ID: 1132606948

View in Genome Browser
Species Human (GRCh38)
Location 16:797534-797556
Sequence AGTGAGGGGTGAGGGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 890
Summary {0: 1, 1: 0, 2: 9, 3: 88, 4: 792}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132606941_1132606948 -3 Left 1132606941 16:797514-797536 CCTGGTGGGGAGCAGATGGCAGT 0: 1
1: 0
2: 1
3: 36
4: 317
Right 1132606948 16:797534-797556 AGTGAGGGGTGAGGGGCAGCTGG 0: 1
1: 0
2: 9
3: 88
4: 792

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132606948 Original CRISPR AGTGAGGGGTGAGGGGCAGC TGG Intronic
900088289 1:908817-908839 AGGGAGGGATGAGGGGCAGGGGG + Intergenic
900154494 1:1198500-1198522 AGCCAGGGGTGAGGGGCACAGGG + Intergenic
900238258 1:1602590-1602612 AGGGAGGGGTGAGGAGGAGAGGG + Intergenic
900284380 1:1891983-1892005 AGCCGAGGGTGAGGGGCAGCCGG - Intergenic
900413945 1:2526558-2526580 AGTGTGGAGCGAGCGGCAGCGGG - Exonic
900489286 1:2938824-2938846 TGTGTGGGGTGGGGGGCTGCTGG + Intergenic
900497094 1:2980698-2980720 AGGGAGGGAAGGGGGGCAGCTGG + Intergenic
900599863 1:3498349-3498371 CGTGAGTGGGGCGGGGCAGCAGG - Exonic
901130910 1:6962313-6962335 GGCGAGGGGCCAGGGGCAGCTGG + Intronic
901874992 1:12162327-12162349 ACAGAGGGTTGAGGTGCAGCAGG - Intergenic
902285423 1:15405345-15405367 AGTGATGGCTGAGGACCAGCAGG + Intergenic
902350348 1:15848911-15848933 ATTCAGGGGTGGGGGGCACCAGG - Intronic
902361529 1:15944858-15944880 AGCGGGGTGTGAGGAGCAGCCGG + Intronic
902754699 1:18541311-18541333 GGTGGGAGGTGAGAGGCAGCAGG - Intergenic
902776177 1:18676398-18676420 AGGGTGGGGAGGGGGGCAGCGGG + Intronic
902826646 1:18979152-18979174 ATTGTGGGGTGAGGGGTAGGAGG + Intergenic
903767488 1:25744051-25744073 AATGAAGGGGTAGGGGCAGCAGG + Intronic
903995756 1:27304635-27304657 AGTGGTGTGTGAGGGGCAGGGGG + Intronic
904114964 1:28155037-28155059 GGTGAGGGTGGAGTGGCAGCTGG - Intronic
904190356 1:28737993-28738015 TGTGATGGGGGAGGGGAAGCGGG + Intronic
904415968 1:30361424-30361446 AGTGATGGGAGAGAGGCAGAGGG - Intergenic
904490820 1:30858051-30858073 AGGGAGGGGACAGGGGCAGGGGG - Intergenic
904771538 1:32884073-32884095 AAGGGGGGCTGAGGGGCAGCTGG - Intergenic
905232158 1:36521310-36521332 TGTGAGGAGTGAAGGGCAGAGGG + Intergenic
905370198 1:37478987-37479009 AGGGAGGGAGGTGGGGCAGCTGG - Intronic
905495011 1:38378070-38378092 AGAAAGGGGTGAGGGGCCACTGG - Intergenic
905739248 1:40355071-40355093 AGTGAGGCCTGAGGTGCACCTGG + Intronic
906083121 1:43107481-43107503 GGTGAGGGGCGGGGGGCAGGGGG + Intergenic
906392184 1:45427769-45427791 AGTGTGGGGTGTGGGGGAGTGGG + Intronic
906686848 1:47768328-47768350 AGTGGGGGGGGAGGGCCAGGTGG + Intronic
