36989487 GCGGCTGCGGCAGTGTGCGAAGG + Intronic
906150578 1:43585203-43585225 GTGCCTGCAGCAGTGGGTGGAGG + Intronic
908408990 1:63843878-63843900 GCTACTTCAGCAAGGTGTGGAGG - Intronic
913158557 1:116124200-116124222 GGGTCTGCAGCAGTGGCTGGAGG + Exonic
915120493 1:153627335-153627357 GCGCGTGCAGGAGTGTGTGACGG - Intronic
916076116 1:161200849-161200871 GTGGCTGCAGCAGTGTGTGTGGG + Intronic
916676162 1:167065875-167065897 GGGACTGGAGCAGTGTGGGGAGG + Intronic
916712243 1:167422045-167422067 TGGTCTGCAGCAGTGTGTGGTGG + Exonic
916817575 1:168368577-168368599 GTGTCTGAAGCAGTGTGTGCTGG + Intergenic
918430071 1:184450297-184450319 GTGACTGGAGCACTGTCTGGAGG - Intronic
919052705 1:192531313-192531335 GTGTTTGCAGCAGTGTGAGGAGG + Intergenic
919977534 1:202622652-202622674 GCTTGTGCAGCTGTGTGTGGGGG + Intronic
924068891 1:240255048-240255070 ACGATTGCAGGAGTCTGTGGTGG + Intronic
1063302914 10:4868145-4868167 AAGACTACAGCAGTCTGTGGTGG + Intergenic
1065631325 10:27683901-27683923 GAGACTGCAGCAATGTGAGCAGG - Intronic
1066058976 10:31705936-31705958 GGGTCTGCAGCAGTGAGAGGTGG - Intergenic
1066642884 10:37574003-37574025 CCAACTACAGCAATGTGTGGTGG + Intergenic
1067844740 10:49710770-49710792 GCTACTGCAGCGGGGTGTGGGGG - Intergenic
1067972868 10:50991945-50991967 GCGACTGCAGCCATGTGTGGAGG - Intronic
1071823109 10:89297792-89297814 GTGCCTGCAGCAGTGTGTAGAGG - Intronic
1072785470 10:98276936-98276958 TTGACTGGAGCAGTGGGTGGGGG - Intergenic
1072981362 10:100100514-100100536 ATGACTGAAGCAGTGTGTGGTGG - Intergenic
1077683838 11:4272367-4272389 GAGACTAAAGCAGTGTGGGGTGG + Intergenic
1077686204 11:4294397-4294419 GAGACTAAAGCAGTGTGGGGTGG - Intergenic
1078315295 11:10289279-10289301 GCAGCTGCAGCTGTGTGGGGTGG + Intronic
1081001795 11:37682604-37682626 GAAACTGTAGCAGTGTTTGGGGG + Intergenic
1082944966 11:58748929-58748951 GCGAGTGGAGGAGTGTATGGTGG - Intergenic
1083256160 11:61496612-61496634 CTGTCTGCAGCAGTGTGGGGAGG - Intergenic
1083811956 11:65111274-65111296 GGGACTGCAGGTGTGTGTGGGGG - Intronic
1084554346 11:69866979-69867001 GTGGCTAAAGCAGTGTGTGGGGG - Intergenic
1084783135 11:71424499-71424521 ACTACTCCAGCAGGGTGTGGTGG - Intergenic
1085168429 11:74425759-74425781 GCGTTTGCAGCTGGGTGTGGTGG - Intergenic
1087811711 11:102615675-102615697 GCGGCTGCAGCAGAGGGTGCAGG - Intronic
1088907247 11:114164069-114164091 ACGATTGCGGCAGTGTCTGGAGG + Intronic
1089509266 11:118985609-118985631 GCCACTGCAGGAGTGGGTGAGGG + Intergenic
1090916906 11:131173161-131173183 TCCACTGCAGCATTGTGTGATGG - Intergenic
1090966689 11:131604135-131604157 GCCACATCAGCAGTGTGTGAGGG + Intronic
