ID: 1132604134

View in Genome Browser
Species Human (GRCh38)
Location 16:786629-786651
Sequence CTGGCTCCTGACTGATTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1141
Summary {0: 1, 1: 0, 2: 1, 3: 88, 4: 1051}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132604134_1132604143 18 Left 1132604134 16:786629-786651 CCAAGGAATCAGTCAGGAGCCAG 0: 1
1: 0
2: 1
3: 88
4: 1051
Right 1132604143 16:786670-786692 TGAGAAGCTGAGAGGCTGCAGGG 0: 1
1: 1
2: 5
3: 55
4: 485
1132604134_1132604141 10 Left 1132604134 16:786629-786651 CCAAGGAATCAGTCAGGAGCCAG 0: 1
1: 0
2: 1
3: 88
4: 1051
Right 1132604141 16:786662-786684 GTGTCAGGTGAGAAGCTGAGAGG 0: 1
1: 0
2: 0
3: 28
4: 308
1132604134_1132604142 17 Left 1132604134 16:786629-786651 CCAAGGAATCAGTCAGGAGCCAG 0: 1
1: 0
2: 1
3: 88
4: 1051
Right 1132604142 16:786669-786691 GTGAGAAGCTGAGAGGCTGCAGG 0: 1
1: 0
2: 6
3: 59
4: 500
1132604134_1132604137 -5 Left 1132604134 16:786629-786651 CCAAGGAATCAGTCAGGAGCCAG 0: 1
1: 0
2: 1
3: 88
4: 1051
Right 1132604137 16:786647-786669 GCCAGCAGGGACCCTGTGTCAGG 0: 1
1: 0
2: 5
3: 100
4: 2149
1132604134_1132604144 23 Left 1132604134 16:786629-786651 CCAAGGAATCAGTCAGGAGCCAG 0: 1
1: 0
2: 1
3: 88
4: 1051
Right 1132604144 16:786675-786697 AGCTGAGAGGCTGCAGGGCGTGG 0: 1
1: 0
2: 10
3: 55
4: 598

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132604134 Original CRISPR CTGGCTCCTGACTGATTCCT TGG (reversed) Intronic
900655173 1:3753248-3753270 CCGGCTCCTGGCAGCTTCCTGGG + Intronic
901047015 1:6402967-6402989 CTGCATCCTGTATGATTCCTGGG - Intergenic
901156967 1:7146633-7146655 CTGGGTCCTCACTGCTTCCCTGG + Intronic
901183792 1:7359216-7359238 CTGGCTCCCCACTGACCCCTGGG - Intronic
902102129 1:13999439-13999461 CTTGCTCCTGAATGACTCCTGGG + Intergenic
903510538 1:23871556-23871578 CTGGGTCCTGACTGAGCACTGGG + Exonic
904366070 1:30011690-30011712 CTGGCTCCTTCCTGCTGCCTGGG + Intergenic
905252998 1:36661735-36661757 CTGTCTCTAGACTGGTTCCTGGG + Intergenic
905952950 1:41967433-41967455 CCTGCTCCTGAATGATTCCTGGG + Intronic
905954992 1:41985240-41985262 CTGGCTCCTGCCTCCTTCTTAGG - Intronic
906569873 1:46828407-46828429 CTTGCTCCTGAATGACTACTGGG - Intergenic
906702479 1:47869958-47869980 TTGGATCCTGACTGATACCCAGG - Intronic
907046999 1:51305491-51305513 CTGGCTCCTGAAGGATCCCTAGG - Intronic
907440790 1:54476806-54476828 GAGGCTCCTCCCTGATTCCTGGG - Intergenic
907992981 1:59600862-59600884 ATGGCTCCTCACTATTTCCTGGG + Intronic
908063865 1:60381299-60381321 CTTGCTCCTGAATGACTACTGGG + Intergenic
908283181 1:62564436-62564458 CTTGCTCCTGAATGACTACTGGG + Intronic
908324592 1:63011224-63011246 CTGGATCCAGACTGACTCCGAGG + Intergenic
908950628 1:69558551-69558573 CCTGCTCCTGAATGACTCCTGGG - Intergenic
908954591 1:69607196-69607218 TGGGCTCCTGTCTGATTCTTTGG + Intronic
909733914 1:78932307-78932329 CCTGCTCCTGAATGAATCCTGGG + Intronic
910321157 1:85945968-85945990 CTGGCTCTTGGCTGATGTCTGGG + Intronic
910381077 1:86627597-86627619 CCTGCTCCTGAATGACTCCTGGG - Intergenic
910560552 1:88585540-88585562 CCTGCTCTTGAGTGATTCCTAGG + Intergenic
910612223 1:89157087-89157109 CTGTCTCCTGAATGACTACTGGG + Intronic
911128740 1:94367528-94367550 CTTCCTCCTGACTGACTACTGGG - Intergenic
911243040 1:95485961-95485983 CCTGCTCCTGAATGACTCCTGGG + Intergenic
911339017 1:96615029-96615051 CTTGCTCCTGAATGACTGCTGGG - Intergenic
911342343 1:96654152-96654174 CTTGCTCCTGAGTGACTACTGGG + Intergenic
911424038 1:97684292-97684314 CTTGCTCCTGTATGACTCCTGGG - Intronic
911541089 1:99159495-99159517 CTTGCTCCTGAATGACTTCTGGG - Intergenic
911794775 1:102061514-102061536 CCTGCTCCTGACTGACTCTTGGG + Intergenic
911800418 1:102131157-102131179 CCTGCTCCTTAATGATTCCTTGG + Intergenic
911990916 1:104695752-104695774 CTTGCTCCTGAATGACTACTGGG + Intergenic
912009187 1:104938404-104938426 CCTGCTCCTGAATGATTACTGGG - Intergenic
912029503 1:105221595-105221617 CCTGCTCCTGAATGATTACTGGG - Intergenic
912224452 1:107717496-107717518 CCTGCTCCTGAATGACTCCTGGG - Intronic
912291629 1:108429583-108429605 CATGCTCCTGAATGACTCCTGGG - Intronic
912646427 1:111396618-111396640 CTTGCTCCTGAATGACTACTGGG + Intergenic
912886119 1:113476480-113476502 CTTGCTCCTGAATGACTACTGGG - Intronic
912975982 1:114330729-114330751 CTGTCACCTGACTGCTTCCAAGG + Intergenic
913102434 1:115581484-115581506 CCTGCTCCTGAATGATTACTAGG - Intergenic
913719477 1:121577150-121577172 CCTGCTCCTGAATGATTACTGGG + Intergenic
913721546 1:121601446-121601468 CCTGCTCCTGAATGATTACTGGG - Intergenic
914470722 1:147975914-147975936 CCTGCTCCTGAATGACTCCTCGG - Intronic
915026294 1:152833096-152833118 CCGGCTCCTGAATGACTACTGGG + Intergenic
915570362 1:156742084-156742106 TTGGATTCTGACTGATTCTTTGG - Intergenic
915763500 1:158338952-158338974 CTGGCTCCTGAGTGACTACTGGG + Intergenic
916257999 1:162810208-162810230 CTTGCTCCTGAATGACTACTGGG - Intronic
916343422 1:163761189-163761211 CCTGCTCCTGAATGACTCCTGGG + Intergenic
916377274 1:164168827-164168849 CCTGCTCCTGAATGACTCCTGGG + Intergenic
916436904 1:164785834-164785856 CTGGTTCCTGACTGGTACCTGGG - Intronic
916827838 1:168460283-168460305 CCTGCTCCTGAATGACTCCTGGG - Intergenic
916848758 1:168681501-168681523 CCTGCTCCTGAATGACTCCTGGG - Intergenic
916924214 1:169500567-169500589 CTTGCTCCTGAATGACTGCTGGG + Intergenic
917009461 1:170454979-170455001 CTTGCTCCTGAATGACTACTGGG - Intergenic
917059311 1:171019198-171019220 CCTGCTCCTGAATGACTCCTGGG + Intronic
917079330 1:171240230-171240252 CGTGCTCCTGAATGACTCCTGGG + Intergenic
917305535 1:173620335-173620357 CCTGCTCCTGAATGACTCCTGGG + Intronic
917890550 1:179433621-179433643 CCTGCTCCTGAATGACTCCTGGG - Intronic
917903661 1:179568809-179568831 CTTGCTCCTGAATGACTACTGGG - Intronic
917914438 1:179687301-179687323 CTTGCTCCTGAATGACTACTGGG - Intronic
918360113 1:183748878-183748900 CTTGCTTCTGAATGATTACTGGG - Intronic
918890109 1:190256026-190256048 CTGGCTCCTGAATGACTACTGGG - Intronic
919031279 1:192246152-192246174 CCTGCTCCTGAATGACTCCTGGG - Intergenic
919114468 1:193263423-193263445 TTGGATCCTGACTGATACGTTGG + Intergenic
919445376 1:197698298-197698320 CCTGCTCCTGAATGACTCCTGGG + Intronic
919489787 1:198192696-198192718 CCTGCTCCTGAATGACTCCTGGG + Intronic
919559453 1:199098667-199098689 CTGGTGCCTGTGTGATTCCTTGG - Intergenic
920085655 1:203414332-203414354 CCGGCTCCTGAATGACTACTGGG + Intergenic
920398864 1:205664765-205664787 TGGGCGCCTGGCTGATTCCTAGG - Exonic
920428950 1:205902367-205902389 CTTGCTCCTGAATGACTACTGGG + Intergenic
921296567 1:213709777-213709799 CCGGCTCCTGAATGACTACTGGG - Intergenic
921753179 1:218821275-218821297 CTTGCTCCTGAATGACTACTGGG + Intergenic
922147313 1:222960354-222960376 CCTGCTCCTGATTGACTCCTGGG + Intronic
922693884 1:227716604-227716626 CCTGCTCCTGAATGATTCCTGGG + Intergenic
923070717 1:230562202-230562224 CTGGCTCTTGACTGCAGCCTGGG + Intergenic
923226802 1:231945345-231945367 CCTGCTCCTGAATGACTCCTGGG + Intronic
923707738 1:236358629-236358651 CCTGCTCCTGAATGATTCTTGGG - Intronic
923726354 1:236508777-236508799 CCTGCTCCTGAATGACTCCTGGG - Intergenic
924412662 1:243822160-243822182 CTTGCTCCTGAATGACTCCTGGG + Intronic
924617697 1:245627386-245627408 CCTGCTCCTGAATGAGTCCTGGG + Intronic
924862953 1:247945265-247945287 CCTGCTCCTGAGTGACTCCTGGG - Intronic
1063579328 10:7291517-7291539 CCGGGTCCTCTCTGATTCCTGGG + Intronic
1064370214 10:14745559-14745581 TTTGCTCCTGAATGACTCCTGGG - Intronic
1064758142 10:18590639-18590661 CTTGCTCCTGAATGACTACTGGG + Intronic
1064848179 10:19679907-19679929 CCTGCTTCTGAATGATTCCTGGG - Intronic
1065157828 10:22888513-22888535 CTTGCTCCTGAATGACTACTGGG + Intergenic
1065733843 10:28733249-28733271 GTGGGTCCTGTCTTATTCCTGGG - Intergenic
1067063352 10:43089486-43089508 CTGGGTCCTGAGTACTTCCTTGG - Intronic
1067240607 10:44489045-44489067 CTTGCTCCTGAATGACTACTGGG + Intergenic
1067673660 10:48349503-48349525 CTTGCTCCTGAATGACTACTGGG + Intronic
1067946991 10:50695880-50695902 CTATCTCCTGAGGGATTCCTGGG + Intergenic
1068115520 10:52733638-52733660 CCTGCTCCTGAATGATTACTGGG - Intergenic
1068516739 10:58034605-58034627 CTTGCTCCTGAATGACTACTGGG - Intergenic
1068718675 10:60217518-60217540 CCTGCTCCTGAATGACTCCTGGG - Intronic
1068835867 10:61552912-61552934 CCTGCTCCTGAGTGACTCCTGGG + Intergenic
1068838780 10:61587102-61587124 CTGGCTCCTGATTGAGCCCTTGG - Intergenic
1068849017 10:61714770-61714792 CTTGCTCCTGAATGATTACAGGG - Intronic
1069264927 10:66445556-66445578 CTTGCTCCTGAATGACTACTGGG + Intronic
1069909780 10:71751990-71752012 CTGGCTCCTGCCTTCTTGCTTGG - Intronic
1070007432 10:72438281-72438303 CTTGCTCCTGAATGACTACTGGG + Intronic
1070061961 10:72992450-72992472 CTTGCTCCTGAATGACTACTGGG + Intergenic
1070334949 10:75447121-75447143 ATATATCCTGACTGATTCCTAGG + Intronic
1070429672 10:76324550-76324572 CTGGCTCATTACTGCTGCCTCGG + Intronic
1070478022 10:76849092-76849114 CTTGCTCCTGAGTGACTACTGGG + Intergenic
1070882301 10:79860873-79860895 CTATCTCCTGAGGGATTCCTGGG + Intergenic
1070896927 10:79992248-79992270 CTTGCTCCTGAATGACTTCTGGG - Intergenic
1071071557 10:81699790-81699812 CCTGCTCCTGAATGACTCCTTGG + Intergenic
1071134278 10:82435705-82435727 CCTGCTCCTGAATGACTCCTGGG - Intronic
1071648871 10:87377184-87377206 CTATCTCCTGAGGGATTCCTGGG + Intergenic
1072393741 10:95017010-95017032 CCGGCTCCTGAATGACTACTGGG - Intergenic
1072711543 10:97718731-97718753 CTGGCTGCTGACGGATGCCCTGG + Intergenic
1073927649 10:108535469-108535491 CTTGCTCCTGAATGACTACTGGG + Intergenic
1073979144 10:109134288-109134310 CTTGCTCCTGAATGACTACTGGG + Intergenic
1073999597 10:109356712-109356734 CCTGCTCCTGACTGACTACTGGG - Intergenic
1074080721 10:110166198-110166220 CTGGTGCCTGACTGAGTGCTGGG + Intergenic
1074480138 10:113811983-113812005 CCTGCTCCTGAATGAATCCTGGG + Intergenic
1074515014 10:114159108-114159130 TTGTTTCCTCACTGATTCCTAGG - Intronic
1074621879 10:115133930-115133952 CTTGCTCCTGAATGACTACTGGG + Intronic
1074623685 10:115153968-115153990 CTTGCTCCTGAATGACTACTGGG - Intronic
1074898119 10:117794443-117794465 CTCACTCCTGACTCATTCCAAGG + Intergenic
1075172089 10:120125233-120125255 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1075990093 10:126829141-126829163 CAGGCTCCTGACTGACTAATGGG + Intergenic
1076431521 10:130407173-130407195 ATGGCTCCTGCCAGATCCCTTGG + Intergenic
1076800616 10:132826360-132826382 CTGGCTCCTGCCTGGCTCCGTGG - Intronic
1076800624 10:132826398-132826420 CTGGCTCCTGCCTGGCTCCATGG - Intronic
