ID: 1132604243

View in Genome Browser
Species Human (GRCh38)
Location 16:787089-787111
Sequence CGATGCACATGGTGTGGGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 133}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132604233_1132604243 3 Left 1132604233 16:787063-787085 CCTGCCTGCCACACCCTGCGAGC 0: 1
1: 0
2: 3
3: 16
4: 217
Right 1132604243 16:787089-787111 CGATGCACATGGTGTGGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 133
1132604230_1132604243 14 Left 1132604230 16:787052-787074 CCCGGTGGGTCCCTGCCTGCCAC 0: 1
1: 0
2: 4
3: 48
4: 331
Right 1132604243 16:787089-787111 CGATGCACATGGTGTGGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 133
1132604234_1132604243 -1 Left 1132604234 16:787067-787089 CCTGCCACACCCTGCGAGCCCTC 0: 1
1: 0
2: 0
3: 19
4: 258
Right 1132604243 16:787089-787111 CGATGCACATGGTGTGGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 133
1132604227_1132604243 26 Left 1132604227 16:787040-787062 CCACGATGCCCGCCCGGTGGGTC 0: 1
1: 0
2: 0
3: 7
4: 48
Right 1132604243 16:787089-787111 CGATGCACATGGTGTGGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 133
1132604236_1132604243 -10 Left 1132604236 16:787076-787098 CCCTGCGAGCCCTCGATGCACAT 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1132604243 16:787089-787111 CGATGCACATGGTGTGGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 133
1132604235_1132604243 -5 Left 1132604235 16:787071-787093 CCACACCCTGCGAGCCCTCGATG 0: 1
1: 0
2: 0
3: 10
4: 79
Right 1132604243 16:787089-787111 CGATGCACATGGTGTGGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 133
1132604229_1132604243 17 Left 1132604229 16:787049-787071 CCGCCCGGTGGGTCCCTGCCTGC 0: 2
1: 0
2: 4
3: 21
4: 239
Right 1132604243 16:787089-787111 CGATGCACATGGTGTGGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 133
1132604231_1132604243 13 Left 1132604231 16:787053-787075 CCGGTGGGTCCCTGCCTGCCACA 0: 1
1: 0
2: 2
3: 38
4: 321
Right 1132604243 16:787089-787111 CGATGCACATGGTGTGGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 133
1132604232_1132604243 4 Left 1132604232 16:787062-787084 CCCTGCCTGCCACACCCTGCGAG 0: 1
1: 0
2: 4
3: 21
4: 276
Right 1132604243 16:787089-787111 CGATGCACATGGTGTGGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 133
1132604228_1132604243 18 Left 1132604228 16:787048-787070 CCCGCCCGGTGGGTCCCTGCCTG 0: 2
1: 0
2: 0
3: 30
4: 258
Right 1132604243 16:787089-787111 CGATGCACATGGTGTGGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 133
1132604226_1132604243 27 Left 1132604226 16:787039-787061 CCCACGATGCCCGCCCGGTGGGT 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1132604243 16:787089-787111 CGATGCACATGGTGTGGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132604243 Original CRISPR CGATGCACATGGTGTGGGCC CGG Exonic
900731442 1:4263906-4263928 CAGTGCAGATGGGGTGGGCCGGG + Intergenic
901149814 1:7093734-7093756 CGAGGCACAGGGTGTGTGCCTGG + Intronic
901261725 1:7876191-7876213 CCATGAACATTGTCTGGGCCCGG + Intergenic
903734817 1:25523404-25523426 AGATACCCATGGTGGGGGCCTGG + Intergenic
903967650 1:27100341-27100363 CCAGGCTCAGGGTGTGGGCCTGG + Exonic
904695557 1:32328944-32328966 CTAGGCCCATGATGTGGGCCAGG - Intronic