906846748 1:49200861-49200883 AGGGAGGGGAGAGGGGCTGAAGG - Intronic
907587885 1:55637676-55637698 AGTGAGGGGTCAGGTCAAGCTGG + Intergenic
907858051 1:58323086-58323108 ATTGTGGGGTGGGGGGCAGGGGG + Intronic
908206148 1:61851870-61851892 ATGGAGGGGTGAGGGGGAGAAGG + Intronic
908677244 1:66619194-66619216 AGTGAGGGATGAGAGGCAGGAGG + Intronic
908916016 1:69127410-69127432 AGTGAAGTCTGAGGGACAGCTGG - Intergenic
908916227 1:69129646-69129668 AAAGAGGGGTGAGGGGCACTGGG + Intergenic
912330734 1:108818032-108818054 AGTGAGGGGTGCAGGGCCACTGG + Intronic
912420580 1:109539849-109539871 AGTGAGCGGTGAGAGGCAGCCGG - Intergenic
912582976 1:110736829-110736851 AGTGAGGACTGCAGGGCAGCGGG - Intergenic
912776805 1:112510567-112510589 GCTGAAGGGTGAGGGGTAGCTGG + Intronic
912949621 1:114111753-114111775 ACTGCCGGGTGAGGGGCTGCAGG + Intronic
913202249 1:116504379-116504401 ACTGAAGGGTGAGACGCAGCAGG + Intergenic
913202340 1:116504988-116505010 ACTGAAGGGTGAGACGCAGCAGG + Intergenic
913681206 1:121187785-121187807 AGGGTGGGGGGAGGGGCAGGAGG + Intronic
914033036 1:143975425-143975447 AGGGTGGGGGGAGGGGCAGGAGG + Intergenic
914156409 1:145092541-145092563 AGGGTGGGGGGAGGGGCAGGAGG - Intronic
914330969 1:146670782-146670804 TGTGAGGGGTGGAGTGCAGCAGG - Intergenic
915285015 1:154847018-154847040 GGTGAGGGGTCAGGCGGAGCCGG - Intronic
915361337 1:155288025-155288047 AGTCAGGGGAGAGGGGCAGAGGG - Exonic
915508005 1:156369440-156369462 AGTGCGGGGTGAGGGCGCGCGGG + Intronic
915592437 1:156878378-156878400 AGTGCAGTGTGAGGGGCACCTGG - Intronic
915916473 1:159943740-159943762 AGTGAGGGGTAGGGGGAAGGGGG + Intronic
916457225 1:164983248-164983270 AGTGAGGGCTGCTGGTCAGCAGG - Intergenic
916611889 1:166399428-166399450 AGTGCGGGGTTGGGGGCAGGGGG - Intergenic
916992210 1:170256187-170256209 AGTGGTGGGTGGGGGGCAGTGGG + Intergenic
917531964 1:175843540-175843562 AATGAAGAGTGAGGGGAAGCTGG - Intergenic
917838726 1:178960731-178960753 AGGGAGGGGTGGGTGGCAGGGGG - Intergenic
917840237 1:178971574-178971596 ACTGAGGGGAGAGGGGGAGAGGG - Intergenic
918096965 1:181343897-181343919 AGGGAGGGGAGAGGAGAAGCCGG - Intergenic
918141499 1:181723981-181724003 GGGGAGGGGTGAGGGGCTGAAGG - Intronic
919813190 1:201421814-201421836 TGGGAGGGAGGAGGGGCAGCAGG - Intronic
919947305 1:202328859-202328881 AGAGGGGGGTTGGGGGCAGCAGG + Intergenic
920045001 1:203127442-203127464 CGTGAGGGGTGAGGGGTCGCTGG + Exonic
920079352 1:203361018-203361040 AGTGAGGAGTGGGAGGGAGCGGG + Intergenic
920221762 1:204409312-204409334 GGTGGGGGGTGAGGGACAGGAGG + Intronic
920367917 1:205457565-205457587 AGTGGGGGGGGGGGGGCAGCAGG + Intergenic