1077953047 11:6982640-6982662 CTTGCTCCTGAATGACTACTGGG + Intronic
1078224640 11:9380896-9380918 CTAGCTCCTGAATGCTCCCTGGG + Intergenic
1078305072 11:10175895-10175917 CCGGCTCCTGAATGACTACTGGG + Intronic
1078305088 11:10176073-10176095 CCGGCTCCTGAATGACTACTGGG + Intronic
1078482881 11:11694427-11694449 CTTGCTCCTGAATGACTACTGGG + Intergenic
1078555996 11:12326704-12326726 CTTGCTCCAGACTGACTCCTTGG + Intronic
1078688751 11:13558219-13558241 CGTGCTCCTGAATGATTACTGGG - Intergenic
1078796552 11:14598007-14598029 CTTGCTCCTGAGTGACTACTGGG - Intronic
1078816338 11:14826003-14826025 CTGGCTCCTGAATGACTTTTGGG + Intronic
1078819645 11:14864682-14864704 CTTGCTCCTGAATGACTACTGGG + Intronic
1078833082 11:14995046-14995068 CCTGCTCCTGAATGATTACTGGG + Intronic
1079209522 11:18448942-18448964 AGGGCTCCTGCCTGAATCCTGGG - Intronic
1079231324 11:18651311-18651333 CTGGTTCCTGTGTGCTTCCTTGG - Intergenic
1079690507 11:23411103-23411125 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1079715196 11:23734794-23734816 CTTGCTCCTGAATGACTACTGGG + Intergenic
1079752826 11:24219969-24219991 CCTGCTCCTGAATGATTACTGGG + Intergenic
1079868170 11:25761171-25761193 CGTGCTCCTGAATGATTACTGGG + Intergenic
1079993473 11:27271162-27271184 CTTGCTCCTGAGTGACTACTGGG - Intergenic
1080178114 11:29392022-29392044 CTGGCCCATGAGTGAGTCCTGGG - Intergenic
1080345393 11:31318916-31318938 CTTGCTCCTGAATGACTACTGGG - Intronic
1080864839 11:36184579-36184601 TTGGCTTCTGACAGGTTCCTAGG + Intronic
1081454680 11:43209960-43209982 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1081520549 11:43877262-43877284 ATGGCTCTTAACTAATTCCTGGG - Intergenic
1081750629 11:45508313-45508335 CTGGCTCCTGAATGAAGGCTAGG - Intergenic
1081783313 11:45728539-45728561 CTGGACCCTGACTGATGCCATGG - Intergenic
1081946079 11:46995535-46995557 CTTGCTCCTGAATGACTACTGGG - Intronic
1081958568 11:47116074-47116096 CTTGCTCCTGAATGACTACTGGG - Intronic
1082613588 11:55332539-55332561 CTTGCTCCTGAATGACTACTGGG - Intergenic
1082614016 11:55336730-55336752 CCTGCTCCTGAATGATTACTGGG - Intergenic
1082945367 11:58752723-58752745 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1083009651 11:59384910-59384932 CTTGCTCCTGAATGACTACTGGG - Intergenic
1083117139 11:60472664-60472686 CTTGCTCCTGAATGACTACTGGG + Intergenic
1083345505 11:61987861-61987883 CCTGCTCCTGAATGACTCCTAGG + Intergenic
1083522079 11:63323317-63323339 CTTGCTTCTGAATGACTCCTGGG + Intronic
1083523130 11:63334583-63334605 CAGGCTCCTGAATGACTGCTGGG - Intronic
1084534870 11:69750716-69750738 CTGGCTCCTCACAGACACCTGGG - Intergenic
1084938707 11:72601063-72601085 TTGGCTGCTTACTGATGCCTGGG - Intronic
1085066645 11:73501573-73501595 CCTGCTCCTGAATGACTCCTGGG + Intronic
1085122808 11:73978072-73978094 CTGGCCCCTGACTTTCTCCTTGG + Exonic
1085499287 11:77004352-77004374 CTGGCTCTTGACTGGCTCCTGGG - Intronic
1086301776 11:85434056-85434078 CCTGCTCCTGAATGACTCCTGGG + Intronic
1086308332 11:85506474-85506496 CTTGCTCCTGAATGATTACTGGG - Intronic
1086328516 11:85729473-85729495 CTTGCTCCTGAGTGACTACTGGG + Intronic
1086612610 11:88775698-88775720 CTTGCTCCTGAATGACTACTGGG - Intronic
1086820495 11:91430861-91430883 CCTGCTCCTGAATGACTCCTAGG - Intergenic
1087004952 11:93460937-93460959 CTTGCTCCTGAATGACTACTGGG + Intergenic
1087154358 11:94886219-94886241 CTGGCTGTGGGCTGATTCCTTGG - Intergenic
1087436145 11:98120080-98120102 CCTGCTCCTGAATGATTACTGGG - Intergenic
1087753870 11:102034678-102034700 CTTGCTCCTGAATGACTACTGGG - Intergenic
1087881549 11:103421590-103421612 CTTGCTCCTGAATGACTCTTGGG + Intronic
1087888058 11:103503356-103503378 CTTGCTCCTGAATGACTACTGGG + Intergenic
1088517246 11:110651120-110651142 CCTGCTCCTGAATGACTCCTGGG + Intronic
1088696826 11:112373664-112373686 CTTTCTCCTGCCTGATTGCTCGG + Intergenic
1089323607 11:117642669-117642691 GTGGCTCCTGGCTGCTTCTTGGG + Intronic
1089398709 11:118152451-118152473 CTGGTTCCTGCCTGGTTCATAGG - Intronic
1089945566 11:122469140-122469162 CTGGCTCCAGCCTCACTCCTTGG + Intergenic
1090114381 11:123952530-123952552 CCTGCTCCTCAATGATTCCTGGG + Intergenic
1090486924 11:127121311-127121333 CTGGCTCCTACCTGGTGCCTTGG + Intergenic
1090690165 11:129172677-129172699 CCTGCTCCTGAATGACTCCTGGG + Intronic
1090698839 11:129276930-129276952 CTGCCTCCTGACTACTTCCATGG + Intronic
1091636369 12:2199934-2199956 TGGGCTCCTGAGTGATTCCTGGG - Intronic
1092519229 12:9250207-9250229 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1092718728 12:11419032-11419054 CTTGCTCCTGAATGACTACTGGG + Intronic
1093377844 12:18452823-18452845 CCTGCTCCTGAATGACTCCTGGG - Intronic
1093383069 12:18518991-18519013 CCAGCTCCTGAATGACTCCTGGG - Intronic
1093413384 12:18893485-18893507 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1093476986 12:19566951-19566973 CCTGCTCCTGAGTGATTACTGGG + Intronic
1093597442 12:20978997-20979019 CCGGCTCCTGAGTGACTACTGGG - Intergenic
1093604278 12:21071290-21071312 CTGTCTCCTGAATGATTGTTGGG - Intronic
1093717762 12:22402970-22402992 CCGGCTCCTGAATGACTACTGGG + Intronic
1093782119 12:23148719-23148741 CCTGCTCCTGAATGATTACTGGG + Intergenic
1094054911 12:26259023-26259045 CCTGCTCCTGAATGACTCCTGGG + Intronic
1094114921 12:26900696-26900718 CTTGCTCCTGAATGACTACTGGG + Intergenic
1094135138 12:27117485-27117507 CTGGCTCCTGAATGACTACTGGG - Intergenic
1094275612 12:28671304-28671326 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1095500802 12:42836686-42836708 CCTGCTCCTGAATGATTGCTGGG - Intergenic
1095510064 12:42941719-42941741 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1095866372 12:46977080-46977102 CTTGCTCCTGAATGACTACTGGG - Intergenic
1095935503 12:47676128-47676150 CTTGCTCCTGAATGACTACTGGG + Intronic
1095952586 12:47789952-47789974 CTGGCTCCTGTGTGAAGCCTTGG - Intronic
1095993442 12:48055446-48055468 ATAGCTGCTGACTGATGCCTGGG - Intronic
1096015802 12:48273353-48273375 CTTGCTCCTGAATGACTACTGGG - Intergenic
1096281609 12:50260004-50260026 CTGACTCTTTATTGATTCCTGGG - Intronic
1096468957 12:51864407-51864429 ATGGCTCCTGACTAATTGCCTGG + Intergenic
1096760622 12:53839084-53839106 CTGGCTCCACCCTGACTCCTTGG - Intergenic
1097304755 12:58056927-58056949 CCTGCTCCTGAATGATTACTGGG - Intergenic
1097470412 12:59983770-59983792 CCTGCTCCTGAATGATTCCTGGG + Intergenic
1097642793 12:62202769-62202791 CTTGCTCGTGAATGACTCCTGGG - Intronic
1097741081 12:63243254-63243276 CTTGCTCCTGATTGACTACTGGG + Intergenic
1097749226 12:63333461-63333483 CCTGCTCCTGAGTGACTCCTGGG + Intergenic
1097824812 12:64164323-64164345 CTTGCTCCTGAATGACTCCTGGG + Intergenic
1097910426 12:64963988-64964010 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1097925641 12:65122716-65122738 TTGCCTCCTGCCTAATTCCTCGG + Intergenic
1097960076 12:65523620-65523642 CTGTTTCCTGACTGAATGCTTGG + Intergenic
1098053216 12:66475711-66475733 CTTGCTCCTGAATGACTACTGGG + Intronic
1098389961 12:69959302-69959324 CTGCCTCCTGACTGTTCCCAGGG + Intergenic
1098733612 12:74068787-74068809 CATGCTCCTGAATGATTCCTGGG + Intergenic
1099312066 12:81038740-81038762 CTTGCCCCTTACTGATTTCTGGG - Intronic
1099684032 12:85863451-85863473 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1099767400 12:87005510-87005532 CTTGCTCCTGAATAATTCCTGGG - Intergenic
1099901050 12:88712116-88712138 CTTGCTCCTGAATGACTACTGGG - Intergenic
1100248717 12:92792006-92792028 CTTGCTCCTGAATGACTACTGGG + Intronic
1100381614 12:94067148-94067170 CTTGCTCCTGAATGACTACTGGG + Intergenic
1100417402 12:94392372-94392394 CTTGCTCCTGAATGACTACTGGG + Intronic
1100808554 12:98313633-98313655 CTTGCTCCTGAATGACTACTGGG + Intergenic
1101186519 12:102286457-102286479 CTTGTTCCTGAATGACTCCTGGG - Intergenic
1101243172 12:102858706-102858728 CCTGCTCCTGAATGACTCCTGGG + Intronic
1102793552 12:115668949-115668971 CCGGCTCCTGAATGACTACTGGG + Intergenic
1103032297 12:117626463-117626485 CTTGCTCCTGAATGACTACTGGG - Intronic
1104100270 12:125601348-125601370 CCTGCTCCTGAATGACTCCTGGG + Intronic
1104256112 12:127140559-127140581 CCCGCTCCTGAATGACTCCTGGG - Intergenic
1105328026 13:19387843-19387865 CTGGTTCCTGACGGCTTCTTGGG - Intergenic
1105569851 13:21591756-21591778 CCTGCTCCTGAATGACTCCTGGG + Intronic
1105668198 13:22584137-22584159 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1105748983 13:23404003-23404025 CCTGCTCCTGAATGATTACTGGG - Intronic
1105863880 13:24441846-24441868 CTGGTTCCTGACGGCTTCTTGGG + Exonic
1106757487 13:32837398-32837420 CTTGCACCAGACTGGTTCCTGGG - Intergenic
1107134238 13:36926509-36926531 CTGGGTCTTGATTTATTCCTTGG + Intergenic
1107395339 13:40009994-40010016 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1108160682 13:47635190-47635212 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1108477240 13:50832739-50832761 CTGGCTCCTGAATGACTGCTGGG - Intronic
1108893477 13:55293662-55293684 CTGGCTTCTGCTTGACTCCTAGG - Intergenic
1108940839 13:55950517-55950539 CCTGCTCCTGAATGACTCCTTGG + Intergenic
1109193244 13:59350426-59350448 CTTGCTTCTCACTGTTTCCTGGG + Intergenic
1109216319 13:59593504-59593526 CTTGCTCCTGAATGACTACTGGG + Intergenic
1109553447 13:63936854-63936876 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1109635262 13:65107162-65107184 CCTGCTCCTGACTGACTACTGGG - Intergenic
1110173921 13:72534425-72534447 CTGGCTCCTCTCTGCTCCCTTGG - Intergenic
1110821560 13:79923494-79923516 TCTGCTCCTGAATGATTCCTGGG - Intergenic
1110916188 13:81023953-81023975 GTTGCTCCTGACTGATTTTTGGG + Intergenic
1111040147 13:82737763-82737785 CTTGCTCCTGAATAACTCCTGGG - Intergenic
1111305919 13:86412241-86412263 CCTGCTCCTGAATGATTCCTGGG + Intergenic
1111908148 13:94279700-94279722 CCTGCTCCTGAGTGACTCCTGGG - Intronic
1112411690 13:99169929-99169951 CTTGCTCCTGAATGACTACTGGG - Intergenic
1112478533 13:99753383-99753405 CTTACTCCCGACTGGTTCCTGGG - Intronic
1112584020 13:100700841-100700863 CTTGCTCCTGAATGACTACTGGG + Intergenic
1113131386 13:107041313-107041335 CCGGCTCCTGAATGACTACTAGG - Intergenic
1113167794 13:107462604-107462626 CTGGCCCCTGCCTGGCTCCTGGG + Intronic
1114032132 14:18587103-18587125 CTGGGTCCTGAGAGTTTCCTAGG + Intergenic
1114085249 14:19233435-19233457 CTGGGTCCTGAGAGTTTCCTAGG - Intergenic
1114609363 14:24027450-24027472 CTTGCTCCTGAATGACTACTGGG + Intergenic
1114755528 14:25255225-25255247 CTAGCTCCTGACTCTTTCCTAGG + Intergenic
1114770418 14:25424549-25424571 CTTGCTCCTGAATGACTACTGGG + Intergenic