904891651 1:33783971-33783993 GGAGTCACATGGTGGGGGCCGGG - Intronic
906568705 1:46818429-46818451 AGATTCACATGGTGGGGGTCTGG - Intronic
907560320 1:55381821-55381843 CCATGCTCATGCTGGGGGCCAGG + Intergenic
915330228 1:155107021-155107043 TGATGCACCTGGGGTGGGCGTGG - Intergenic
920850778 1:209626739-209626761 TGATGCATGTGGTGTGGGCCTGG - Intronic
920970719 1:210741669-210741691 GGAGGCACATTCTGTGGGCCAGG - Intronic
922165058 1:223108420-223108442 CTAAGCACATACTGTGGGCCAGG + Intergenic
922573286 1:226646230-226646252 CGGTGCTCATGTTGTGGGGCTGG - Intronic
1065912155 10:30317534-30317556 TGTTGCAGATAGTGTGGGCCAGG - Intronic
1071746382 10:88424205-88424227 AGATGCACCTGGTATGTGCCAGG - Intronic
1073920524 10:108452976-108452998 CCATGCACTTAGTGTGGTCCAGG + Intergenic
1074462462 10:113650778-113650800 CTAAGCACCTGGTGTGGGCCAGG + Intronic
1077030204 11:462123-462145 TGATGCGCCTGGTGGGGGCCTGG - Intronic
1077336787 11:2008849-2008871 CGTTGTGCATGGTGTGGGCTGGG + Intergenic
1079112332 11:17611972-17611994 CGATGCACTTAGTGTGAGCTCGG - Intronic
1079359910 11:19761870-19761892 GGATGCAGATGGTTTGGACCAGG - Intronic
1083262121 11:61528818-61528840 CGATGGGGCTGGTGTGGGCCTGG + Intronic
1083576758 11:63797495-63797517 AGAGGCACCAGGTGTGGGCCAGG + Intergenic
1085351430 11:75800409-75800431 CCATGTACATGGTGTGGTACAGG - Exonic
1202819771 11_KI270721v1_random:64031-64053 CGTTGTGCATGGTGTGGGCTGGG + Intergenic
1096473843 12:51896122-51896144 CTATGCACATGTTTTGAGCCTGG - Intergenic
1097902420 12:64886460-64886482 CCATGCACATGGTGGGGGTTAGG - Intergenic
1102346273 12:112163246-112163268 CTTGGTACATGGTGTGGGCCTGG + Exonic
1103715067 12:122940373-122940395 AGAGGCACATGGGGTGGGCTGGG - Intronic
1103734411 12:123050139-123050161 TGCTGCCCATGGTGTGGGCTGGG + Intronic
1113605735 13:111603945-111603967 CAATCCACACGGTGTGGCCCAGG - Intronic
1115520844 14:34231574-34231596 CGGGGCACATGCTGTGGGCAGGG + Intronic
1119193356 14:72699672-72699694 TGAAGCACTTGGAGTGGGCCTGG - Intronic
1121765182 14:96479827-96479849 GGAGGCCCAAGGTGTGGGCCTGG - Intronic
1122514604 14:102298070-102298092 GCAGGCACATGGTGTGGGACTGG + Intronic
1124616511 15:31246048-31246070 CGATGGCCATGGTGTTGGCTTGG + Intergenic
1124677509 15:31698446-31698468 CAATGCTGATGTTGTGGGCCAGG - Intronic
1127643140 15:60934038-60934060 TGATGCATATGGTGTGGAGCTGG - Intronic
1128720221 15:69942435-69942457 TTGTGCACATGGTATGGGCCAGG - Intergenic
1129740383 15:77986971-77986993 CGAGGCAAGTGGTGTGGGCTGGG + Intronic
1129845369 15:78765626-78765648 CGAGGCAAGTGGTGTGGGCTGGG - Exonic
1130256479 15:82328233-82328255 CGAGGCAAGTGGTGTGGGCTGGG + Intergenic
1130353428 15:83110039-83110061 CGATGCACACGGCGCTGGCCTGG - Intronic
1130598473 15:85261755-85261777 CGAGGCAAGTGGTGTGGGCTGGG - Intergenic
1132211932 15:100030245-100030267 CCATGTGCACGGTGTGGGCCAGG + Intronic
1132604243 16:787089-787111 CGATGCACATGGTGTGGGCCCGG + Exonic
1132898040 16:2238160-2238182 AGCTCCACATGGGGTGGGCCGGG - Intronic
1137538780 16:49347732-49347754 AGCTGCCCACGGTGTGGGCCAGG - Intergenic
1139021076 16:62750277-62750299 AGATGCTCATGGAGTGGTCCTGG - Intergenic
1140745425 16:77976436-77976458 CACTGCACATGGTGTGGCCAAGG + Intronic
1142423678 16:89989189-89989211 CGTTGCAGGTGGTGTGGGTCAGG + Intergenic
1144757947 17:17691622-17691644 CCAGGCACCTGGTGTGTGCCCGG + Intronic