920468521 1:206206310-206206332 AGGGTGGGGGGAGGGGCAGGAGG + Intronic
920499946 1:206479779-206479801 AGTGAGGGGTGAGTGTGAGCTGG + Intronic
920648575 1:207820784-207820806 AGAGAGGGGGAACGGGCAGCGGG + Intergenic
921714887 1:218407773-218407795 AGTATGTGGTGAGGGGCAGGAGG - Intronic
922540816 1:226418008-226418030 TGTGAGGTGTGAGAGGCAGAGGG + Intergenic
922868577 1:228881831-228881853 AATTAGGGCTGAAGGGCAGCAGG + Intergenic
923296607 1:232600743-232600765 ACTGAGTGCTGAGGGGCAGGGGG - Intergenic
923457106 1:234174021-234174043 AGTGAGGGGTGAGTGGGGCCTGG - Intronic
924337563 1:242998989-242999011 AGTGGGGAGTGAGGGGAGGCAGG - Intergenic
924436643 1:244048809-244048831 AGGGAGGGGCGGGGGGGAGCGGG + Intergenic
1063109266 10:3020541-3020563 AGTGAGCGCTGTGGGGAAGCGGG - Intergenic
1063295571 10:4801793-4801815 AGGGAAGGCAGAGGGGCAGCAGG - Intronic
1063953121 10:11242705-11242727 ACTCAGGAGTGAGGGGCATCAGG + Intronic
1064458249 10:15508544-15508566 AGTGTGGGGTGAGAGGCCACTGG + Intergenic
1065133325 10:22644121-22644143 AGGGAGGGGTGAGCAGGAGCTGG - Intronic
1065484186 10:26221323-26221345 AGAGAGGAGTGAAGGGCAGTGGG + Intronic
1065579153 10:27154315-27154337 TGGGAGGAGTGAGGGGCAACGGG - Exonic
1067181057 10:43986298-43986320 AGGGTGGGATGAGGGGCTGCAGG - Intergenic
1067330253 10:45309105-45309127 AGTGGGGGAGGAGGGACAGCAGG + Intronic
1068219162 10:54021512-54021534 TGTGAGGGGTGAGGGGCTAAAGG - Intronic
1069630191 10:69892938-69892960 TGTGATGGGGGAGGGGCAGGCGG - Intronic
1069717278 10:70529361-70529383 AGATAGGGGTGGGAGGCAGCAGG - Intronic
1069849500 10:71396258-71396280 AGTGAGGGAGGAGGCGCAGATGG + Intergenic
1069985059 10:72277319-72277341 TGTGAGGGGTGGGTGGCGGCAGG + Intergenic
1070302119 10:75211050-75211072 AGAGAGGGGCGAGGGGCCGCGGG - Intronic
1070793633 10:79204278-79204300 TGTGAGGGGACATGGGCAGCAGG - Intronic
1070979195 10:80630754-80630776 AATGAGGAGTCAGGGTCAGCTGG + Intronic
1070984867 10:80679989-80680011 AGGGAGGGGCGAGGGGCTGGAGG + Intergenic
1071001311 10:80833433-80833455 GTTGAGGGGTGGGGGGCAGGGGG + Intergenic
1072466501 10:95667496-95667518 AGGAAGGGATGAGGGGCAGATGG + Intronic
1072765202 10:98089322-98089344 AGTGATGTGTGAGTGGGAGCAGG - Intergenic
1073451154 10:103610148-103610170 AGTGAGGGGTGGGAGGAAGCTGG + Intronic
1074795889 10:116943454-116943476 AGTGGAGGGGGAGGGGAAGCAGG - Intronic
1075508784 10:123051895-123051917 TGTGGGGGGTGAGGGAAAGCAGG - Intronic
1076332106 10:129677758-129677780 GGTGAAGGGTGTGGGCCAGCCGG + Intronic
1076554923 10:131315047-131315069 AGTGCAGGGTGAGGAGCAGGAGG + Intergenic
1076625850 10:131821571-131821593 CCTGAGGGGTGTGGGGCTGCTGG - Intergenic