1114869835 14:26643067-26643089 CTTGCTCCTGAATGACTGCTGGG - Intergenic
1114971420 14:28034273-28034295 CCTGCTCCTGACCGACTCCTGGG - Intergenic
1114981538 14:28170842-28170864 CTTGCTCCTGATTGACTACTGGG + Intergenic
1115035155 14:28848104-28848126 CCTGCTCCTGAATGATTACTGGG + Intergenic
1115224411 14:31088105-31088127 CGGGCTACTGGCTGAATCCTGGG - Intronic
1115295093 14:31816788-31816810 CATGCTCCTGAATGATTACTGGG - Intronic
1115392987 14:32874885-32874907 CTTGCTCCTGAATGATTGTTGGG - Intergenic
1115690688 14:35841109-35841131 CCGGCTCCTGAATGACTACTGGG - Intronic
1115706274 14:36002166-36002188 CTGGCCCTTGACAGGTTCCTGGG + Intergenic
1115774135 14:36697168-36697190 CTTGCTCCTGAGTGACTACTAGG - Intronic
1115792486 14:36895798-36895820 CTTGCTCCTGAATGACTACTGGG - Intronic
1115928555 14:38465310-38465332 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1116177702 14:41493983-41494005 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1116247322 14:42432640-42432662 CTTGCTCCTGAATGACTACTGGG - Intergenic
1116385901 14:44329396-44329418 CTGGCTTCTGTTTCATTCCTGGG - Intergenic
1116398344 14:44474435-44474457 CTGGCTCCTGAATGACTACCGGG - Intergenic
1116681115 14:47971404-47971426 CCTGCTCCTGAATGAGTCCTGGG - Intergenic
1116685442 14:48033371-48033393 CCTGCTCCTGAGTGACTCCTGGG - Intergenic
1117204435 14:53426645-53426667 CTTGCTCCTGAATGACTACTGGG + Intergenic
1117822131 14:59660618-59660640 CTTGCTCCTGAATGACTACTGGG + Intronic
1117822613 14:59666323-59666345 CTTGCTCCTGAATGACTACTGGG + Intronic
1118550748 14:66947100-66947122 CTGGCTCCTCCCTGATTTCTAGG + Intronic
1118646728 14:67847537-67847559 CTTGCTCCTGAATAACTCCTGGG - Intronic
1118662134 14:68026103-68026125 CTTGCTCCTGAATAAGTCCTGGG - Intronic
1118829703 14:69419259-69419281 CTTGCTCCTGAATGACTACTGGG - Intronic
1119915169 14:78392536-78392558 CTGGGTCCTGGCTGATTCTTTGG + Intronic
1119930308 14:78539865-78539887 CTTGCTCCTGAATGACTACTGGG - Intronic
1120113943 14:80591889-80591911 CTTGCTCCTGAATGACTACTGGG + Intronic
1120283348 14:82466346-82466368 CCTGCTCCTGAATGATTCTTGGG + Intergenic
1120368740 14:83605466-83605488 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1120582056 14:86264590-86264612 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1120725038 14:87929224-87929246 CCTGCTCCTGAATGACTCCTAGG + Intronic
1120871314 14:89339700-89339722 CTGCTTCCTCACTGTTTCCTCGG + Intronic
1120883004 14:89429032-89429054 CTGCCTCCTCACTGAGCCCTTGG - Intronic
1120915986 14:89710862-89710884 CTGGGTCTTGACTGACTCTTGGG + Intergenic
1121707064 14:96004825-96004847 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1122226258 14:100281911-100281933 CTGGCACCACACTGATCCCTTGG - Exonic
1122824070 14:104361167-104361189 CTGTGGCCTGACTCATTCCTGGG + Intergenic
1123444321 15:20313771-20313793 CTTGCTCCTGAATGACTACTGGG + Intergenic
1123569330 15:21587177-21587199 CTTGCTCCTGAATGACTTCTGGG - Intergenic
1123605441 15:22022498-22022520 CTTGCTCCTGAATGACTTCTGGG - Intergenic
1124046260 15:26153263-26153285 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1124197208 15:27641988-27642010 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1124667007 15:31601343-31601365 CCTGCTCCTGAATGACTCCTGGG + Intronic
1124724404 15:32143179-32143201 CGGGCTCCTGAATGACTACTGGG - Intronic
1124874164 15:33575497-33575519 CCTGCTCCTGAATGACTCCTGGG + Intronic
1125235162 15:37504533-37504555 CCTGCTCCTGAATGACTCCTAGG + Intergenic
1125246876 15:37650597-37650619 ATGGATCCTGTCTGGTTCCTGGG - Intergenic
1125329724 15:38570867-38570889 CTTGCTCCTGAATGACTACTGGG - Intergenic
1125413970 15:39433372-39433394 CAGTCTCCCAACTGATTCCTAGG + Intergenic
1125584326 15:40809579-40809601 CTGGCTCCTGACTGCCCTCTTGG + Intronic
1125921389 15:43527751-43527773 GTGACTCCGGCCTGATTCCTTGG - Exonic
1126187762 15:45847393-45847415 CTGCCTCCTGACTCATCCCAGGG - Intergenic
1126284299 15:46994035-46994057 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1126542236 15:49836482-49836504 CTTGCTCCTGAATGACTACTGGG - Intergenic
1126554359 15:49969007-49969029 CTTGCTCCTGAATGACTACTAGG + Intronic
1126880425 15:53089037-53089059 CTTGCTCCTGAATGACTTCTTGG - Intergenic
1126897688 15:53276893-53276915 CCTGCTCCTGAATGACTCCTAGG + Intergenic
1127042637 15:54993679-54993701 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1127491502 15:59468968-59468990 CTTGCTCCTGAATGACTACTGGG - Intronic
1127570876 15:60240036-60240058 CTTGCTCCTGAATGACTACTGGG + Intergenic
1127687415 15:61362376-61362398 CCTGCTCCTGAGTGACTCCTGGG - Intergenic
1127970935 15:63960609-63960631 CTTGCTCCTGAATGACTACTGGG - Intronic
1129257533 15:74342575-74342597 CGGGCTCCTGCCTGCTTCCCTGG + Intronic
1129574196 15:76723187-76723209 CCGGCTCCTGAATGACTACTGGG - Intronic
1130135025 15:81175187-81175209 CTGGTTCCTAACTCATTCCTGGG + Intronic
1130452070 15:84065430-84065452 CTTGCTCCTGACTGACTTTTGGG - Intergenic
1130800680 15:87260017-87260039 CTTGCTCCTGAATGACTACTAGG - Intergenic
1131415829 15:92256765-92256787 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1131988937 15:98073776-98073798 CTTGCTCCTGAATGACTTCTGGG - Intergenic
1202977685 15_KI270727v1_random:314270-314292 CTTGCTCCTGAATGACTTCTGGG - Intergenic
1132604134 16:786629-786651 CTGGCTCCTGACTGATTCCTTGG - Intronic
1133014713 16:2934008-2934030 GGGGCTCCTGCCTGCTTCCTGGG - Intronic
1134312649 16:13090060-13090082 CTTGCTCCTGAATGACTACTGGG - Intronic
1134344395 16:13376340-13376362 CTGGAGCCTGACTGATTCTCTGG + Intergenic
1134570101 16:15283656-15283678 CTGGCCCTTGACTGGCTCCTGGG - Intergenic
1134935161 16:18239570-18239592 CTGGCCCTTGACTGGCTCCTGGG - Intergenic
1135824371 16:25713617-25713639 CTGGATCCTGGCCCATTCCTTGG - Intronic
1135865277 16:26095499-26095521 CTTGCTCCTGAATGACTACTGGG + Intronic
1136643250 16:31586305-31586327 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1136659595 16:31745378-31745400 CCTGCTCCTGCATGATTCCTGGG - Intronic
1137070742 16:35902350-35902372 CTATCTCCTGAGTGAATCCTGGG + Intergenic
1137232737 16:46582605-46582627 CTGGCTGCTGGCTGTTTGCTGGG - Intronic
1137336157 16:47551472-47551494 CTTGCTCCTGAATGACTACTGGG - Intronic
1137371713 16:47912730-47912752 CTTGCTCCTGAATGACTGCTGGG + Intergenic
1137572730 16:49577478-49577500 CTGGCTCCTGGCTGGTCGCTGGG - Intronic
1137824764 16:51482509-51482531 CTTGCTCCTGAATGACTCCTGGG - Intergenic
1137890698 16:52159030-52159052 CTTGCTCCTGAATGACTACTGGG - Intergenic
1138324984 16:56157383-56157405 CTTGCTCCTGAATGACTACTGGG + Intergenic
1138887190 16:61093587-61093609 CTTGCTCCTGAATGACTACTGGG + Intergenic
1139225231 16:65228130-65228152 CTGGCTCCTCGCTCTTTCCTGGG - Intergenic
1139280956 16:65770055-65770077 CTGGCTTCTGACTGATGGCTAGG + Intergenic
1139405351 16:66713305-66713327 CTGGCAACTGCCTGATTTCTTGG - Intergenic
1139651631 16:68365198-68365220 CTGGCTCCTGGCTGGATTCTGGG + Intronic
1140094588 16:71864029-71864051 CTGGCTCCTGAAGGAGTCTTGGG - Intronic
1140147680 16:72327268-72327290 CTTGCTCCTGAATGACTACTGGG + Intergenic
1140669815 16:77267021-77267043 CCTGCTCCTGAATGACTCCTGGG - Intronic
1141119634 16:81342514-81342536 CTTGCTCCTGAATGATTACTGGG + Intronic
1141369106 16:83470986-83471008 TTGGCTCCTGACGCCTTCCTTGG + Intronic
1142246892 16:88974329-88974351 CTGGATCCTCACTGACCCCTGGG - Intronic
1142260348 16:89039895-89039917 CTGCCGCCTGACTTCTTCCTCGG + Intergenic
1142355678 16:89600697-89600719 CAGGCTCCAGGCTGAGTCCTAGG + Intergenic
1142916175 17:3140604-3140626 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1143215100 17:5218967-5218989 CTGGCTCTTGACTGGCTCCTGGG + Intronic
1143444862 17:7001667-7001689 CTGGCTCCTGGCAAAGTCCTGGG + Exonic
1145260076 17:21349367-21349389 CTGGATCCTGCCTGATTCCGTGG + Intergenic
1145316542 17:21738571-21738593 CTGGATCCTGCCTGATTCCGTGG - Intergenic
1145714965 17:27010478-27010500 CTGGATCCTGCCTGATTCCGTGG - Intergenic
1146104645 17:30022913-30022935 CTTGCTCCTGAATGACTACTGGG + Intronic
1146608129 17:34279913-34279935 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1146643851 17:34563319-34563341 CTGGGTCCAGAATGATTCGTGGG + Intergenic
1147048704 17:37774440-37774462 CTGGAGCCTGACAGAATCCTGGG + Intergenic
1148890005 17:50800440-50800462 CTGACTCCTGCCTGTGTCCTTGG - Intergenic
1149159554 17:53674832-53674854 CTGGCTCTTATTTGATTCCTTGG - Intergenic
1149196679 17:54130112-54130134 CTTGCTCCTGAATGACTACTGGG - Intergenic
1149199177 17:54162765-54162787 CTTGCTCCTGAATGATTACTGGG + Intergenic
1150190201 17:63230540-63230562 CCTGCTCCTGAATGACTCCTGGG - Intronic
1150196170 17:63302036-63302058 CTTGCTCCTGAATGACTCCTGGG - Intronic
1153857472 18:9164651-9164673 CCTGCTCCTGAATGACTCCTGGG - Intronic
1153865792 18:9267504-9267526 CCTGCTCCTGACTGACTACTGGG + Intronic
1155178988 18:23326931-23326953 CTTGCTCCTGAATGACTACTGGG + Intronic
1155584166 18:27345669-27345691 CTGGCTCCTGACTGCCTGCTTGG + Intergenic
1155723717 18:29052152-29052174 CTTGCTCCTGAATGACTACTGGG - Intergenic
1155779613 18:29814313-29814335 CTTGCTCCTGAATGACTTCTGGG + Intergenic
1155848066 18:30733811-30733833 CCTGCTCCTGAAGGATTCCTGGG + Intergenic
1156230468 18:35149443-35149465 CCTGCTTCTGAATGATTCCTGGG - Intergenic
1156343866 18:36238392-36238414 CCGGCTCCTGAATGACTACTGGG - Intronic
1156529662 18:37803166-37803188 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1156695131 18:39756513-39756535 CCTGCTCCTGAGTGACTCCTGGG + Intergenic
1157057988 18:44253498-44253520 CGTGCTCCTGAATGATTACTGGG - Intergenic
1157692243 18:49692884-49692906 CTGGCTACTCACTCATTTCTTGG - Intergenic
1157945072 18:51970169-51970191 CTTGCTCCTGAATGACTACTGGG - Intergenic
1158041033 18:53093915-53093937 CTGTTTCCTGGCTGTTTCCTTGG + Intronic
1158105376 18:53880101-53880123 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1158413267 18:57226737-57226759 CTTGCTCCTGAATGACTACTGGG + Intergenic
1158676717 18:59526767-59526789 CCTGCTCCTGAATGACTCCTGGG - Intronic
1158956042 18:62539913-62539935 CTGGCTCTTGAGTGAAGCCTAGG - Intronic
1159050570 18:63417809-63417831 CTGGATCCTGACTGATCCTGGGG - Intronic
1159076930 18:63690946-63690968 CCTGCTCCTGAATGACTCCTGGG + Intronic
1159807055 18:72969788-72969810 CCTGCTCCTGAATGATTACTGGG - Intergenic
1159902044 18:74056106-74056128 CTTGCTCCTGAATGACTACTGGG + Intergenic
1159954385 18:74508943-74508965 CTGACTTCTGCCTGAGTCCTGGG + Intronic
1160063568 18:75553475-75553497 CTGGCAGTTGCCTGATTCCTAGG - Intergenic
1160376207 18:78414521-78414543 CTGTCTCCTGACAGCTTCCCAGG - Intergenic