1091403254 12:193580-193602 ATGGCAGCAGCAGTGTGTGGGGG - Intronic
1092578296 12:9813806-9813828 ACGACTGCAGGAGTCTGCGGTGG - Intergenic
1094783269 12:33817922-33817944 GCAACTGCAGCAGTGTGGTGGGG + Intergenic
1096776202 12:53965899-53965921 GCGCCTGCAGCAGTCTGGGTGGG + Intergenic
1097650546 12:62292552-62292574 GTGTCTGCAGCAGTGGGTGGAGG + Intronic
1097787533 12:63778298-63778320 GGGAATGCAGCAGTGTGGAGGGG - Intergenic
1103700306 12:122845754-122845776 GCGGCTGCAGGAGGGTGTGAGGG + Intronic
1106581031 13:31018604-31018626 GTGACTGAATCACTGTGTGGAGG + Intergenic
1106609374 13:31263868-31263890 GTCACTGCAGCAGGGTGTGTAGG + Intronic
1109134191 13:58625957-58625979 GTGACAGTAGCAGTGGGTGGGGG - Intergenic
1109907610 13:68865503-68865525 GTTTCTGCAGCAGTGGGTGGAGG - Intergenic
1111823545 13:93242552-93242574 GTGTCTGCAGCAGTGGGTGAGGG + Intronic
1120130975 14:80807613-80807635 CAGATTGCAGCAGTTTGTGGTGG - Intronic
1120363922 14:83541432-83541454 GAGGCTGCAGCAGATTGTGGCGG + Intergenic
1121637469 14:95463479-95463501 GCGCCTGGTGCAGGGTGTGGAGG - Intronic
1122798305 14:104217358-104217380 GGCACTGCAGCAGTGTGGTGAGG + Intergenic
1122798315 14:104217397-104217419 GGCACTGCAGCAGTGTGGTGAGG + Intergenic
1122798323 14:104217436-104217458 GGCACTGCAGCAGTGTGGTGAGG + Intergenic
1122798343 14:104217514-104217536 GGCACTGCAGCAGTGTGGTGAGG + Intergenic
1122798353 14:104217553-104217575 GGCACTGCAGCAGTGTGGTGAGG + Intergenic
1122798361 14:104217592-104217614 GGCACTGCAGCAGTGTGGTGAGG + Intergenic
1122798369 14:104217631-104217653 GGCACTGCAGCAGTGTGGCGAGG + Intergenic
1124403292 15:29369759-29369781 GCCAATGCAACAGTGTTTGGAGG + Intronic
1125144290 15:36448556-36448578 GATACTGGAGAAGTGTGTGGAGG - Intergenic
1125972087 15:43920117-43920139 GCGACTGCATGTATGTGTGGCGG + Intronic
1126212155 15:46111793-46111815 GCCCCTGCAGCAATGTCTGGGGG - Intergenic
1127636530 15:60876089-60876111 GGGACTTCAGGAGGGTGTGGTGG - Intronic
1129541611 15:76354098-76354120 GCTTCTGCAGCACTGTGGGGTGG + Exonic
1132604025 16:786150-786172 GCGACTGCAGCAGTGTGTGGGGG + Exonic
1132606994 16:797742-797764 CCGAGTGCAGGTGTGTGTGGGGG + Exonic
1133240787 16:4413131-4413153 GCGCCTGGACCAGTTTGTGGGGG + Intronic
1134107892 16:11497010-11497032 GAGCCTGCAACAGTGTGTGTAGG + Intronic
1134336149 16:13301396-13301418 GCAACAGCAGCATTATGTGGGGG - Intergenic
1136403058 16:30028895-30028917 GCAGCTGCTGCAGTGTCTGGTGG - Intronic
1136540303 16:30924659-30924681 GCGACTGCAGGCGGGGGTGGGGG - Exonic
1136777766 16:32880845-32880867 GAGGCTGCAGCAGGGTGTTGTGG - Intergenic
1136892857 16:33980669-33980691 GAGGCTGCAGCAGGGTGTTGTGG + Intergenic