1147152576 17:38526630-38526652 CGATCCACAGGATGGGGGCCTGG - Intergenic
1150287242 17:63961273-63961295 CGATGCAGATGGTGATGCCCAGG + Exonic
1151460846 17:74253225-74253247 CGTTGGAGATGGTCTGGGCCGGG - Exonic
1151857968 17:76736699-76736721 CGAAGCACGTGGTGCGGGCCCGG - Exonic
1152111962 17:78361452-78361474 GGATGCAGACGCTGTGGGCCTGG + Intergenic
1152527202 17:80895209-80895231 CGATGCCCAGGCTGGGGGCCGGG - Intronic
1154379801 18:13838840-13838862 CCATGCACATGGTGTGGGAGAGG - Intergenic
1161140229 19:2642893-2642915 CGGTGCACATGGTGCAGGGCGGG - Intronic
1161140301 19:2643269-2643291 CGGTGCACATGGTGCAGGGCGGG - Intronic
1161208999 19:3056632-3056654 CGGTGCACATGGAGTGGGGGAGG - Intronic
1164024545 19:21339280-21339302 AGCTGAACATAGTGTGGGCCTGG + Intergenic
1165279453 19:34783906-34783928 ACATGGCCATGGTGTGGGCCAGG - Intergenic
1168521333 19:57053225-57053247 CAATTCACATGGTGTCGGCATGG - Intergenic
926464882 2:13175773-13175795 GGATGGGCATGGGGTGGGCCAGG + Intergenic
927340501 2:21978415-21978437 TGATTCACAAGGTGTGGTCCTGG + Intergenic
927776202 2:25905475-25905497 TGAAGCAAATAGTGTGGGCCAGG - Intergenic
928946251 2:36774682-36774704 CAATGCACATGCTGTTGTCCTGG + Intronic
929534441 2:42771703-42771725 TGCTGCACATGGTGGGTGCCAGG + Intronic
930305698 2:49671884-49671906 CTATGCTCATGGTCTGGGCCTGG + Intergenic
935403264 2:102682388-102682410 GGAGGCACATGGTGTGTGCCGGG + Intronic
940233306 2:151482517-151482539 CAGTCCACATGGTGTGGGCGAGG + Intronic
941424964 2:165331466-165331488 CAATGCAGATGGTGATGGCCAGG - Exonic
948354462 2:237366894-237366916 AGATGCACAGGATGTGAGCCTGG - Exonic
948773937 2:240270326-240270348 CCATGGACATTGTGTGGGCAGGG - Intergenic
1168998826 20:2151934-2151956 CCAGGCACAGGGTGTGGGCCAGG - Intronic
1169090717 20:2859954-2859976 TGCTTCACATGGGGTGGGCCTGG + Intronic
1169250473 20:4057113-4057135 CCATGCCCAGGATGTGGGCCAGG + Intergenic
1170852876 20:20020208-20020230 TGATTCCCAAGGTGTGGGCCAGG - Intronic
1170923473 20:20701441-20701463 AAATAAACATGGTGTGGGCCGGG + Intronic
1171194790 20:23188165-23188187 ATATGGACAGGGTGTGGGCCCGG + Intergenic
1172277155 20:33686028-33686050 CGGCGCACTGGGTGTGGGCCGGG + Exonic
1174258408 20:49276642-49276664 TCATACACATGGTGTGGGCTGGG + Intronic
1175981615 20:62741515-62741537 GGAGGAACATGGTGTGGGGCAGG - Intronic
1176011857 20:62901409-62901431 AGCTGCACATGGTGTGTGCCTGG + Intronic
1176261078 20:64180634-64180656 GGGTTCACAGGGTGTGGGCCAGG + Intronic
1178403124 21:32304269-32304291 CAATGCACAGGGGGTGGGCAAGG + Intronic
1180711500 22:17842416-17842438 GGAGGCACCTGGTGGGGGCCTGG - Intronic
1181570225 22:23764330-23764352 AGTTGCCCATGGTCTGGGCCCGG - Exonic
1181610242 22:24007111-24007133 CGATGACCATGCTGTGGGCAGGG + Intergenic
1184170148 22:42754033-42754055 GGCTGCCCATGGTGTGGTCCTGG + Intergenic
1184815362 22:46864831-46864853 GGATGAACTTGGTATGGGCCGGG - Intronic
950524876 3:13517732-13517754 GGAGGCACATGGTGGGGTCCGGG + Intergenic
950888169 3:16378791-16378813 CGCTGCTGATGGTGTGGACCAGG - Intronic
950987404 3:17389656-17389678 TGTTGCACATGGTGTTGGCTGGG - Intronic
953743600 3:45556811-45556833 TGATGCCCATGGTGCCGGCCTGG - Intronic
955433619 3:58875468-58875490 TGTGGGACATGGTGTGGGCCTGG + Intronic