1160442701 18:78904385-78904407 CTGACTCCTGGCTGGTTTCTCGG - Intergenic
1161197150 19:2993359-2993381 CAGGCTCCTGCCTGCTTCCTGGG + Intronic
1161624410 19:5317741-5317763 CTGGCCCCTTACTAATTTCTAGG - Intronic
1161773385 19:6243352-6243374 CTGCCTCCTAACTGACTCCAGGG + Intronic
1163963588 19:20721891-20721913 CTTGCTCCTGAATGACTACTGGG - Intronic
1164360454 19:27502290-27502312 CTTGCTCCTGAATGACTACTGGG + Intergenic
1164553124 19:29228522-29228544 CTTGCTCCTGAATGACTACTGGG + Intergenic
1164556054 19:29252886-29252908 CTTGCTCCTGAATGACTACTGGG - Intergenic
1164833618 19:31341748-31341770 CTGGCTCCTCACTCACTCCTAGG + Intronic
1166179935 19:41101422-41101444 CCTGCTCCTGAATGATTACTGGG + Intergenic
1166901296 19:46065872-46065894 CTGGTTCCTGGCTGCTTCCATGG - Intronic
925432983 2:3812837-3812859 CCTGCTCCTGAATGACTCCTGGG - Intronic
925447225 2:3938139-3938161 CCTGCTCCTGAATGACTCCTGGG - Intergenic
925795466 2:7537240-7537262 CTTGCTCCTGAATGATCACTGGG - Intergenic
925956417 2:8970253-8970275 CCTGCTCCTGAATGATTACTGGG + Intronic
926212893 2:10884372-10884394 TTGCCTGCTGACTGATTCCCTGG - Intergenic
926454146 2:13043166-13043188 CCCGTTCCTGAATGATTCCTGGG + Intergenic
926873430 2:17448434-17448456 CTTGCTCCTGAATGACTCCTGGG + Intergenic
927331987 2:21876114-21876136 CCTGCTCCTGAATGATTTCTGGG - Intergenic
927334507 2:21906578-21906600 CTTGCTCCTGAATGACTACTGGG - Intergenic
927353581 2:22147545-22147567 CTTTCTCTTGACTGATTGCTGGG + Intergenic
927390739 2:22592167-22592189 CCTGCTCCTGAATGACTCCTGGG + Intergenic
927716792 2:25358429-25358451 CAGGCTCCTGCCTGTCTCCTGGG + Intergenic
928354582 2:30598906-30598928 CTTGCTCCTGAATGACTCCTAGG - Intronic
928354699 2:30600253-30600275 CTTGCTCCTGAATGACTCCTGGG + Intronic
928380820 2:30816555-30816577 CCTGCTCCTGAATGATTACTGGG + Intronic
928803970 2:35128109-35128131 CCTGCTCCTGAATGACTCCTGGG + Intergenic
928805776 2:35152540-35152562 CTTGCTCCTGAGTAACTCCTGGG - Intergenic
928880439 2:36091259-36091281 CGTGCTCCTGAATGACTCCTGGG + Intergenic
928883250 2:36121196-36121218 CTTGCTCCTGAATGACTCCTGGG - Intergenic
929082537 2:38135678-38135700 CTTGCTCCTGAATGACTACTGGG - Intergenic
929958094 2:46475307-46475329 CTTGCTCCTGAATGACTACTGGG - Intronic
930275078 2:49301355-49301377 CTTGCTCCTGAATGACTACTGGG + Intergenic
930323602 2:49885063-49885085 CCTGCTCCTGAATGATTACTGGG + Intergenic
930477011 2:51894202-51894224 CTTGCTCCTGAATGAGTACTGGG + Intergenic
930574071 2:53124852-53124874 CTTGCTCCTGAATGATTTTTGGG - Intergenic
930904906 2:56554858-56554880 CTTGCTCCTGAATGACTACTGGG - Intergenic
931815170 2:65893158-65893180 CTTGCTCCTGAATGACTACTGGG + Intergenic
932013754 2:68003372-68003394 CCTGCTCCTGAATGACTCCTGGG + Intergenic
932121079 2:69100832-69100854 CAGGCATCTGACAGATTCCTTGG - Intronic
932272567 2:70423718-70423740 CTGACTCCAGGCTGATTACTGGG + Intergenic
932324188 2:70845060-70845082 CTTGCTCCTGAATGACTACTGGG + Intergenic
932344469 2:70986619-70986641 CTGGCTCCTGAGTGATCTCGGGG + Exonic
933202690 2:79468762-79468784 CCTGCTCCTGAATGATTACTGGG + Intronic
934703008 2:96457592-96457614 CTTGCTCCTGAATGACTACTGGG + Intergenic
934716202 2:96546046-96546068 ATGGCTGCTGACTGATTTCAGGG - Intronic
934877641 2:97940169-97940191 CTTTCTCCTGCCTGATTGCTTGG - Intronic
935489110 2:103695555-103695577 CTTGCTCCTGAATGACTCCTGGG - Intergenic
935952380 2:108342608-108342630 CCTGCTCCTGAATGACTCCTGGG - Intergenic
936036265 2:109114891-109114913 CTTGCTCCTGAATGACTACTGGG - Intergenic
936290620 2:111220942-111220964 CTGGCTCCTCCCTGCTACCTGGG + Intergenic
936701886 2:115020903-115020925 CCTGCTCCTGAATGATTCTTGGG + Intronic
936750086 2:115631669-115631691 CCTGCTCCTGAATGACTCCTGGG - Intronic
936999681 2:118454559-118454581 CTTGCTCCTGAATGACTACTGGG - Intergenic
937148129 2:119664891-119664913 CCTGCTCCTGAATGACTCCTGGG + Intergenic
937189735 2:120083363-120083385 CTTGCTCCTGAATGACTACTGGG - Intronic
937526383 2:122774967-122774989 CTTGCTCCTGAATGACTACTGGG + Intergenic
937679589 2:124629444-124629466 CCTGCTCCTGAATGACTCCTGGG + Intronic
938147809 2:128851822-128851844 CCGGCTCCTGAATGACTACTGGG + Intergenic
938224018 2:129599830-129599852 CCTGCTCCTGAATGACTCCTGGG - Intergenic
938549306 2:132365662-132365684 CCTGCTCCTGAATGACTCCTGGG + Intergenic
938668791 2:133567080-133567102 CAGGCTCCTGAGTGAGTCATGGG + Intronic
939109979 2:137994899-137994921 CCTGCTCCTGAATGACTCCTGGG + Intronic
939317293 2:140567340-140567362 CTATCTGCTGACTTATTCCTTGG + Intronic
939365215 2:141221810-141221832 CCTGCTCCTGAATGACTCCTGGG + Intronic
939391410 2:141573327-141573349 CCTGCTCCTGAATGACTCCTGGG + Intronic
939398622 2:141663070-141663092 CCTGCTCCTGAATGACTCCTGGG + Intronic
940057070 2:149525054-149525076 CCTGCTCCTGAATGACTCCTGGG - Intergenic
940094719 2:149961661-149961683 CCTGCTCCTGAATGACTCCTGGG - Intergenic
940246134 2:151618415-151618437 CTGGGTTCCGATTGATTCCTTGG - Exonic
940273052 2:151912425-151912447 CCTGCTCCTGAATGACTCCTGGG - Intronic
940395500 2:153185715-153185737 CCTGCTTCTGAATGATTCCTGGG - Intergenic
940401635 2:153254727-153254749 CCTGCTCCTGAATGATTACTGGG - Intergenic
940411025 2:153363117-153363139 CATGCTCCTGAATGACTCCTGGG + Intergenic
940592848 2:155751126-155751148 CCTGCTCCTGAATGACTCCTGGG + Intergenic
940814305 2:158281010-158281032 CCTGCTCCTGATTGATTACTGGG + Intronic
940826891 2:158422731-158422753 CTTTCTCCTGCCTGATTGCTCGG - Intronic
940996088 2:160151328-160151350 CTTGCTCCTGAATGACTACTGGG + Intronic
941060909 2:160845622-160845644 CCTGCTCCTGAATGATTCTTGGG + Intergenic
941571363 2:167174842-167174864 CTTGCTCCTGAATGACTACTGGG - Intronic
941973573 2:171379141-171379163 CTTGCTCCGGAATGACTCCTGGG + Intronic
942407545 2:175671526-175671548 CTCGCTCCTGAATGACTACTGGG + Intergenic
942819518 2:180095441-180095463 CTTGCTCCTGAATGATTTCTAGG + Intergenic
942924355 2:181414006-181414028 CCTGCTCCTGAATGACTCCTGGG + Intergenic
943130579 2:183848892-183848914 CTGGCTCCTGAATGACCACTGGG + Intergenic
943296360 2:186145221-186145243 CCTGCTCCTGAATGACTCCTGGG + Intergenic
943628545 2:190225003-190225025 CTTGCTCCTGAATGACTACTAGG + Intronic
943630023 2:190240738-190240760 CTTGCTCCTGAATGACTACTGGG - Intronic
943866277 2:192928426-192928448 CTTGCTCCTGAATGACTACTGGG - Intergenic
944163570 2:196692583-196692605 CCTGCTCCTGAATGACTCCTGGG - Intronic
944608213 2:201372511-201372533 CTTGCTCCTGAATGACTACTGGG + Intergenic
944963299 2:204901216-204901238 CTGGCTCCTGACTGGTTCTCTGG - Intronic
945164587 2:206929268-206929290 CCTGCTCCTGAATGACTCCTGGG + Intergenic
945207516 2:207347328-207347350 CTTGCTCCTGAATGACTACTGGG + Intergenic
945282783 2:208051648-208051670 CTGCCTCCTGATTGGTTACTAGG - Intergenic
945434305 2:209800815-209800837 CTTGCTCCTGAATGACTCCTGGG - Intronic
945524285 2:210868821-210868843 CCTGCTCCTGAATGACTCCTGGG + Intergenic
945944092 2:215977763-215977785 CCTGCTCCTGAATGACTCCTGGG + Intronic
946065033 2:216979977-216979999 CCTGCTCCTGACTGACTACTGGG - Intergenic
946205629 2:218105813-218105835 CTTGCTCCTGAATGACTACTGGG - Intergenic
946513429 2:220385474-220385496 CCTGCTCCTGAATGATTACTGGG - Intergenic
946546666 2:220751597-220751619 CCTGCTCCTGAATGATTCCTGGG - Intergenic
947033780 2:225827458-225827480 CTTGCTTCTGAATGACTCCTGGG + Intergenic
947462236 2:230313515-230313537 CTAGCTCCAGCCTGATACCTGGG - Intergenic
947471357 2:230404026-230404048 CTAGCTCCAGCCTGATACCTGGG - Intergenic
947479908 2:230489772-230489794 CCTGCTCCTGAATGACTCCTGGG - Intronic
947839500 2:233198487-233198509 TTGGCTCATGACTTATCCCTGGG + Intronic
948002651 2:234580840-234580862 CTTGCTGCTGACTGGTTCCCAGG + Intergenic
948399024 2:237669401-237669423 CTGGCAGCTAACTGATTCTTAGG + Intronic
948821124 2:240547245-240547267 CTTGCTCCTGAATGACTACTGGG + Intronic
1168933225 20:1641850-1641872 CCTGCTCCTGAATGACTCCTGGG - Intronic
1169630679 20:7627302-7627324 CTAGCCCCAGCCTGATTCCTTGG + Intergenic
1169695403 20:8382213-8382235 CCTGCTCCTGAATGACTCCTGGG - Intronic
1169973428 20:11296320-11296342 CTGGCTTCTGCCTGATCCCATGG + Intergenic
1170407133 20:16050200-16050222 CTGGCCCCTGTCTGCTTTCTTGG + Exonic
1170469517 20:16654635-16654657 CTGGCTTCTGCCTGATCCCATGG + Intergenic
1170496861 20:16933502-16933524 CCTGCTCCTGAATGATTCCTGGG + Intergenic
1170730265 20:18968336-18968358 CCTGCTCCTGAATGACTCCTTGG + Intergenic
1171513121 20:25703949-25703971 CTGGCTCCTGAATGACTACTGGG - Intergenic
1171934987 20:31266294-31266316 CTTGCTCCTGAATGACTACTGGG - Intergenic
1173091066 20:39972396-39972418 CCTGCTCCTGAATGACTCCTAGG - Intergenic
1173412046 20:42820301-42820323 CCTGCTCCTGAATGACTCCTGGG + Intronic
1174169964 20:48610506-48610528 CTTGCTGATGACTGATTCCATGG - Intergenic
1174968394 20:55245839-55245861 CCTGCTCCTGAATGATCCCTGGG + Intergenic
1176316640 21:5251602-5251624 CATGCTCCTGAATGATTACTGGG - Intergenic
1176760017 21:10772499-10772521 CTTGCTCCTGAATGACTACTGGG + Intergenic
1177373518 21:20237995-20238017 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1177478204 21:21651375-21651397 CTCGCTCCTGGCTGTTTCCATGG - Intergenic
1177712214 21:24792594-24792616 CTGGCTCATGAATGATTCAAAGG + Intergenic
1178811247 21:35883730-35883752 CCTGCTCCTGAATGACTCCTGGG + Intronic
1179112461 21:38459137-38459159 GTGGCTCCTGAGTGATGGCTTGG - Intronic
1179146288 21:38770843-38770865 GTGGCTCCTGATTGGTTTCTAGG - Intergenic
1179355228 21:40652701-40652723 CTTGCCCTTGACTGACTCCTAGG + Intronic
1179566181 21:42250551-42250573 GTGGCCCCTGACTCATTCCCTGG - Intronic
1179929900 21:44560715-44560737 CCTGCTCCTGAATGACTCCTGGG + Intronic
1180394459 22:12317531-12317553 CATGCTCCTGAATGATTACTGGG - Intergenic
1180405286 22:12547217-12547239 CATGCTCCTGAATGATTACTGGG + Intergenic
1180599195 22:17003563-17003585 CCTGCTCCTGAATGATTACTGGG + Intronic
1182078992 22:27515753-27515775 CTGGCCCCAGGATGATTCCTGGG + Intergenic
1182152250 22:28036401-28036423 CCTGCTCCTGAATGATTACTGGG + Intronic
1182433084 22:30312168-30312190 CTTGCTGGTGACTGAGTCCTTGG + Intronic
1182703734 22:32261408-32261430 CTCGCTCCTGCCTCACTCCTGGG - Intergenic
1182938669 22:34252734-34252756 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1182993542 22:34791568-34791590 CTGGCTCCTGAATGACTACTGGG + Intergenic
1184753993 22:46506224-46506246 CTGACTACTGACGGATTGCTGGG + Intronic
1184809447 22:46820492-46820514 CTTGCTCCTGAATGACTCCTGGG - Intronic
949119651 3:370861-370883 CTTGCTCCTGAATGACTCCTAGG - Intronic