1139477432 16:67209734-67209756 GCGACCGCTGCAGTCTGGGGAGG - Intronic
1142003149 16:87675508-87675530 CCGGCTGCAGCAGTGTCTGCTGG - Intronic
1142354293 16:89594990-89595012 GAGACTGGAGCAGGGTGTGTGGG + Intronic
1142723877 17:1797599-1797621 GCTTCTGCTGCAGTGTGGGGTGG + Intronic
1143971327 17:10798110-10798132 GGGACAGCAGCCGTGGGTGGTGG - Intergenic
1145057656 17:19714053-19714075 GCGGCGCCAGCGGTGTGTGGCGG + Intronic
1145068874 17:19785978-19786000 GGGGCTGCCGCACTGTGTGGAGG + Exonic
1147737103 17:42646434-42646456 ATGACTGCAGCAGTGTGTGATGG - Intergenic
1148142353 17:45337908-45337930 TCCACAGCAGCAGTGTGAGGAGG + Intergenic
1149488427 17:57063878-57063900 GCAACTGCAGCAGTGAGGTGGGG + Intergenic
1149552648 17:57551652-57551674 AAGACTTCAGCAGTGGGTGGGGG - Intronic
1149977805 17:61284225-61284247 GCGACTGCTGGTGTGGGTGGGGG - Intronic
1150446232 17:65228740-65228762 AAGACTGCGGCAGTGGGTGGGGG + Intergenic
1154018824 18:10644647-10644669 GAGACTGGAGAAGTGTGTGCTGG - Intergenic
1154185404 18:12178775-12178797 GAGACTGGAGAAGTGTGTGCTGG + Intergenic
1158073328 18:53499288-53499310 TCCACTGCAGCAGTGAGTGAAGG + Exonic
1160292026 18:77603674-77603696 GCGGAGACAGCAGTGTGTGGGGG - Intergenic
1160867777 19:1263291-1263313 GTGACAGCTGCGGTGTGTGGTGG - Intronic
1161345960 19:3768824-3768846 GCGGCTGGAGCAGAGTGAGGAGG - Intergenic
1161427281 19:4210477-4210499 GTGGCTGCAGCAGGGTGGGGAGG - Intronic
1161493731 19:4576338-4576360 ATGGCTGCAGCAGAGTGTGGAGG - Intergenic
1161610380 19:5238812-5238834 GGGCCTGCTGCAGTGGGTGGGGG - Intronic
1161649888 19:5477959-5477981 GTGGCTGCAGCAGAGTGAGGAGG - Intergenic
1161756422 19:6137446-6137468 GTGGCTGCAGCAGAGTGAGGAGG + Intronic
1163290135 19:16373996-16374018 GCAACTGCAGATCTGTGTGGAGG - Intronic
1163662869 19:18589066-18589088 CCGACTGGAGGAGTGAGTGGGGG + Exonic
1164590449 19:29504022-29504044 GGGACTGCAGGAGTGGGTGCAGG - Intergenic
1164854638 19:31511458-31511480 GGGGCTGTAGGAGTGTGTGGGGG + Intergenic
1164986744 19:32653794-32653816 GGCCCTGCAGCAGTGTGTGTGGG - Intronic
1165618005 19:37219113-37219135 GTGACTGCAGCATTGGGTAGGGG + Intronic
1166313674 19:41976729-41976751 GCTACTGCAGCAGGGCGTGCGGG + Intronic
1167616454 19:50536959-50536981 GCGACTCCAGCTGGGTGTGGTGG + Intronic
1167958392 19:53086560-53086582 CCCACTGCTGCAGTGTGTGTGGG - Intronic
1168434651 19:56307302-56307324 AGGACTGCAGCAGGGGGTGGGGG - Intronic
1168638630 19:58015529-58015551 CCGAGTGCAGCCGAGTGTGGTGG - Intergenic
925364634 2:3303471-3303493 GCCACTGCTGCTGTGAGTGGCGG - Intronic
926129596 2:10293727-10293749 GCCACTCTAGCAGTGTGAGGTGG + Intergenic
927200282 2:20573916-20573938 GTGACTGCAGCAGTGTTTTCAGG + Intronic