1076708908 10:132320395-132320417 AGTGAGGGGTGGGGGTCCGCTGG + Intronic
1076724828 10:132408458-132408480 AGTGAGGTGTGGGGCGCTGCTGG + Intronic
1077048449 11:556130-556152 AGCGGCGGGTGAGGGGCGGCCGG + Intronic
1077237517 11:1488810-1488832 GGGGTAGGGTGAGGGGCAGCTGG + Intronic
1077300821 11:1846183-1846205 GGTCAGGGGTGAGGTGCAGCTGG - Intergenic
1077333105 11:1991992-1992014 AGGCAGGGATTAGGGGCAGCTGG - Intergenic
1077435846 11:2538827-2538849 AGTGAGGGGCCTGGGGCAGGAGG + Intronic
1077882363 11:6361341-6361363 AGTGAGGGGTGGGAAGCAACTGG - Intergenic
1078037758 11:7825235-7825257 AGTGAGGTGGGAGGTGCAGGTGG + Exonic
1078157873 11:8814219-8814241 TGTGAGGGGAGAGTGGAAGCTGG - Intronic
1079030251 11:16981462-16981484 ACTGAGGGGTGAAGAGCAGCAGG - Intronic
1079126105 11:17719636-17719658 AGGGAGGGGTGGGGGACAGTGGG + Exonic
1079242271 11:18729350-18729372 GGCGGGGGGTGAGGGGCAGATGG - Intronic
1079405644 11:20143030-20143052 GTTGAGGGGTGTGGGGGAGCAGG + Intergenic
1081239016 11:40680402-40680424 TGTGAGGGGCCAGGGGCAGAAGG + Intronic
1081512019 11:43784453-43784475 AGGTGGGGGTGGGGGGCAGCAGG + Intronic
1081781889 11:45718855-45718877 AGTGAGGAGTGGGGAGCAGGAGG - Intergenic
1082894960 11:58180157-58180179 AGTGAGGTGGGAGGTGCAGGTGG - Exonic
1082896070 11:58191206-58191228 AGTGAGGTGGGAGGCGCAGGTGG - Exonic
1082896239 11:58193201-58193223 AGTGAGTAGTGATGGGCAGAGGG + Intergenic
1083205544 11:61146589-61146611 AGGGAGGGCTGCGGGGCAGGCGG + Intronic
1083619337 11:64041328-64041350 GTGGAGGGGTGGGGGGCAGCAGG - Intronic
1083694593 11:64434235-64434257 AGGGTGGGGTGGGGGGCAGGGGG - Intergenic
1083730313 11:64649143-64649165 AGTGGGGGCTGGGGGACAGCTGG + Intronic
1083744416 11:64727239-64727261 ACTGAGGGCTGGGGGGGAGCTGG - Intronic
1083782626 11:64925992-64926014 GGGGAGGGGTGGGAGGCAGCGGG + Intronic
1083815585 11:65130683-65130705 GGTGGGGGGTGGGGGGCAGGGGG + Exonic
1083823975 11:65188033-65188055 AGCGACAGGTGAGGGGCAGTGGG + Exonic
1083832539 11:65241946-65241968 AGGCAGTGGTGAGGGGCAGGTGG - Intergenic
1084085483 11:66853113-66853135 GGGCAGGGGTGAGGGGCAGGGGG + Intronic
1084086161 11:66856384-66856406 AGGGAGAGGCGAGAGGCAGCTGG + Intronic
1084173240 11:67410520-67410542 AGGGAGGGGTGAGGGCTGGCGGG - Intronic
1084460919 11:69296167-69296189 AGTGAGGGGTGGGGTGCCGGTGG - Exonic
1084622619 11:70283526-70283548 AGTGATGGGTGAGCTTCAGCTGG + Intronic
1085052371 11:73386447-73386469 TGTGAGGGGTGCTGAGCAGCAGG + Intronic
1085274882 11:75292000-75292022 AGTGAGAGGTGAGGGTGGGCAGG - Intronic
1085287336 11:75372137-75372159 TATGAGGGGTGAGGAGCAGGAGG + Intergenic