949245001 3:1916748-1916770 CTTGCTCCTGAATGACTACTGGG - Intergenic
949427879 3:3939121-3939143 CTTGCTCCTGAATGACTGCTGGG - Intronic
949450281 3:4177422-4177444 CTCGCTCCTGAATGACTACTGGG + Intronic
949683124 3:6538748-6538770 CTTGCTCCTGAATGACTACTGGG - Intergenic
950664695 3:14488179-14488201 CTGGCTCCAGACTGACCCCGAGG + Exonic
950744152 3:15073733-15073755 CTGGCTCCTGCCAGACCCCTGGG + Exonic
950781306 3:15394756-15394778 CTTGCTCCTGAATGACTACTGGG - Intronic
950976059 3:17246877-17246899 CTGGCCCTTGACTGATTCCTGGG + Intronic
951433980 3:22640859-22640881 CCTGCTCCTGAATGACTCCTGGG - Intergenic
951623732 3:24636157-24636179 CATGCTCCTGAATGACTCCTGGG + Intergenic
951769730 3:26242321-26242343 CTTGCTCCTGAATGACTACTGGG - Intergenic
951821067 3:26812672-26812694 CTTGCTCCTGAATGACTACTGGG - Intergenic
951827474 3:26884232-26884254 CTTGCTCCTGAATGACTACTGGG + Intergenic
951996331 3:28734019-28734041 CTTGCTCCTGAATGACTCCTGGG - Intergenic
951997840 3:28751102-28751124 CCTGCTCCTGAATGACTCCTAGG + Intergenic
952574812 3:34761698-34761720 CCTGCTCTTGAATGATTCCTGGG + Intergenic
953047508 3:39307429-39307451 CCTGCTCCTGAGTGATTACTGGG + Intergenic
953053197 3:39364732-39364754 CCTGCTCCTGAATGACTCCTGGG + Intergenic
953652411 3:44819503-44819525 CTTGCTCCTGAATGACTACTGGG - Intronic
953817077 3:46167616-46167638 CTTGCTCCTGAATGACTCTTGGG - Intronic
954528980 3:51301690-51301712 CCTGCTCCTGAGTGACTCCTGGG - Intronic
954828202 3:53394019-53394041 CTTGCTCCTGAATGACTACTGGG + Intergenic
954833477 3:53443997-53444019 CCTGCTCCTGAATGACTCCTGGG - Intergenic
954836232 3:53471197-53471219 CTTGCTCCTGAATGACTACTGGG - Intergenic
955121921 3:56068800-56068822 CCTGCTCCTGAATGATTCCTGGG - Intronic
955303630 3:57808512-57808534 CCTGCTCCTGAATGACTCCTGGG - Intronic
955464646 3:59224087-59224109 CTTGCTCCTGAATGACTACTGGG - Intergenic
956165936 3:66398340-66398362 TTGGCTCCTGAGTCATTCCATGG - Intronic
956340517 3:68218423-68218445 CTGGCTTGTGACTGATTCCCAGG + Intronic
956377148 3:68626284-68626306 CATGCTCCTGAATGATTACTGGG - Intergenic
957268608 3:78000795-78000817 CCTGCTCCTGAATGACTCCTGGG - Intergenic
957584061 3:82112160-82112182 CCTGCTCCTGAATGAATCCTGGG - Intergenic
957629816 3:82704665-82704687 CCTGCTCCTGAATGACTCCTGGG - Intergenic
957678137 3:83396561-83396583 CTTGCTCCTGAATGATTTTTGGG + Intergenic
957689689 3:83552041-83552063 CTTGCTCCTGAATGACTTCTAGG - Intergenic
958030036 3:88097715-88097737 CCGGCTCCTGAATGACTACTGGG + Intronic
958072983 3:88638618-88638640 CCTGCTCCTGAATGACTCCTGGG - Intergenic
958155466 3:89750359-89750381 CTTGCTCCTGAATGACTACTGGG + Intergenic
958483926 3:94679234-94679256 CCTGCTCCTGAATGACTCCTGGG + Intergenic
958656203 3:97006861-97006883 CCTGCTCCTGAATGACTCCTGGG - Intronic
958815448 3:98909353-98909375 CCTGCTCCTGAATGATTCTTGGG + Intergenic
958817458 3:98931536-98931558 CCTGCTCCTGAGTGATTCTTGGG + Intergenic
958956998 3:100475634-100475656 CTTGCTCCTGAATGACTACTGGG - Intergenic
959013158 3:101102175-101102197 CTGGATCCTGAGTCATTACTTGG - Intergenic
959030825 3:101297657-101297679 CCTGCTCCTGAATGACTCCTGGG - Intronic
959076985 3:101759662-101759684 CTGGCCCTTGACTGACTCCTGGG - Intronic
959170582 3:102839533-102839555 CTTGCTCCTGAATGACTACTGGG - Intergenic
959205568 3:103302449-103302471 CCTGCTCCTGAATGACTCCTGGG - Intergenic
959256480 3:104021443-104021465 CCTGCTCCTGAATGACTCCTGGG + Intergenic
959361105 3:105392836-105392858 CCTGCTCCTGAATGACTCCTGGG - Intronic
959479674 3:106855936-106855958 CTTGCTCCTGAATGACTACTGGG + Intergenic
959519801 3:107312484-107312506 CTTTCTCTTGACTGATTCTTTGG + Intergenic
959654588 3:108787624-108787646 CTGTCTCTTGCCTGATTGCTTGG - Intergenic
959694761 3:109237215-109237237 CCTGCTCCTGAATGACTCCTGGG + Intergenic
959725892 3:109541059-109541081 CTTGCTCCTGAATGACTACTGGG + Intergenic
959735261 3:109650780-109650802 CCTGCTCCTGAATGATTACTGGG + Intergenic
959763739 3:109999647-109999669 CTTGCTCCTGAATGACTACTGGG - Intergenic
960654174 3:119984089-119984111 CTTGCTCCTGAATGACTACTGGG + Intronic
960679830 3:120236259-120236281 CCTGCTCCTGAATGACTCCTGGG - Intronic
960681504 3:120252186-120252208 CCTGCTCCTGAATGACTCCTGGG + Intronic
960751910 3:120964530-120964552 CTTGCTCCTGACTGACTACTGGG - Intronic
960764344 3:121109480-121109502 CATGCTCCTGAATGACTCCTGGG - Intronic
960787436 3:121389643-121389665 CTTGCTCCTGAATGACTACTGGG - Intronic
960795063 3:121476840-121476862 CTGGCTCCTGAAGGATACCTTGG - Intronic
960867962 3:122221095-122221117 CTGGCTCCTGGCTTATTGTTGGG - Intronic
960957635 3:123045376-123045398 CTGCCTCCTCAGTGATTGCTTGG - Intergenic
961956308 3:130807533-130807555 CTTGCTCCTGAATGACTGCTGGG + Intergenic
962602549 3:137005025-137005047 CTTGCTCCTGAATGACTACTGGG - Intronic
962645372 3:137433389-137433411 CTTGCTCCTGAATGACTACTGGG + Intergenic
962692220 3:137910160-137910182 CTTGCTCCTGAATGACTCCTGGG + Intergenic
962861568 3:139407462-139407484 CTTGCTCCTGAATGACTACTGGG + Intergenic
962891613 3:139677608-139677630 CTGGCCCCTAACTGAGTCCTGGG - Intronic
962998999 3:140658813-140658835 CCTGCTCCTGAATGACTCCTGGG + Intergenic
963119003 3:141760373-141760395 CCGGCTCCTGAATGACTACTGGG - Intergenic
963522823 3:146377437-146377459 ATTGCTCCTTTCTGATTCCTTGG + Intergenic
963590199 3:147247632-147247654 CTGGCTCCTGATTCATTGTTTGG - Intergenic
963756318 3:149238431-149238453 CCTGCTCCTGAATGACTCCTAGG + Intergenic
963998287 3:151737218-151737240 CTTGCTCCTGAATGACTACTGGG - Intronic
964294889 3:155222918-155222940 CCTGCTCCTGAATGACTCCTGGG - Intergenic
964648811 3:158988843-158988865 CTTGCTCCTGAATGACTTCTGGG - Intronic
964657852 3:159088177-159088199 CCTGCTCCTGAATGATTACTGGG - Intronic
964878524 3:161397322-161397344 CTTGCGCCTGAATGACTCCTTGG + Intergenic
965288542 3:166847226-166847248 CTTGCTCCTGAATGACTCCCAGG - Intergenic
965296388 3:166952759-166952781 CGTGCTCCTGAATGATTACTGGG - Intergenic
965745662 3:171922668-171922690 CCTGCTCCTGAATGATTACTGGG + Intronic
966250231 3:177857726-177857748 TCTGCTCCTGAATGATTCCTGGG - Intergenic
966342422 3:178940126-178940148 CTTGCTCCTGAATGACTACTGGG - Intergenic
966352062 3:179041465-179041487 CTTGCTCCTGAATGACTACTGGG + Intronic
966539365 3:181072607-181072629 CCTGCTCCTGAATGACTCCTAGG - Intergenic
966567080 3:181395843-181395865 ATGGCTCCTGTCTGATACCCAGG + Intergenic
967477890 3:189941979-189942001 TTCCCTCCTGACTCATTCCTGGG - Intergenic
967619352 3:191614083-191614105 CTTGCTCCTGAATGACTACTGGG - Intergenic
967629133 3:191722265-191722287 ATGGCCCTTGGCTGATTCCTGGG - Intergenic
967673820 3:192271884-192271906 CAGGCTACAGACTGACTCCTTGG + Intronic
968088645 3:195886112-195886134 CTGGCTCCTGATAGGTCCCTGGG - Intronic
968382294 4:107458-107480 CCGGCGGCTGCCTGATTCCTGGG - Intergenic
968418333 4:460319-460341 CTTGCTCCTGAATGACTACTGGG + Intronic
968710255 4:2110122-2110144 CCTGCTCCTGAATGACTCCTGGG + Intronic
968826429 4:2901159-2901181 CTGGCTCCTGACGCACACCTGGG - Intronic
968982856 4:3860064-3860086 CTGGGTCCTGCCTGATTCTCCGG + Intergenic
969464809 4:7349965-7349987 CAGAATCCTAACTGATTCCTGGG - Intronic
970116854 4:12707133-12707155 CTGGCTCATGACCAGTTCCTGGG - Intergenic
970155373 4:13136199-13136221 CTTGCTCCTAAATGACTCCTGGG + Intergenic
970165209 4:13229567-13229589 CCTGCTCCTGAATGACTCCTGGG + Intergenic
970412373 4:15821072-15821094 CCTGCTCCTGAATGACTCCTGGG + Intronic
970657093 4:18243157-18243179 CTGGCTGCTGACTGCCTCTTGGG + Intergenic
970727447 4:19063021-19063043 CCTGCTCCTGAATGATTACTGGG + Intergenic
971437510 4:26643310-26643332 CTTGCTCCTGAATGACTACTGGG + Intronic
971507135 4:27378950-27378972 CTTGCTCCTGAATGACTACTGGG - Intergenic
972317569 4:37941782-37941804 CTTGCTCCTGAATGACTACTGGG - Intronic
973011421 4:45079656-45079678 CTTGCTCCTGAATAACTCCTGGG - Intergenic
973178998 4:47244727-47244749 CTTGCTCCTGAATGACTACTGGG + Intronic
973599267 4:52525112-52525134 CTTGCTCCTGAATGACTACTGGG + Intergenic
973624409 4:52757029-52757051 CTGGATCCTGGCTCATTACTTGG + Intergenic
974785591 4:66616298-66616320 CTTGCTCCTGAATGACTCTTGGG - Intergenic
974793287 4:66716797-66716819 CTTGCTCCTGAATGACTACTGGG + Intergenic
974965335 4:68753519-68753541 CATGCTCCTGAATGACTCCTGGG + Intergenic
975006971 4:69302231-69302253 CCTGCTCCTGAATGATTACTGGG + Intronic
975061858 4:70013091-70013113 CTTGCTCCTGAATGATCACTGGG - Intergenic
975076041 4:70210451-70210473 CTTGCTCCTGAATGACTACTGGG - Intergenic
975490122 4:74978842-74978864 CCTGCTCCTGAATGACTCCTGGG + Intronic
975520423 4:75294906-75294928 CTTGCTCCTGAATGACTACTGGG - Intergenic
975524555 4:75334405-75334427 CTTGCTCCTGAATGACTACTGGG + Intergenic
976272352 4:83243682-83243704 CTTGCTCCTGAATGACTACTGGG + Intergenic
976355838 4:84116790-84116812 CTTGCTCCTGAATGACTACTGGG - Intergenic
976492752 4:85691102-85691124 CTTGCTCCTGAATAACTCCTGGG - Intronic
976527589 4:86112472-86112494 CATGCTCCTGAATGACTCCTGGG - Intronic
976790513 4:88873022-88873044 CTTGCTCCTGAATGACTACTGGG + Intronic
976809639 4:89087370-89087392 CTTGCTCCTGAATGACTACTGGG - Intronic
976945235 4:90757624-90757646 CTGGCACTTGTCTGCTTCCTTGG - Intronic
976998479 4:91465238-91465260 CCTGCTCCTGAATGATTACTGGG + Intronic
977462263 4:97339752-97339774 CCTGCTCCTGAATGACTCCTGGG + Intronic
977632699 4:99261056-99261078 CTTGCTCCTGAATGAATACTGGG - Intergenic
977680724 4:99795895-99795917 CCTGCTCCTGAATGACTCCTGGG - Intergenic
977843727 4:101742154-101742176 CTTGCTCCTGAATGACTACTGGG - Intronic
977892687 4:102329913-102329935 CCTGCTCCTGACTGATTACTGGG + Intronic
977906237 4:102480774-102480796 CTTGCTCCTGAATGACTACTGGG + Intergenic
978004582 4:103600718-103600740 CCGGCTCCTGAATGACTACTGGG - Intronic
979179785 4:117710561-117710583 CCTGCTCCTGAATGACTCCTGGG + Intergenic
979206937 4:118049106-118049128 CTTGCTCCTGAATAACTCCTTGG + Intronic
979310775 4:119200540-119200562 CTTGCTCCTGAATGACTACTGGG + Intronic
979390807 4:120125660-120125682 CCTGCTCCTGAATGACTCCTGGG + Intergenic
979445214 4:120804583-120804605 CCTGCTCCTGAATGATTACTGGG + Intronic
979461350 4:120987974-120987996 CCTGCTCCTGAATGATTACTGGG - Intergenic
979487750 4:121287670-121287692 CTGGCTCCTGAATGACTACTGGG + Intergenic
979628256 4:122871081-122871103 CCTGCTCCTGAATGACTCCTGGG - Intronic
979732558 4:124042886-124042908 CCTGCTCCTGAATGATTCTTGGG - Intergenic
979735320 4:124075475-124075497 TCTGCTCCTGAATGATTCCTGGG + Intergenic
979742668 4:124170377-124170399 CCTGCTCCTGAATGACTCCTGGG + Intergenic
979791830 4:124793257-124793279 CCTGCTCCTGAATGACTCCTGGG - Intergenic