928324704 2:30310255-30310277 GAGCTTGCAGCTGTGTGTGGTGG - Intronic
929667140 2:43841803-43841825 GAGTCTGGAGCAATGTGTGGAGG - Intronic
929879987 2:45827122-45827144 GTGACTGGAGCAGAGTGTGGAGG - Intronic
932050568 2:68393911-68393933 CCCACTGAAGCAGGGTGTGGAGG + Intronic
933145961 2:78852787-78852809 GCAAATGCAGCAGTATTTGGGGG - Intergenic
936386898 2:112038860-112038882 GCCACTGCAGCAGTGGGTGGGGG + Intergenic
936812043 2:116413799-116413821 CCACCTGCAGCAGTGTTTGGTGG - Intergenic
937505213 2:122529180-122529202 GCCACTGCCGCAGCGTGGGGTGG - Intergenic
938824408 2:134990905-134990927 GCTACTGCAGCCATGTGCGGTGG + Intronic
945597468 2:211812761-211812783 GAGACTGCAGCAGCCTGTAGGGG - Intronic
946782344 2:223204901-223204923 AGGACTGCAGGAGTCTGTGGTGG - Intergenic
1169146305 20:3254752-3254774 GCGACTGAAGCAGAGGCTGGGGG + Intronic
1170054234 20:12181818-12181840 GCAAATTCAGCAGGGTGTGGTGG + Intergenic
1170728299 20:18948899-18948921 GGGGCTGGAGAAGTGTGTGGAGG + Intergenic
1172240759 20:33411169-33411191 GTGTCAGCAGCAGTCTGTGGCGG - Intronic
1172509616 20:35491247-35491269 GCGTCTGCAGCAGTGTCTCCAGG - Exonic
1175409051 20:58754053-58754075 GAGACAGCAGCCGTTTGTGGTGG - Intergenic
1179333559 21:40428555-40428577 GTATTTGCAGCAGTGTGTGGTGG - Intronic
1179916397 21:44480816-44480838 GCGACAGCAGGGATGTGTGGGGG + Intergenic
1181319768 22:21995289-21995311 GCAAATGCAGCAGTGAGTAGTGG + Intergenic
1182054499 22:27339391-27339413 GGGCCTGCCTCAGTGTGTGGGGG - Intergenic
1183222212 22:36522711-36522733 GCTACTGCGGCAGTGTCGGGAGG + Intronic
1183932973 22:41246617-41246639 GCGTCTGCAGCAGACTGTGGCGG + Exonic
1183945612 22:41324200-41324222 GACACTGCAGCAGTATGGGGAGG + Intronic
1184240951 22:43211031-43211053 GCGGATGCAGCGGTGGGTGGTGG + Exonic
1184773960 22:46613975-46613997 GCGGCTGCAGCAGTGTGAGGAGG + Intronic
950511595 3:13431685-13431707 GGGAGTGTAGCAGGGTGTGGTGG + Intergenic
951676879 3:25250867-25250889 AAGACTGCAGGAGTCTGTGGTGG + Intronic
952216911 3:31287365-31287387 AGGCCTGCTGCAGTGTGTGGGGG + Intergenic
953688611 3:45098092-45098114 GAGACCACTGCAGTGTGTGGCGG - Intronic
954692446 3:52402841-52402863 GGCACTGCTGAAGTGTGTGGAGG - Exonic
956714487 3:72066485-72066507 GTGACTGCAGCACTGTGGGCTGG + Intergenic
959863772 3:111243267-111243289 GTGGCTGCAGCTGTGGGTGGTGG + Intronic
959875039 3:111372854-111372876 GCGAATTAAGCAGTGTGTGGAGG + Intronic
960267897 3:115641880-115641902 GCGGCTGAAGCAGAGTTTGGTGG + Intronic
961375181 3:126460491-126460513 GCAGCTGCAGCTGTGGGTGGAGG - Intronic
961393741 3:126571619-126571641 GCACCTGCCGCAGTGCGTGGTGG - Intergenic