1085392576 11:76190000-76190022 CATGAGGAGTGAGGGGCAGCTGG + Intronic
1085498919 11:76999615-76999637 AGTGAGGAGTGAGGTGGGGCAGG - Intronic
1085754771 11:79193282-79193304 AGTGAGGTGGGCAGGGCAGCCGG + Intronic
1086252466 11:84833201-84833223 AGTGAAGGGTTGGGGGCAGAGGG - Intronic
1086954582 11:92922980-92923002 AATGAGGGGTGTGGTGGAGCAGG + Intergenic
1089529452 11:119116854-119116876 AGGGAGGGATGAGGAGCAGGAGG - Exonic
1089654786 11:119939368-119939390 AGTGAGGGGTTAGGAGTAGGAGG + Intergenic
1089757708 11:120698650-120698672 AGCCAGGGGGAAGGGGCAGCAGG - Intronic
1089832897 11:121344481-121344503 ATTGTGGGGTGAGGGGCAGGCGG + Intergenic
1090251884 11:125257292-125257314 GGAGAGGGGAGAGGGGAAGCAGG + Intronic
1091166703 11:133482540-133482562 AGTGAGGGGTGAGTGGGAGGAGG + Intronic
1091238847 11:134039233-134039255 TGGGAGGGGTGAGAGGAAGCTGG + Intergenic
1202816087 11_KI270721v1_random:47170-47192 AGGCAGGGATTAGGGGCAGCTGG - Intergenic
1091635353 12:2192824-2192846 GGGGAGCGGTGAGGGACAGCTGG + Intronic
1091712583 12:2752576-2752598 AGTGAGCGGGGAGGAGCAGATGG - Intergenic
1091907536 12:4201001-4201023 AGTCATGGGTGTGGGGCACCGGG + Intergenic
1092290729 12:7158255-7158277 AGTGAGGGATGGGGGGCCGGGGG - Exonic
1092433937 12:8431384-8431406 AGTGAGTCCTGAGGGGCAGTCGG - Intergenic
1092762058 12:11819222-11819244 AGCCAGGGCAGAGGGGCAGCAGG - Intronic
1092921317 12:13234127-13234149 TGGGAAGGGTGAGGGGCAGTAGG - Intergenic
1093885144 12:24450933-24450955 AGTGAGGGGGTAGGGGAAGCAGG - Intergenic
1095289349 12:40459518-40459540 AGTGAGGGGTGAGGGAGAGGTGG - Intronic
1095376419 12:41534441-41534463 TGTGAGGAGTGAGGGGAAGGGGG - Intronic
1095431936 12:42144296-42144318 AGTGAGGGGTCAGAGACAGGAGG + Intronic
1096033468 12:48442216-48442238 AGTGAGGTGGGAGGAGCAGGTGG + Intergenic
1096140520 12:49239005-49239027 AGGGAGGGGAGAGGGGCTGAAGG - Intronic
1096510139 12:52123245-52123267 AGTGGGTGGTGGGTGGCAGCTGG - Intergenic
1096627360 12:52903942-52903964 AGGGCGGGGTGAGGGGCTGCGGG - Intronic
1096676745 12:53230411-53230433 ACAGAGGGGAGGGGGGCAGCGGG - Intronic
1096760774 12:53840276-53840298 AGTGAGGGGTGGGGGAAAGGAGG - Intergenic
1097568768 12:61305442-61305464 AGTGAGGGGTGAAGAGGAGATGG - Intergenic
1098362033 12:69664361-69664383 AGTAAGGGGAGAGGGGGAGATGG - Intronic
1098522639 12:71450982-71451004 AGGGAGGGGGGATTGGCAGCAGG - Intronic
1098680526 12:73348166-73348188 ATGGTGGGGAGAGGGGCAGCAGG + Intergenic
1101475279 12:105040406-105040428 AGTGGTGGGTGAGTGGCAGTGGG - Intronic
1102025891 12:109714237-109714259 GGTGTGGGGGGAGGGGAAGCCGG - Exonic
1102552114 12:113698863-113698885 AGTGGGGGGTCAGGGGGAGGTGG + Intergenic