980021859 4:127720238-127720260 CCTGCTCCTGAATGACTCCTGGG - Exonic
980090145 4:128434764-128434786 CTTGCTCCTGAATGACTACTGGG - Intergenic
980100051 4:128533146-128533168 CCGGCTCCTGAATGACTACTGGG - Intergenic
980331943 4:131421821-131421843 CCAGCTCCTGAATGATTACTGGG + Intergenic
980411683 4:132428224-132428246 CTTGCTCCTGAATGACTTCTAGG - Intergenic
980626224 4:135378129-135378151 CCTGCTCCTGAATGACTCCTGGG - Intergenic
980865110 4:138545094-138545116 CCTGCTCCTGAATGAATCCTAGG + Intergenic
981201918 4:141990275-141990297 CTTGCTCCTGAATGACTACTGGG - Intergenic
981290414 4:143068870-143068892 CCTGCTCCTGAATGACTCCTGGG - Intergenic
981415250 4:144485319-144485341 CTTGCTCCTGAATGACTACTGGG + Intergenic
981750141 4:148085375-148085397 CCTGCTCCTGAATGATTCTTGGG + Intronic
982052341 4:151514186-151514208 CTTGCTCCTGAATGACTACTGGG + Intronic
982218141 4:153100054-153100076 CTGGCTCCTGAATGACTTTTGGG + Intergenic
982684035 4:158466457-158466479 CCTGCTCCTGAATGATTACTGGG - Intronic
982792790 4:159612680-159612702 CTTGCTCCTGAATGACTACTGGG - Intergenic
982825235 4:159996133-159996155 CCTGCTCCTGAATGACTCCTGGG + Intergenic
982848518 4:160280462-160280484 CCTGCTCCTGAATGACTCCTGGG + Intergenic
983169326 4:164518292-164518314 CCTGCTCCTGAATGACTCCTGGG - Intergenic
983594565 4:169451519-169451541 CTTGCTCCTGAATGACTACTGGG + Intronic
983694167 4:170508347-170508369 CTTGCTCCTGAATGATTGCTGGG - Intergenic
983774652 4:171592302-171592324 CCTGCTCCTGAATGACTCCTGGG - Intergenic
983788314 4:171761820-171761842 CAGGCCCCTGAATGATTACTGGG + Intergenic
984076118 4:175182175-175182197 CCTGCTCCTGAATGACTCCTAGG - Intergenic
984184935 4:176532379-176532401 CTTGCTATTGACTGATACCTTGG - Intergenic
984460265 4:180026887-180026909 CTGGCTCTTGGCTGATACTTGGG + Intergenic
984625820 4:182006986-182007008 CCTGCTCCTGAATGACTCCTGGG - Intergenic
984628247 4:182033301-182033323 CTTGCTCCTGAATGGCTCCTGGG - Intergenic
984854248 4:184179754-184179776 CCTGCTCCTGAATGACTCCTGGG + Intronic
986100589 5:4606456-4606478 CACGCTCCTGAATGACTCCTAGG + Intergenic
986721743 5:10564918-10564940 CTGGCTCCGGACCGGTCCCTCGG + Intronic
986879855 5:12156378-12156400 CTTGCTCCTGAATGACTACTGGG + Intergenic
986915202 5:12611179-12611201 CCTGCTCCTGAATGACTCCTGGG - Intergenic
987312588 5:16694917-16694939 TTGGCTTTTGACTCATTCCTGGG - Intronic
987399555 5:17461259-17461281 CCTGCTCCTGAATGACTCCTGGG - Intergenic
987454154 5:18122228-18122250 CCTGCTCCTGAGTGACTCCTGGG + Intergenic
987584300 5:19834782-19834804 CCTGCTCCTGAATGACTCCTGGG - Intronic
987750076 5:22028073-22028095 CTTGCTCCTGAATGACTACTGGG - Intronic
988172537 5:27678255-27678277 CTTGCTCCTGAATGACTACTGGG + Intergenic
988186541 5:27871381-27871403 CCTGCTCCTGAATGACTCCTGGG + Intergenic
988370524 5:30362496-30362518 CCTGCTCCTGAATGATTACTGGG - Intergenic
988687875 5:33542746-33542768 CTTGCTCCTGAATGACTACTGGG + Intronic
988871845 5:35398960-35398982 CTTGCTCCTGAATGACTACTGGG + Intergenic
988957836 5:36336969-36336991 CTTGCTCCAAACTCATTCCTGGG + Intergenic
989028711 5:37094321-37094343 CTTGCTCCTGAATGATCACTGGG + Intergenic
989696310 5:44204907-44204929 CTTGCTCCTGAATGACTACTGGG - Intergenic
989739838 5:44757788-44757810 CCTGCTCCTGAATGACTCCTGGG + Intergenic
990052866 5:51529775-51529797 TTGGCTCCTGACTAACTCTTTGG + Intergenic
990231641 5:53718858-53718880 CCTGCTCCTGAATGACTCCTGGG + Intergenic
990417228 5:55598030-55598052 CTGGGTCCTGACTTTTTACTGGG + Intergenic
990982069 5:61610868-61610890 GTGGCTCCAGTCTGTTTCCTGGG + Intergenic
991199270 5:63972412-63972434 CCTGCTCCTGAATGACTCCTGGG + Intergenic
991280509 5:64908143-64908165 CCTGCTCCTGAGTGAATCCTGGG - Intronic
991539089 5:67706542-67706564 CCTGCTCCTGAATGATTACTGGG + Intergenic
992235976 5:74709175-74709197 CCTGCTCCTGAATGATTACTGGG + Intronic
992336219 5:75772807-75772829 CCTGCTCCTGACTGACTACTGGG - Intergenic
992368956 5:76122606-76122628 CCTGCTCCTGACTGACTACTGGG + Intronic
993089747 5:83410648-83410670 CCTGCTCCTGAATGACTCCTGGG + Intergenic
993270865 5:85794144-85794166 CCTGCTCCTGAATGATTCCTGGG + Intergenic
993420714 5:87698004-87698026 CCTGCTCCTGAATGACTCCTGGG - Intergenic
993471118 5:88308610-88308632 CTTGCTCCTGAATGACTACTGGG + Intergenic
993587056 5:89744495-89744517 CCTGCTCCTGAATGACTCCTAGG - Intergenic
994116609 5:96068192-96068214 CTGGGCCCTGACTCATTGCTTGG + Intergenic
994222693 5:97214602-97214624 CCTGCTCCTGAATGACTCCTGGG + Intergenic
994299058 5:98124273-98124295 CTTGCTCCAGAATGACTCCTGGG + Intergenic
994350946 5:98745209-98745231 CCTGCTCCTGAATGACTCCTAGG + Intergenic
994437789 5:99761125-99761147 CCGGCTCCTGAATGAGTACTGGG - Intergenic
994696357 5:103077328-103077350 CCTGCTCCTGAATGACTCCTGGG - Intergenic
994707853 5:103227484-103227506 CTTGCTCCTGAATGACTTCTGGG + Intergenic
994978461 5:106841614-106841636 CTTGCTCCTGAATGACTACTGGG + Intergenic
995110753 5:108426108-108426130 CCTGCTCCTGAATGACTCCTGGG - Intergenic
995457311 5:112366138-112366160 CTGACTGCTGAGTGATGCCTGGG - Intronic
995608150 5:113880355-113880377 CTCACTCCTGGCTGATTTCTTGG - Intergenic
995660709 5:114479764-114479786 CCGGCTCCTGAATGACTCTTGGG + Intronic
995814527 5:116152115-116152137 CTTGCTCCTGAATGACTACTGGG - Intronic
996242876 5:121224403-121224425 CTTGCTCCTGAATGACTACTGGG + Intergenic
996481960 5:123985879-123985901 CCTGCCCCTGACTGACTCCTGGG - Intergenic
996830012 5:127729753-127729775 CCTGCTCCTGAATGACTCCTGGG + Intergenic
996894109 5:128458681-128458703 CCTGCTCCTGAATGACTCCTGGG + Intronic
996965511 5:129303353-129303375 CCTGCTCCTGAGTGACTCCTGGG - Intergenic
997067797 5:130582486-130582508 CCTGCTCCTGAATGACTCCTGGG + Intergenic
997069962 5:130609894-130609916 CCTGCTCCTGAATGATTACTGGG + Intergenic
997097714 5:130931934-130931956 CCTGCTCCTGAATGACTCCTGGG + Intergenic
997343643 5:133168464-133168486 CTTGCTCCTGAATGACTACTGGG - Intergenic
998786098 5:145710594-145710616 CTGCCTCCTGACTTCTTTCTTGG - Intronic
998789159 5:145746915-145746937 CCTGCTCCTGAATGACTCCTGGG + Intronic
999130121 5:149276077-149276099 CTTGCTGCTGACTGCCTCCTTGG + Intronic
999438655 5:151584159-151584181 CTGTCTCCTTCCTGGTTCCTAGG - Intergenic
999560001 5:152790436-152790458 CTTGCTCCTGAATGACTACTGGG + Intergenic
999597198 5:153217745-153217767 CCTGCTCCTGAATGACTCCTGGG + Intergenic
999607922 5:153336682-153336704 CCTGCTCCTGAATGATTCCTGGG - Intergenic
999620977 5:153473195-153473217 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1000148673 5:158478430-158478452 CTGGCTCATGACTGAGCCCTGGG + Intergenic
1000237379 5:159374953-159374975 CATGCTCCTGAATGATTACTGGG - Intergenic
1000523780 5:162330112-162330134 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1000999844 5:167995181-167995203 ATGGCTCCTGCCTGATTTATGGG + Intronic
1001288294 5:170439220-170439242 AAGGCTTCTGATTGATTCCTGGG - Intronic
1001344011 5:170874102-170874124 CTTGCTCCCGAATGACTCCTGGG - Intronic
1001738854 5:174032839-174032861 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1001898329 5:175400517-175400539 CTTGCTCCTGAATGACTACTGGG + Intergenic
1001911656 5:175523877-175523899 CTGGCTCCTCAGTTTTTCCTTGG + Intronic
1002026999 5:176402524-176402546 CTGCCTCCTGATTGAGGCCTTGG + Intronic
1002185601 5:177453511-177453533 ATGGCTCCTGTCTGACTCCATGG - Intronic
1002597842 5:180335640-180335662 CTGCCTCCTGACTGAGGCCCAGG + Intronic
1002657247 5:180759933-180759955 CTTGCTCCTGAATGACTACTGGG - Intergenic
1003411718 6:5869896-5869918 GTGGCAACTGACCGATTCCTGGG + Intergenic
1003605990 6:7561477-7561499 CTGCCTCCTGACTGGCTGCTGGG - Intronic
1003647764 6:7928566-7928588 CTTGCTCCTGAATGACTACTGGG + Intronic
1003686812 6:8312559-8312581 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1003823347 6:9925005-9925027 CTGGCTCCAGGCAGATTGCTTGG - Intronic
1003991627 6:11492478-11492500 CTGGATCCTGATGGATACCTCGG + Intergenic
1004983797 6:21057770-21057792 CCTGCTCCTGAATGACTCCTGGG - Intronic
1005120748 6:22387232-22387254 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1005221441 6:23593223-23593245 CTGGATCTTGACTGACTACTGGG - Intergenic
1005795151 6:29352442-29352464 CCTGCTCCTGACTGACTTCTAGG - Intergenic
1006950548 6:37818929-37818951 CTGGCTCCTGGGCGATTCCGGGG - Intergenic
1007988124 6:46228033-46228055 CCTGCTCCTGAATGATTACTGGG - Intronic
1008082958 6:47212906-47212928 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1008083424 6:47218689-47218711 CTTGCTCCTGAATGACTACTGGG + Intergenic
1008243986 6:49148344-49148366 CCTGCTCCTGAATGAATCCTGGG - Intergenic
1008431428 6:51421904-51421926 CTTGCTCCTGAATGATTGTTGGG + Intergenic
1008789533 6:55213659-55213681 TTGGCTCCTGACTACTTTCTTGG + Intronic
1008871141 6:56273115-56273137 CTTGCTCCTGAATAATTTCTGGG + Intronic
1009027450 6:58016878-58016900 CTGGCCCTTGACAGACTCCTGGG - Intergenic
1009050961 6:58276160-58276182 CCTGCTCCTGAATGATTACTGGG + Intergenic
1009202985 6:60768361-60768383 CTGGCCCTTGACAGACTCCTGGG - Intergenic
1009237218 6:61137547-61137569 CCTGCTCCTGAATGATTACTGGG + Intergenic
1009239463 6:61166224-61166246 CCTGCTCCTGAATGATTACTGGG - Intergenic
1009706896 6:67263879-67263901 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1009739962 6:67731845-67731867 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1009867134 6:69411620-69411642 CTTGCTCCTGAGTGATCACTGGG + Intergenic
1010027912 6:71240687-71240709 CCTGCTCCTGAATGATTGCTGGG + Intergenic
1010102217 6:72123230-72123252 CCTGCTCCTGAATGATTACTGGG - Intronic
1010125760 6:72429935-72429957 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1010275099 6:73959915-73959937 CTTTCTCCTGCCTGATTCCCTGG + Intergenic
1010276701 6:73976280-73976302 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1010319173 6:74486745-74486767 CCTGCTCCTGAATGATTACTGGG + Intergenic
1011138146 6:84121686-84121708 CTTGCTCCTGAATGACTCCTGGG + Intergenic
1011289381 6:85760568-85760590 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1011336731 6:86269786-86269808 CTTGCTCCTGAATGACTGCTGGG - Intergenic
1011365814 6:86581347-86581369 CCTGCTCCTGAATGATTGCTGGG - Intergenic
1011537646 6:88393584-88393606 CTTGCTCCTGAATGACTACTGGG + Intergenic
1011815855 6:91189479-91189501 CTTGCTCCTGAATGGTTACTGGG - Intergenic
1011953604 6:92998035-92998057 CCGGCTCCTGAATGACTACTGGG + Intergenic
1012075293 6:94675096-94675118 GTTGCTCCTGAATGACTCCTGGG + Intergenic
1012596845 6:101051415-101051437 CCTGCTCCTGAATGATTACTGGG - Intergenic
