ID: 1132604281

View in Genome Browser
Species Human (GRCh38)
Location 16:787252-787274
Sequence GCAACCACGTAGAGCGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132604276_1132604281 -9 Left 1132604276 16:787238-787260 CCACCTAACACCAAGCAACCACG 0: 1
1: 0
2: 2
3: 22
4: 161
Right 1132604281 16:787252-787274 GCAACCACGTAGAGCGTGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1132604275_1132604281 -8 Left 1132604275 16:787237-787259 CCCACCTAACACCAAGCAACCAC 0: 1
1: 0
2: 4
3: 34
4: 233
Right 1132604281 16:787252-787274 GCAACCACGTAGAGCGTGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1132604272_1132604281 10 Left 1132604272 16:787219-787241 CCCAGTGCTGCCGGGGAGCCCAC 0: 1
1: 0
2: 2
3: 15
4: 143
Right 1132604281 16:787252-787274 GCAACCACGTAGAGCGTGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1132604273_1132604281 9 Left 1132604273 16:787220-787242 CCAGTGCTGCCGGGGAGCCCACC 0: 1
1: 0
2: 1
3: 24
4: 175
Right 1132604281 16:787252-787274 GCAACCACGTAGAGCGTGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1132604274_1132604281 0 Left 1132604274 16:787229-787251 CCGGGGAGCCCACCTAACACCAA 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1132604281 16:787252-787274 GCAACCACGTAGAGCGTGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132604281 Original CRISPR GCAACCACGTAGAGCGTGGT GGG Intronic
903006879 1:20304411-20304433 GCAAGCATGTAGAACGTGGAGGG + Intronic
905005829 1:34709688-34709710 GAAAGCACGTACAGCGTGGAGGG + Intergenic
913067420 1:115269343-115269365 GAAACCATGGAGAGAGTGGTAGG + Intergenic
924266031 1:242283359-242283381 GAAACCACGTAGCCAGTGGTAGG - Intronic
1087564323 11:99835114-99835136 GCAACCACGTACAGCAAAGTAGG - Intronic
1094130133 12:27065821-27065843 GAAACCAAGTAGCGCATGGTAGG - Intronic
1094872648 12:34606821-34606843 GAAAACACGAAGAGCGAGGTAGG + Intergenic
1095976804 12:47945906-47945928 GAAAGCAGGTAGAGAGTGGTAGG + Intergenic
1102489364 12:113280030-113280052 GCATGCACGAAGAGTGTGGTAGG + Intronic
1106065929 13:26349291-26349313 GTAACCTCATAGAGTGTGGTTGG + Intronic
1113043248 13:106126931-106126953 GCAACCAGGAAGAGCCTGGAAGG + Intergenic
1125203576 15:37125312-37125334 CCAGCCAGGTAGAGAGTGGTTGG + Intergenic
1128456507 15:67834483-67834505 GCAACCACCTGGAGCCTGTTTGG + Exonic
1128858703 15:71045849-71045871 GGAACAACATAGAGGGTGGTAGG - Intronic
1130743202 15:86623268-86623290 TCAATCATGTAGAGCCTGGTTGG + Intronic
1132604281 16:787252-787274 GCAACCACGTAGAGCGTGGTGGG + Intronic
1134624930 16:15716798-15716820 GCCACCACGTCCAGCCTGGTTGG + Intronic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1138853689 16:60661092-60661114 GCAATCATGTAGAGCATGATGGG + Intergenic
1141010721 16:80395922-80395944 GCAGCCACGTGGAGGGTGGTGGG - Intergenic
1147881977 17:43660185-43660207 GCAACCAGGGAGGGCCTGGTGGG + Intronic
1150330593 17:64291124-64291146 GCAAGCAGGTAGAGGTTGGTGGG + Intergenic
941293918 2:163712015-163712037 GGAACCATGTGGAGGGTGGTAGG - Intronic
948941091 2:241196948-241196970 GCCACCACGTGGGGAGTGGTTGG - Intronic
1183234992 22:36610350-36610372 TCAGCCCCGTAGAGCGTGATTGG + Intronic
1184825262 22:46946328-46946350 GCAACCTCTTACAGCCTGGTGGG - Intronic
962193228 3:133333021-133333043 GCACCCACATAGAGCTTGCTAGG - Intronic
969994829 4:11301391-11301413 GCAACCATGTAGAGAGAGGTTGG - Intergenic
972175518 4:36400909-36400931 GCAACCAAGAAGAGAGTGGAGGG - Intergenic
987710094 5:21494350-21494372 GCAAACAGGTAGTGCGAGGTGGG - Intergenic
988749517 5:34179812-34179834 GCAAACAGGTAGTGCGAGGTGGG + Intergenic
991737776 5:69643016-69643038 GCAAACAGGTAGTGCGAGGTGGG + Intergenic
991760417 5:69913409-69913431 GCAAACAGGTAGTGCGAGGTGGG - Intergenic
991786914 5:70204692-70204714 GCAAACAGGTAGTGCGAGGTGGG + Intergenic
991789352 5:70222742-70222764 GCAAACAGGTAGTGCGAGGTGGG + Intergenic
991814102 5:70497852-70497874 GCAAACAGGTAGTGCGAGGTGGG + Intergenic
991817235 5:70519144-70519166 GCAAACAGGTAGTGCGAGGTGGG + Intergenic
991839648 5:70788460-70788482 GCAAACAGGTAGTGCGAGGTGGG - Intergenic
991879360 5:71205082-71205104 GCAAACAGGTAGTGCGAGGTGGG + Intergenic
991881800 5:71223111-71223133 GCAAACAGGTAGTGCGAGGTGGG + Intergenic
994460320 5:100063081-100063103 GCAAACAGGTAGTGCGAGGTGGG + Intergenic
994484464 5:100376498-100376520 GCAAACAGGTAGTGCGAGGTGGG + Intergenic
1003473666 6:6461574-6461596 GCAACCATGCAGAGCCTGGGAGG + Intergenic
1005295407 6:24420895-24420917 TCAGTGACGTAGAGCGTGGTAGG + Intronic
1005466881 6:26124345-26124367 GCAACTACGCAGAGCGGGTTGGG + Exonic
1005547588 6:26886162-26886184 GCAAACAGGTAGTGCGAGGTGGG + Intergenic
1009018351 6:57927233-57927255 GCAAACAGGTAGTGCGAGGTGGG + Intergenic
1035792201 8:2317304-2317326 GAAACCATGGAGAGCGTGATGGG + Intergenic
1035800604 8:2404401-2404423 GAAACCATGGAGAGCGTGATGGG - Intergenic
1038682874 8:29685805-29685827 ATAACCACGTAGGGGGTGGTTGG + Intergenic
1043037312 8:75214430-75214452 GCAATCAAGTAGAGTGTAGTGGG - Intergenic
1189249054 X:39585910-39585932 GCCACCAGGCAGAGAGTGGTGGG + Intergenic