1102569477 12:113818829-113818851 AGACAGGGGTGAGGGACAGTGGG - Intronic
1103241920 12:119420573-119420595 AGTGGGGGATGGGGGGCAGAAGG + Intronic
1103425472 12:120830318-120830340 AGGGAGGGGTGGGGGGGAGGTGG + Intronic
1103563336 12:121803848-121803870 AGTGAGGGGTGGGGGGCCGCTGG + Intergenic
1103627932 12:122234833-122234855 GGTAAGGGGTGAGGGGCCTCTGG - Intronic
1103914532 12:124369586-124369608 AGGGAGGGGTGGCGGGCTGCCGG + Intronic
1103975632 12:124700937-124700959 AGTGTGGGGTGAAGGGGAGCGGG + Intergenic
1103986212 12:124769070-124769092 AGTGAGGGGAGAGAGGCTGAAGG + Intergenic
1103998493 12:124845108-124845130 CGAGAGGGGTGAGGGGAAGGAGG + Intronic
1104114975 12:125740863-125740885 AGAGAGGGGCAGGGGGCAGCTGG - Intergenic
1104152129 12:126093937-126093959 AGGGAGCTGTGGGGGGCAGCAGG + Intergenic
1104182889 12:126399468-126399490 GGTGAGGGATGAGGGGCAGAAGG - Intergenic
1104949021 12:132430463-132430485 AGTGAGGGGCGTGGCACAGCAGG + Intergenic
1104971760 12:132533986-132534008 AGGGAGGGGTGCAGGGGAGCTGG + Intronic
1105601491 13:21892286-21892308 AGGAAGGAGTGAGGGGGAGCAGG - Intergenic
1106019439 13:25900468-25900490 AGTGAAGAGGGAGGGGCATCTGG + Intronic
1106272915 13:28171795-28171817 AGTGAGGAGAGAGGGGCTACAGG - Intronic
1107373317 13:39775584-39775606 TGTGAGGGGTGAATGGGAGCAGG - Intronic
1107437532 13:40393407-40393429 ATTGGGGGGTGAGGGGCAAGGGG + Intergenic
1107530432 13:41277739-41277761 AGGGAGGGGAGAGGGGCTGAAGG - Intergenic
1107762147 13:43691296-43691318 AGTAAGGAGTGATGGGCACCCGG - Intronic
1108459744 13:50653165-50653187 AGTGTGGGGTGGGGGGCAGGGGG + Intronic
1108522421 13:51258435-51258457 ATAGAGGGGTGAGGGCCATCTGG + Intronic
1109329701 13:60913631-60913653 AGTGAGGAGTGGGGCGCATCTGG + Intergenic
1110914472 13:81004465-81004487 GGGGTGGGGTGAGGGGAAGCGGG - Intergenic
1111452199 13:88433957-88433979 AGTGAGGGGTGAGAGACAGGAGG + Intergenic
1111706926 13:91761854-91761876 AGGGAGGGGAGAGGGGCTGAAGG - Intronic
1112037317 13:95508654-95508676 AGAGAGGAGTGAGGGGAAGAGGG + Intronic
1112801026 13:103109930-103109952 AGGGTGGGGTGAGGGAGAGCAGG - Intergenic
1112966791 13:105207038-105207060 AGTGAGGGAGGAGGGATAGCAGG - Intergenic
1113555457 13:111230474-111230496 CAGGAGGGGTGCGGGGCAGCAGG - Intronic
1113811102 13:113143177-113143199 AGGCAGGGGTGTGGGGGAGCAGG - Intronic
1113841578 13:113364206-113364228 AGGGCGGGGGGAGGGGCGGCTGG + Intergenic
1114453637 14:22842115-22842137 ACTGAGGGGAGTGGGGCAGGGGG - Intronic
1115724180 14:36194716-36194738 AGGGAGGGGAGAGGGGGAGGGGG + Intergenic
1115724519 14:36198517-36198539 GGGGAGGGGGGAGGGGCAGAGGG + Intergenic