1012740902 6:103015777-103015799 CTTGATCCTAAATGATTCCTAGG - Intergenic
1012784339 6:103604188-103604210 CCTGCTCCTGAGTGACTCCTGGG - Intergenic
1012922135 6:105231274-105231296 CTTGCTCCTGAATGACTACTGGG - Intergenic
1013305865 6:108846763-108846785 CTGGAGCCTGACTCACTCCTGGG + Intergenic
1013461804 6:110381468-110381490 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1013577516 6:111499287-111499309 CTGACTCTTGCCTGATTACTAGG + Intergenic
1013919822 6:115390887-115390909 CTTGCTCTTGAATGACTCCTGGG - Intergenic
1013944225 6:115703648-115703670 CTGGGTCTTGCCTGATGCCTGGG + Intergenic
1013975509 6:116073903-116073925 CTGGCTCCTGGCTGCTGCCAGGG + Intergenic
1014064938 6:117113438-117113460 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1014085067 6:117332728-117332750 CTTGCTCCTGAATGGCTCCTGGG + Intronic
1014422617 6:121263820-121263842 CCTGCTCCTGAATGACTCCTAGG + Intronic
1014431057 6:121371125-121371147 CCTGCTCCTGAATGATTACTGGG + Intergenic
1014731737 6:125039831-125039853 CCTGCTCCTGAATGACTCCTGGG + Intronic
1014938290 6:127409864-127409886 CTTGCTCCTGAATGACTACTGGG - Intergenic
1015136743 6:129880792-129880814 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1015368315 6:132422807-132422829 CTTGATCCTGAGTGATTCCTGGG - Intergenic
1015796206 6:137014110-137014132 CTGGCTCCTGAGAAACTCCTTGG + Intronic
1016338253 6:143032482-143032504 CTTGCTCCTGAATGACTACTGGG - Intergenic
1016453376 6:144206983-144207005 CTTGCTCCTGAATGACTTCTTGG - Intergenic
1016618919 6:146084495-146084517 CCTGCTCCTGAATGATTCCTGGG - Intronic
1017968409 6:159287805-159287827 CTTGCTCCTGAATGACTACTGGG - Intergenic
1018175545 6:161175895-161175917 CTGGCTCCTGAATGACTACTGGG - Intronic
1018262556 6:161984914-161984936 CTGACCTCTGACTCATTCCTGGG + Intronic
1018345926 6:162899361-162899383 CTGGGCCCTGACTCATTCCTGGG - Intronic
1018507575 6:164488210-164488232 CTTGCTCCTGAGTGACTACTGGG - Intergenic
1018529072 6:164743718-164743740 TTGGCGCCTGACTTATTCCCTGG + Intergenic
1018812712 6:167308996-167309018 CTGGCTCCTGCTTGGCTCCTTGG - Intronic
1019113260 6:169735541-169735563 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1019944000 7:4312299-4312321 CTGGCTCCTGCTTGACTTCTGGG - Intergenic
1020244419 7:6419740-6419762 CTGGCCCCTGACGGGTTTCTGGG + Intronic
1020447288 7:8282546-8282568 ATGACTCCTGACTTGTTCCTGGG + Intergenic
1020636238 7:10698751-10698773 CCTGCTCCTGAGTGATTACTGGG + Intergenic
1022506584 7:30911616-30911638 CTGCCTCCTGCCTGCCTCCTTGG + Intergenic
1022634929 7:32122597-32122619 CCTGCTCCTGAATGACTCCTGGG + Intronic
1022686106 7:32598177-32598199 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1023717844 7:43061843-43061865 CCAGCTCCTGAATGATTACTGGG + Intergenic
1023894618 7:44422021-44422043 CTTGCTCCTGAATGACTACTGGG + Intronic
1024099789 7:46018298-46018320 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1024153219 7:46593776-46593798 CTTGCTCCTGAATGACTACTGGG + Intergenic
1024372636 7:48604489-48604511 CCTGCTCCTGAATGATTACTGGG - Intronic
1024375549 7:48634058-48634080 CTTGCTCCTGAATGACTTCTGGG + Intronic
1024590246 7:50875240-50875262 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1024591530 7:50889739-50889761 CTTGCTCCTGAATGACTACTGGG + Intergenic
1024666804 7:51555390-51555412 CTTGCTCCTGACAGACTACTGGG - Intergenic
1024907657 7:54406496-54406518 CTTGCTCCTGAATGACTCTTGGG - Intergenic
1024990290 7:55229359-55229381 CCTGCTCCTGAATGACTCCTGGG - Intronic
1025249994 7:57345218-57345240 CTTGTTCCTGGCTGTTTCCTGGG - Intergenic
1027506524 7:79022260-79022282 CTTGCTCCTGAATGACTTCTGGG + Intronic
1027944314 7:84725481-84725503 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1028027900 7:85869310-85869332 CATGCTCCTGAATGACTCCTGGG + Intergenic
1028099337 7:86800024-86800046 CCTACTCCTGACTGACTCCTGGG + Intronic
1028279681 7:88906494-88906516 CTTGCTCCTGAATAACTCCTGGG - Intronic
1028528218 7:91808941-91808963 CTTGCTCCTGAATGATGCCTGGG - Intronic
1029001845 7:97162648-97162670 CTTGCTCCTGAATGACTACTGGG - Intronic
1029041730 7:97582918-97582940 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1029053099 7:97710271-97710293 CTTGCTCCTGAATGACTACTGGG - Intergenic
1029322205 7:99773579-99773601 CTTGCTCCTGAATGACTACTGGG + Intronic
1029801752 7:102955275-102955297 CTTGCTCCTGAATGACTACTGGG + Intronic
1030697326 7:112600109-112600131 CTTGCTCCTGAATGACTACTGGG + Intergenic
1031311866 7:120208653-120208675 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1031434028 7:121710717-121710739 CTTGCTCCTGAATGACTACTGGG - Intergenic
1032154765 7:129458800-129458822 CTGGCTACAGAGTGGTTCCTAGG + Intronic
1033791832 7:144799599-144799621 CTTGCTCCTGATTGGCTCCTGGG + Intronic
1034450026 7:151132293-151132315 GAGGCTGCTCACTGATTCCTCGG + Intronic
1034708276 7:153167441-153167463 CTTGCTCCTGAATGATTTTTGGG - Intergenic
1035008534 7:155689731-155689753 CCTGCTCCTGACTGACTACTGGG - Intronic
1035599206 8:886629-886651 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1035696234 8:1599125-1599147 CTTGCTCCTGAATGACTACTGGG - Intronic
1035921376 8:3679918-3679940 CTTGCTCCTGAATGACTACTGGG + Intronic
1036407513 8:8468364-8468386 TTGGCACCTGACTTATTTCTGGG - Intergenic
1036858799 8:12326575-12326597 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1036955553 8:13184557-13184579 CTTGCTCCTGAATGACTACTGGG - Intronic
1037154358 8:15681920-15681942 CTTGCTCCTGAATGATTTTTGGG - Intronic
1037183260 8:16032494-16032516 TTGGCTCCTGAATGACTACTGGG - Intergenic
1037230286 8:16650334-16650356 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1037249305 8:16874551-16874573 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1037576576 8:20210547-20210569 CTGTCTTCTTACTGATTTCTAGG + Exonic
1038073969 8:24048896-24048918 CGTGCTCCTGAATGACTCCTGGG + Intergenic
1038221479 8:25612608-25612630 CTCGCTCCTGAATGACTGCTGGG - Intergenic
1038243060 8:25828442-25828464 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1038384260 8:27127126-27127148 CTGGTTCCTCACTTATTCCCTGG + Intergenic
1038512062 8:28147329-28147351 CTGGCACCTGACTGATGCAGAGG + Intronic
1038518592 8:28208997-28209019 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1039134135 8:34300455-34300477 CTTGCTCCTGAATGACTACTGGG + Intergenic
1039138785 8:34358909-34358931 TCTGCTCCTGAATGATTCCTGGG - Intergenic
1039299920 8:36198515-36198537 CCTGCTCCTGACTGACTACTGGG - Intergenic
1039402516 8:37282108-37282130 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1040442590 8:47459892-47459914 CCTGCTCCTGAATGATTACTGGG - Intronic
1040444624 8:47481146-47481168 CTGTCTTCTGACTGACTTCTTGG + Intronic
1040613018 8:49004794-49004816 CCTGCTCCTGAATGATTACTGGG - Intergenic
1040613927 8:49015755-49015777 CCTACTCCTGAATGATTCCTGGG - Intergenic
1040842132 8:51795529-51795551 CCTGCTCCTGAATGACTCCTGGG + Intronic
1041129753 8:54685412-54685434 CCTGCTCCTGAATGAATCCTGGG - Intergenic
1041351641 8:56952950-56952972 TTGGCTCTTGACTAATTTCTAGG + Intergenic
1041974126 8:63777442-63777464 CTTGCTCCTGAATGACTACTGGG - Intergenic
1042038415 8:64564056-64564078 CTTGCTCCTGAATGACTACTGGG - Intergenic
1042308453 8:67356196-67356218 CTTGCTCCTGAATGACTACTGGG - Intergenic
1042614074 8:70629917-70629939 CTTGCTCCTGAATGACTACTGGG - Intronic
1042630235 8:70808150-70808172 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1042636270 8:70879038-70879060 CTTGCTCCTGAATGACTACTTGG + Intergenic
1042846856 8:73177123-73177145 CTGGCTTCTGCCTGTTTCATGGG - Intergenic
1043081405 8:75769822-75769844 CTTGCTCCTGAATGACTACTGGG - Intergenic
1043092821 8:75926751-75926773 CAGGCTCCTGATTGACTCCTGGG + Intergenic
1043165605 8:76899334-76899356 CTTGCTCCTGAATGACTACTGGG - Intergenic
1043177872 8:77044728-77044750 CCTGCTCCTGAATGATTACTGGG + Intergenic
1043181509 8:77091165-77091187 CCTGCTCCTGAATGATTACTGGG + Intergenic
1043244165 8:77976997-77977019 CTTGCTCCTGAATGACTACTGGG - Intergenic
1043366049 8:79534721-79534743 CCTGCTCCTGAGTGATTACTGGG - Intergenic
1043547231 8:81329113-81329135 CTTGCTCCTGAATGACTACTGGG - Intergenic
1043725411 8:83604605-83604627 CTTGCTCCTGAATGACTACTGGG + Intergenic
1044038331 8:87334630-87334652 CTTGCTCCTGAATGACTACTGGG - Intronic
1044135634 8:88582316-88582338 CTTGCTCCTGAATTACTCCTGGG - Intergenic
1044576688 8:93777611-93777633 CTTGCTCCTGAATGACTACTGGG - Intronic
1044619663 8:94176523-94176545 CTGGCCCCTGCCTGTTACCTGGG + Exonic
1045017753 8:98013499-98013521 CTGGCACCTAACAGATCCCTAGG - Intronic
1045152453 8:99424442-99424464 CCTGCTCCTGAATGATTACTGGG + Intronic
1045164711 8:99590594-99590616 CTTGCTCCTGAATGACTACTTGG - Intronic
1045202004 8:99992999-99993021 CTTGCTCCTGAATGACTACTGGG + Intronic
1045705184 8:104914451-104914473 CCTGCTCCTGAATGACTCCTGGG - Intronic
1045877799 8:107002605-107002627 CCTGCTCCTGAAAGATTCCTGGG + Intergenic
1046338628 8:112823579-112823601 CCTGCTCCTGAATGACTCCTGGG - Intronic
1047121630 8:121911127-121911149 CTTGCTCCTGAATGACTACTGGG + Intergenic
1047129603 8:122004135-122004157 CTTGCTCCTGAATGACTACTGGG + Intergenic
1047473178 8:125199438-125199460 CTTGCTCCTGAATGACTACTGGG - Intronic
1048291709 8:133186193-133186215 GTGGCTCCTGACTGCTGCCTTGG - Intergenic
1048429041 8:134351507-134351529 CTTGCTCCTGAATGACTCCTGGG - Intergenic
1048852495 8:138658258-138658280 CAGGCTGCTGCCTGGTTCCTGGG + Intronic
1049298726 8:141857596-141857618 CTGGCTCCAGCCTGTGTCCTTGG + Intergenic
1049339483 8:142104452-142104474 CTGGCTCATGGCTGTGTCCTAGG - Intergenic
1049436562 8:142588797-142588819 CTGGCATCTGCCTGATTTCTGGG - Intergenic
1049964884 9:769619-769641 CTTGCTCCTGAATGACTACTGGG + Intergenic
1050011871 9:1193380-1193402 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1050630329 9:7551585-7551607 CTTGCTCCTGAATGATTCCATGG + Intergenic
1050645572 9:7715782-7715804 CTTGCTCCTGAATGACTACTGGG + Intergenic
1050661025 9:7882766-7882788 CCCGCTCCTGAATGACTCCTGGG + Intronic
1051035903 9:12744946-12744968 CTTGCTCCTGAATGACTCCTGGG - Intergenic
1051458830 9:17291062-17291084 CCTGCTCCTGAATGACTCCTGGG - Intronic
1051598749 9:18851127-18851149 CTGTCTCCTGAATGATTTTTTGG - Intronic
1051670195 9:19502387-19502409 CTTGCTCCTGAATGACTACTGGG - Intergenic
1052134354 9:24891634-24891656 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1052217582 9:25985445-25985467 CTTGCTCCTGAATGAATACTGGG + Intergenic
1052258601 9:26489399-26489421 CCTGCTCCTGAGTGATTCTTGGG - Intergenic