956455224 3:69414498-69414520 CGATGAACATGTTGTGGTCCAGG + Intronic
956892322 3:73624816-73624838 CGAAGCCCATGGTGGCGGCCAGG + Exonic
959819175 3:110712045-110712067 AGAGGCAAATGATGTGGGCCTGG + Intergenic
961326930 3:126114545-126114567 CTGTGCAGATGGTGAGGGCCGGG - Exonic
961682992 3:128611335-128611357 CTAAGCACATCGTGTGTGCCTGG + Intergenic
962827734 3:139112164-139112186 GGAGGCACAAAGTGTGGGCCAGG - Intronic
966642632 3:182207842-182207864 AGATGCACATGGGGTGTGCCAGG - Intergenic
968500827 4:949096-949118 CGAGGCCCATGGGGTGGGCTTGG + Intronic
968606892 4:1539810-1539832 TGATGCAGAGGGTGGGGGCCAGG + Intergenic
969446334 4:7246804-7246826 CGATGGCCATGATGAGGGCCTGG + Intronic
992042492 5:72848873-72848895 CGGGGCGCATTGTGTGGGCCCGG - Intronic
992085416 5:73274008-73274030 CCAGGCACATGCTGTGGGTCAGG - Intergenic
992324885 5:75650974-75650996 TGAGGCACATGGTGAGGCCCAGG - Intronic
997941016 5:138157548-138157570 CTTTGCACATGATTTGGGCCTGG - Intronic
999927999 5:156400199-156400221 CAATACTCTTGGTGTGGGCCTGG + Intronic
1001450514 5:171820907-171820929 GTATTCAGATGGTGTGGGCCGGG - Intergenic
1001550049 5:172596115-172596137 CCAAGCACCTGCTGTGGGCCAGG + Intergenic
1001871461 5:175159710-175159732 CATTGCACAGGGTGTGGGCTGGG + Intergenic
1003401327 6:5793581-5793603 CATTGGACATTGTGTGGGCCAGG - Intergenic
1007103566 6:39268219-39268241 CAAAGCACATACTGTGGGCCAGG - Intergenic
1007313552 6:40965881-40965903 CCATCCTCATGGTCTGGGCCTGG - Intergenic
1008334917 6:50291248-50291270 TGATGCAGATGCTGTTGGCCTGG - Intergenic
1010686591 6:78860358-78860380 CAATGCACAAACTGTGGGCCAGG - Intergenic
1011259452 6:85456205-85456227 TGGTGCACATGGAGTGGGCATGG + Intronic
1011468145 6:87680193-87680215 CCATGCCCATTGTGGGGGCCAGG - Intronic
1013186556 6:107764458-107764480 AGATGCAAATGATGTGGGACAGG + Intronic
1016388975 6:143556326-143556348 CCAGGCACAAGGCGTGGGCCAGG + Intronic
1021520645 7:21536566-21536588 GCAGGCACATGGTGTGGGACTGG - Intergenic
1022304328 7:29132243-29132265 GGAAGCCCATGGTGGGGGCCAGG + Intronic
1024606825 7:51028572-51028594 CCATGCCCATGGTGGGGGGCTGG + Exonic
1028885604 7:95929111-95929133 TCATCCACATTGTGTGGGCCTGG - Intronic
1028985850 7:97007420-97007442 CGCTGCACATTGTTCGGGCCAGG + Intronic
1033233016 7:139616388-139616410 TGATGAACATGGTATGCGCCTGG + Intronic
1033361506 7:140641267-140641289 CGATGCAGGTGATGGGGGCCGGG + Intronic
1033491411 7:141847026-141847048 CCATGCAGATAGTGTGGGCAAGG + Intergenic
1044261747 8:90132862-90132884 CGATGCACATGTTGTTGTCTTGG + Intergenic
1046920706 8:119725409-119725431 TGAGGCACATGCTGTGGTCCCGG - Intergenic
1047137756 8:122100649-122100671 CTAAGAGCATGGTGTGGGCCTGG + Intergenic
1048676681 8:136791867-136791889 TATTGCACATGGTGTGGGCTTGG - Intergenic
1048859663 8:138714691-138714713 TGATGGACATGGTGTCTGCCTGG + Intronic
1049544062 8:143221430-143221452 CGATGCCCCTGGGGAGGGCCGGG + Intergenic
1059417901 9:114173315-114173337 CAGAGCACGTGGTGTGGGCCAGG - Intronic
1061539401 9:131269765-131269787 AGATGCACATGGGCTGGGCCCGG - Intronic
1062003756 9:134229298-134229320 GGAGGAAGATGGTGTGGGCCAGG + Intergenic
1062655948 9:137604833-137604855 CGATGCAGGTGTTGGGGGCCGGG + Intergenic
1200684074 Y:6244826-6244848 GGAGGCACATGGGGTGAGCCAGG - Intergenic
1201048561 Y:9909560-9909582 GGAGGCACATGGGGTGAGCCAGG + Intergenic