962698687 3:137975825-137975847 GTGGCTGCAGCAGAGTGAGGTGG - Intergenic
967299232 3:187996211-187996233 ATGACTGCAGCACTGTGTGCAGG - Intergenic
967434641 3:189430466-189430488 TAGACTCCAGCAGTGTTTGGGGG + Intergenic
968054158 3:195678351-195678373 GAGGCTGCACCAGTATGTGGAGG + Intergenic
971369203 4:26002268-26002290 GCAACTGCAGCCGGGTGGGGTGG + Intergenic
975226420 4:71877605-71877627 TGGATTGCAGCAGTCTGTGGTGG + Intergenic
982198321 4:152937025-152937047 GCGCCTGCAGGAGTGTGGGGAGG + Intronic
985515998 5:344900-344922 GCGTGTGCAGGTGTGTGTGGAGG + Intronic
986284218 5:6347991-6348013 GCCATTGCAGCAGGGTGAGGAGG + Intergenic
988910699 5:35838790-35838812 GAGAATGCCGCAGTGTCTGGTGG + Intergenic
990375978 5:55171445-55171467 AAAACTGCAGCAGTGTTTGGGGG + Intronic
990456761 5:55995511-55995533 GAGACTGCGGCAGATTGTGGCGG + Intergenic
992554778 5:77892580-77892602 GTGACTGCAGGAGTGGGTGATGG - Intergenic
993605707 5:89988610-89988632 GCAACTTCAGCAATGTGTGTAGG + Intergenic
995184138 5:109254072-109254094 GCTTCTACAGCAGTGGGTGGTGG + Intergenic
997293122 5:132752055-132752077 GCAGCTGCAGCACTGTATGGCGG + Exonic
997849956 5:137323083-137323105 CCCAGTGCAGCAGTGTTTGGAGG - Intronic
999798223 5:155007917-155007939 GCTACTGCAGCAGGTGGTGGGGG - Intergenic
1001157592 5:169286663-169286685 GCAACTGCAGCATGGTGTAGTGG - Intronic
1001939808 5:175732539-175732561 GCGGTTGCAGCCGTGGGTGGTGG + Intergenic
1002074703 5:176701248-176701270 GCGGGTGCAGCAAAGTGTGGGGG + Intergenic
1002087662 5:176785891-176785913 GCTTTTGGAGCAGTGTGTGGGGG + Intergenic
1002289942 5:178193587-178193609 GCTTCTGCAGCAGTGAGTTGAGG + Intergenic
1004029184 6:11849429-11849451 GCGACTGCAGTAAGATGTGGAGG - Intergenic
1004861939 6:19813253-19813275 GAGTCTTCAACAGTGTGTGGTGG - Intergenic
1006240475 6:32673358-32673380 TTGACTGCAGCTGGGTGTGGTGG + Intergenic
1007759874 6:44127549-44127571 GCGGCCGCGGCAGTGTATGGGGG - Intronic
1008351759 6:50499639-50499661 GTGCCTGCAGCAGTGTGCAGAGG - Intergenic
1015088804 6:129329647-129329669 GCGACTGCAGCTGGGCATGGTGG - Intronic
1018369969 6:163158760-163158782 GTGCCTGCTGCAGTGTGAGGAGG - Intronic
1019043535 6:169125419-169125441 GGCCCTGCAGCAGTGTCTGGGGG - Intergenic
1019386820 7:761767-761789 GCGCCTGCTGCTGTGTGTGCAGG + Exonic
1019671738 7:2283591-2283613 GGGACAGCAGCCGTGTGTCGTGG - Intronic
1020008100 7:4792848-4792870 CCGCCTGCAGCAGTGGGTGTGGG + Intronic
1022230898 7:28410862-28410884 GCGATTGCACGAGTGTGTTGTGG - Intronic
1023837651 7:44077740-44077762 GAGACTTGAGCAGTGTGTGCAGG - Intronic
1023959421 7:44914071-44914093 GCTAGGGCAGGAGTGTGTGGAGG - Intergenic
1024724771 7:52180126-52180148 GTGACTGGAGCAGTAGGTGGAGG + Intergenic