1052369573 9:27648353-27648375 CCTGCTCCTGAATGATTCCTGGG + Intergenic
1052387003 9:27834676-27834698 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1052421120 9:28244208-28244230 CCTACTCCTGAATGATTCCTGGG + Intronic
1052562986 9:30109614-30109636 CTTGCTCCTGAATGACTACTGGG + Intergenic
1052673417 9:31587607-31587629 CTGGCTCCAGTCTGATGCCATGG - Intergenic
1053039136 9:34854535-34854557 CCTGCTCCTGAATGATTCGTAGG - Intergenic
1055138146 9:72846805-72846827 CATGCTCCTGACTGATTGTTGGG + Intergenic
1055343066 9:75306215-75306237 CGTGCTCCTGAATGACTCCTGGG - Intergenic
1055509521 9:76982252-76982274 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1055804216 9:80074810-80074832 CTGGCTCAAAACTGATTCCCCGG - Intergenic
1055842012 9:80516662-80516684 CCGGCTCCTGAATGACTCTTGGG - Intergenic
1056049648 9:82755100-82755122 CCTGCTCCTGAATGATTACTGGG - Intergenic
1056051320 9:82772626-82772648 CCTGCTCCTGAATGATTACTGGG - Intergenic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1057712063 9:97454569-97454591 CCTGCTCCTGAATGACTCCTGGG + Intronic
1058096699 9:100869685-100869707 CCTGCTCCTGAATGATTACTGGG + Intergenic
1058563728 9:106258623-106258645 CTTGCTCCTGAATGACTACTGGG - Intergenic
1058591349 9:106568346-106568368 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1058794272 9:108483147-108483169 CTGCCTCCTTCCTCATTCCTGGG - Intergenic
1058925866 9:109663445-109663467 CTTGCTCCTGAATGACTACTGGG - Intronic
1059076904 9:111202844-111202866 CCTGCTCCTGAATGATTCTTGGG + Intergenic
1059173181 9:112145846-112145868 CTGCCCCCTGAATGACTCCTGGG - Intronic
1059673280 9:116512260-116512282 CGTGCTCCTGACTGACTACTGGG - Intronic
1059683647 9:116612603-116612625 CTTGCTCCTGAATGACTACTGGG + Intronic
1059912978 9:119066676-119066698 CTTGCTCCTGAATGACTACTGGG - Intergenic
1060026850 9:120179838-120179860 CTTGCTCCTGAATGACTCCTGGG + Intergenic
1060305904 9:122411887-122411909 CCTGCTCCTGAGTGATTACTGGG - Intergenic
1060654991 9:125365434-125365456 GTGGCTGCTGAATGTTTCCTGGG - Intronic
1061668631 9:132175293-132175315 CTGGCTCCTGACCGCTCGCTAGG + Intronic
1062073206 9:134570222-134570244 CTGCCTCCTCACTGCCTCCTTGG + Intergenic
1062308949 9:135925574-135925596 CTGGCCCCGGACTCACTCCTGGG + Intergenic
1185952749 X:4454512-4454534 CCTGCTCCTGAATGACTCCTAGG + Intergenic
1186237183 X:7526005-7526027 CTTGCTCCTGAGTGACTACTGGG + Intergenic
1186247977 X:7634538-7634560 CTTGTTCCTGAATGACTCCTGGG + Intergenic
1186431219 X:9506184-9506206 CTTGCTCCTGGATGACTCCTGGG + Intronic
1186523455 X:10226277-10226299 CCTGCTCCTGAATGACTCCTGGG + Intronic
1186738538 X:12492961-12492983 CCGGTTCCTTACTGATTCATGGG + Intronic
1186866704 X:13727482-13727504 CTTGCTCCTGAATGACTACTGGG + Intronic
1187325296 X:18281234-18281256 CTTGCTCCTGAATAACTCCTGGG + Intronic
1187839672 X:23474247-23474269 CTTGCTCCTGAATGACTACTGGG - Intergenic
1188092440 X:25979619-25979641 ATTGCTCCTGAATGACTCCTGGG + Intergenic
1188704905 X:33315305-33315327 CTGGCTCTTGACTGGCTTCTGGG + Intronic
1188708124 X:33360345-33360367 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1189501535 X:41564967-41564989 CTTGCTCCTGATTGACTACTGGG + Intronic
1190529951 X:51364499-51364521 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1190592951 X:52023694-52023716 CCGGCTCCTGAATGACTACTGGG - Intergenic
1190604050 X:52122031-52122053 CCTGCTCCTGAATGATTACTGGG + Intergenic
1190721011 X:53147850-53147872 CTGGCTCCTGAAAGACTACTGGG + Intergenic
1190807381 X:53851702-53851724 CCGGCTCCTGAATGACTACTGGG - Intergenic
1190820890 X:53971219-53971241 CCTGCTCCTGAATGACTCCTGGG + Intronic
1190890031 X:54559858-54559880 CTGGCTCCACACTGAGTCCTGGG + Intronic
1190905112 X:54719638-54719660 CCTGCTCCTGAATGATTACTGGG - Intergenic
1190922219 X:54864581-54864603 CCTGCTCCTGAGTGATTACTGGG + Intergenic
1190972071 X:55359350-55359372 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1190995432 X:55603780-55603802 CTTGCTCCTGAATGACTACTGGG - Intergenic
1191028809 X:55945089-55945111 CTTGCTCCTGAATGACTACTGGG - Intergenic
1191037453 X:56042135-56042157 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1191049935 X:56180720-56180742 CTTGCTCCTGAATGACTACTAGG - Intergenic
1191118072 X:56871856-56871878 CTTGCTCCTGAATGACTACTGGG + Intergenic
1191186329 X:57616599-57616621 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1191186934 X:57623356-57623378 CTTGCTCCTGAATGACTACTGGG + Intergenic
1191266375 X:58398508-58398530 CTTGCTCCTGAATGATTACTGGG + Intergenic
1191681178 X:63841513-63841535 CTTGCTCCTGAATGACTACTGGG + Intergenic
1191780743 X:64862366-64862388 CTTGCTCCTGAATGACTCTTGGG - Intergenic
1191882167 X:65853889-65853911 CTTGCTCCTGAATGACTACTGGG - Intergenic
1192007916 X:67236960-67236982 CTTGCTCCTGAATGACTACTGGG + Intergenic
1192096732 X:68219663-68219685 CTTGCTCCTGAATGACTACTGGG + Intronic
1192132243 X:68563036-68563058 CTTGCTCCTGAATGACTACTGGG - Intergenic
1192303033 X:69926415-69926437 CCTGCTCCTGAATGACTCCTGGG - Intronic
1192703429 X:73501194-73501216 CTTGCTCCTGAATGACTACTGGG + Intergenic
1192704395 X:73513790-73513812 CCGGCTCCTGAATGACTACTGGG + Intergenic
1192957813 X:76092406-76092428 CTTGCTCCTGAATGACTACTGGG - Intergenic
1192964460 X:76162205-76162227 CTTGCTCCTGAATGACTACTGGG + Intergenic
1192977397 X:76300666-76300688 CAGGCTCCTGAATGACTACTGGG - Intergenic
1193039569 X:76990221-76990243 CTTGCTCCTGAATGGCTCCTGGG + Intergenic
1193091419 X:77497348-77497370 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1193233275 X:79074432-79074454 CTGGCTCCTCAGTGACTACTGGG + Intergenic
1193259013 X:79382927-79382949 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1193412172 X:81177947-81177969 CTTGCTCCTGAGTGACTACTGGG + Intronic
1193435696 X:81472730-81472752 CTTGCTCCTGAATGACTACTGGG - Intergenic
1193453053 X:81694566-81694588 CCTGCTCCTGAATGATTCCTGGG - Intergenic
1193605643 X:83564978-83565000 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1193672048 X:84398950-84398972 CCTGCTCCTGAATGACTCCTGGG + Intronic
1193727703 X:85062138-85062160 CCTGCTCCTGAATGATTACTGGG - Intronic
1193806826 X:86005146-86005168 CTTGCTCCTGAATGACTACTGGG + Intronic
1193931315 X:87555977-87555999 CCTGCTCCTGAATGATTACTGGG - Intronic
1194132855 X:90103749-90103771 CTTGCTCCTGAATGACTCTTGGG - Intergenic
1194772649 X:97923929-97923951 CTTGCTCCTGAATGACTACTGGG + Intergenic
1194852235 X:98883671-98883693 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1195103439 X:101579094-101579116 CTTGCTCCTGAATGATTTTTGGG - Intergenic
1195153699 X:102100131-102100153 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1195163071 X:102190232-102190254 CTTGCTCCTGAATGACTACTGGG - Intergenic
1195213938 X:102678025-102678047 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1195226034 X:102794663-102794685 CTTGCTCCTGAATGACTCCTGGG - Intergenic
1195419372 X:104656433-104656455 CATGCTCCTGAATGATTACTGGG - Intronic
1195686004 X:107586707-107586729 CCTGCTCCTGAGTGACTCCTGGG - Intronic
1195733447 X:107989343-107989365 CCGGCTCCTGAATGACTACTGGG - Intergenic
1195733777 X:107992445-107992467 TTAGCTCCTGACTGTTTCCCAGG + Intergenic
1195825295 X:108993100-108993122 CCGGCTCCTGAATGACTACTGGG + Intergenic
1195846222 X:109231671-109231693 CTTGCTCCTGAATGACTACTGGG + Intergenic
1195947664 X:110232399-110232421 CTTGCTCCTGAATGACTACTGGG + Intronic
1195985857 X:110629196-110629218 CTTGCTCTTGAATGACTCCTGGG + Intergenic
1196094787 X:111787289-111787311 CTTGCTCCTGAATGACTACTGGG + Intronic
1196537675 X:116866864-116866886 CCTGCTCCTGAGTGACTCCTGGG - Intergenic
1196607029 X:117669013-117669035 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1197029835 X:121800402-121800424 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1197191364 X:123651183-123651205 CTTGCTCCTGAATGACTACTGGG + Intronic
1197319384 X:125008765-125008787 CCGGCTCCTGAATGACTCCTGGG + Intergenic
1197395328 X:125920588-125920610 CTTGCTCCTGAATGACTACTGGG - Intergenic
1197423793 X:126270635-126270657 CCTGCTCCTGAATGACTCCTAGG - Intergenic
1197522961 X:127522383-127522405 CTTGCTTCTGAATGACTCCTGGG + Intergenic
1197606817 X:128594955-128594977 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1197625100 X:128793169-128793191 CGTGCTCCTGAATGACTCCTGGG + Intergenic
1198223874 X:134627726-134627748 CTGCCTCCTAACTGGTTCCTTGG + Intronic
1198293436 X:135261055-135261077 CTTGCTCCTGAATGACTACTGGG - Intronic
1198660114 X:138959279-138959301 CCTGCTCCTGAATGACTCCTGGG - Intronic
1198786098 X:140289968-140289990 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1198819866 X:140635806-140635828 CTTGCTCCTGAATGACTACTGGG + Intergenic
1199132992 X:144216335-144216357 CTTGCTCCTGAATAAATCCTGGG - Intergenic
1199173075 X:144754573-144754595 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1199307970 X:146290153-146290175 CCTGCTCCTGAGTGACTCCTGGG - Intergenic
1199343122 X:146705948-146705970 CTTGCTCCTGAATGATTTTTGGG - Intergenic
1199384028 X:147203171-147203193 CTTGCTCCTGAATGACTACTGGG + Intergenic
1199556081 X:149110551-149110573 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1199567148 X:149227674-149227696 CCTGCTCCTGAATGACTCCTGGG - Intergenic
1199801503 X:151255600-151255622 CCTGCTCCTGAATGACTCCTAGG + Intergenic
1199830985 X:151548991-151549013 CCTGCTCCTGAATGACTCCTGGG + Intergenic
1199939350 X:152609813-152609835 CTTGCTCCTGAATGACTACTGGG - Intergenic
1200364205 X:155644458-155644480 CTGGCTCCTGGATGGTACCTCGG - Intronic
1200478643 Y:3673829-3673851 CTTGCTCCTGAATGACTCCTGGG - Intergenic
1201248734 Y:12033867-12033889 CTCGCTCCTGAATGACTACTGGG - Intergenic
1201251233 Y:12059957-12059979 CCGGCTCCTGAATGACTACTAGG + Intergenic
1201498548 Y:14616700-14616722 CTTGCTCCTGAATGACTACTGGG - Intronic
1201691033 Y:16764918-16764940 CCTGCTCCTGACTGACTACTGGG + Intergenic
1201913839 Y:19160885-19160907 CTTGCTCCTGAATGAATACTGGG + Intergenic
1202013255 Y:20370736-20370758 CTTGCTCCTGAATGACTACTGGG + Intergenic
1202026664 Y:20531066-20531088 CTTGCTCCTGAATGACTACTGGG + Intergenic
1202112775 Y:21441446-21441468 CTTGCTCCTGAATGACTACTGGG - Intergenic
1202174906 Y:22088902-22088924 CTTGCTCCTGAATGATTGCTGGG + Intronic
1202216456 Y:22497480-22497502 CTTGCTCCTGAATGATTGCTGGG - Intronic
1202326732 Y:23698589-23698611 CTTGCTCCTGAATGATTGCTGGG + Intergenic
1202544037 Y:25971464-25971486 CTTGCTCCTGAATGATTGCTGGG - Intergenic