1026507381 7:70996589-70996611 GCAACTCCAGCTGGGTGTGGTGG + Intergenic
1027305079 7:76886027-76886049 GGGACTGTTGCAGGGTGTGGGGG + Intergenic
1029575726 7:101402112-101402134 GCCAAGACAGCAGTGTGTGGCGG + Intronic
1031253785 7:119421464-119421486 GTATTTGCAGCAGTGTGTGGAGG - Intergenic
1031669461 7:124525114-124525136 GCCACTGCATCAGTGTGGTGGGG + Intergenic
1033221114 7:139526579-139526601 GGGACTGAGGCAGTGTGGGGAGG + Intronic
1033601295 7:142890491-142890513 GCGTCTGCAGGTGTGTGTGCAGG - Intergenic
1033893985 7:146049939-146049961 GAGGCTGCAGCAGTCTGTGATGG - Intergenic
1035605469 8:927345-927367 GTGACTGTAGCACTTTGTGGGGG + Intergenic
1035649343 8:1253238-1253260 GCGGCTGCAGCCCTGCGTGGTGG - Intergenic
1036296244 8:7540539-7540561 GCCACAGCAGCAATGTGTGCCGG + Intronic
1036326322 8:7780480-7780502 GCCACAGCAGCAATGTGTGCCGG - Intronic
1037938051 8:22928300-22928322 GGGACTGCTGCAGGGGGTGGGGG + Intronic
1039568061 8:38565132-38565154 CCGACTGCAGGAGTGGGAGGAGG - Intergenic
1039894583 8:41707463-41707485 TTGGCTGCAGCAGTGTGTGGTGG - Intronic
1041094231 8:54333208-54333230 GCGACTGGACCAGTGGCTGGAGG + Intergenic
1041831954 8:62164238-62164260 GCTACTGTAGCTGTCTGTGGTGG - Intergenic
1046980172 8:120328517-120328539 GAGGCTGCAGCTGGGTGTGGTGG - Intronic
1048480593 8:134788279-134788301 GCAGCTGAAGCAGTGCGTGGAGG - Intergenic
1049346670 8:142142827-142142849 GTGAGAGCAGCAGTGGGTGGTGG + Intergenic
1053195012 9:36110732-36110754 GCCACTGCAGCAGTGTGAAATGG - Intronic
1053270731 9:36747719-36747741 ACAACTGCAGCTGGGTGTGGTGG + Intergenic
1055278127 9:74642499-74642521 GCGGCAGCAGCAGAGTGGGGAGG + Exonic
1056975677 9:91251019-91251041 TCTGCTGCAGCCGTGTGTGGTGG - Intronic
1060537250 9:124400107-124400129 GCGGCAGGAGCAGTGAGTGGGGG - Intronic
1061224642 9:129273738-129273760 GCGAACTCAGCAGGGTGTGGAGG - Intergenic
1061867087 9:133498055-133498077 GCTACCCCACCAGTGTGTGGTGG - Intergenic
1062057035 9:134474130-134474152 GTGACTGCAGCAGAGTGGGCTGG + Intergenic
1189391560 X:40580986-40581008 GCGACAGCCGCAGCGTGAGGAGG - Exonic
1189888913 X:45578018-45578040 AGGACTGCAGAAGTCTGTGGTGG + Intergenic
1191944239 X:66514367-66514389 GCCAGTGAAGAAGTGTGTGGAGG + Intergenic
1194085687 X:89524962-89524984 GCAGCTGCAGCAGTGTGGCGGGG + Intergenic
1194274909 X:91866592-91866614 GCCACTGCAGCAGTTGGGGGAGG + Intronic
1199892480 X:152100117-152100139 GCAACTGCAGCAGTGTTTCAAGG + Intergenic
1200438333 Y:3180845-3180867 GCAGCTGCAGCAGTGTGGCGGGG + Intergenic
1200592151 Y:5087993-5088015 GCCACTGCAGCAGTTGGGGGAGG + Intronic
1201060283 Y:10038300-10038322 GGGACTGCAGAAGTGTGTATAGG - Intergenic