1116353125 14:43891747-43891769 AGTTAGGGATGAGGAGCAGCAGG + Intergenic
1116923539 14:50608310-50608332 AGGGAGGGGTGGGGGACAGTAGG + Intronic
1117378345 14:55136063-55136085 AGTGAGGGGAGGAGGGCAGCTGG - Intronic
1118387896 14:65271895-65271917 AGTGAGGGGTGGGAGGGAACAGG - Intergenic
1118538877 14:66801562-66801584 AGAGTGGGGAGAGGGGCAGCGGG - Intronic
1118551677 14:66957794-66957816 AGTGGGAGGTGAGCAGCAGCGGG + Intronic
1118770331 14:68938592-68938614 AGTGAGTGGTGAGGACCTGCTGG - Intronic
1118801366 14:69192365-69192387 AGTGCGGGTTGGGGCGCAGCGGG + Intronic
1118981336 14:70719169-70719191 AGAAAGGGGTGAGGGGGACCAGG + Intergenic
1119635648 14:76271196-76271218 AGTGAGGGGTGATGGTGGGCAGG - Intergenic
1119719508 14:76881786-76881808 AGGCAGGGGTCATGGGCAGCTGG - Intergenic
1119767661 14:77200505-77200527 AGTGATGGGTGGGAGGCAGATGG - Intronic
1120090701 14:80329734-80329756 AGTGTGGGGTGGGGGGCTGGGGG + Intronic
1121013103 14:90533450-90533472 GGCGAGGGGTGAGTGGCTGCTGG - Exonic
1122075821 14:99233875-99233897 AGGCAGGGGAGGGGGGCAGCCGG + Intronic
1122266874 14:100550724-100550746 AGTGAGGAGTGAGGGCTGGCAGG - Intronic
1122296444 14:100708867-100708889 AGGTAGGGGAGCGGGGCAGCGGG + Intergenic
1122311067 14:100794740-100794762 AGAGAGCGGTGGGGGGCGGCGGG + Intergenic
1122888100 14:104719485-104719507 AGTGAGGGGGCAGCGGCTGCTGG - Exonic
1122918057 14:104867890-104867912 GGCCTGGGGTGAGGGGCAGCAGG - Intronic
1122925642 14:104898238-104898260 AGTGAGGGCACAGGGGCTGCGGG + Intergenic
1122929838 14:104928171-104928193 AGGGAAGGATGAGGGGCGGCAGG - Intronic
1122961283 14:105094564-105094586 AGTGAGGAGGGAGAGGCAGGAGG + Intergenic
1122965993 14:105126291-105126313 AGGGAGGGGTGCTGGGCAACAGG + Intergenic
1122970977 14:105152098-105152120 AGTGTGGGTTGTGGGGGAGCGGG - Intronic
1123011270 14:105350659-105350681 AGAGAAGGCTGAGGGGCAGGTGG - Intronic
1123036699 14:105474651-105474673 GGTGGCGGGTGCGGGGCAGCCGG - Intronic
1123632661 15:22272790-22272812 TGTGTGCGGTGAGGGGCAGCAGG + Intergenic
1123632710 15:22272983-22273005 TGTGTGTGGTGAGGGGCAGCAGG + Intergenic
1124003829 15:25780525-25780547 GGTGAGGGGTGAGAGGCTGGAGG - Intronic
1124240589 15:28024679-28024701 GCTGAGGGTTGTGGGGCAGCGGG - Intronic
1124484589 15:30103542-30103564 GGTGAGGGGTGAGGGGTAAGAGG + Intergenic
1124518992 15:30393696-30393718 GGTGAGGGGTGAGGGGTAAGAGG - Intronic
1124539664 15:30572550-30572572 GGTGAGGGGTGAGGGGTAAGAGG + Intergenic
1124758988 15:32435032-32435054 GGTGAGGGGTGAGGGGTAAGAGG - Intergenic
1124864083 15:33472217-33472239 AGAGATAGGTGAGGGGCTGCAGG - Intronic
1125193049 15:37015592-37015614 AGTGTGGGGTGGGTGGCAGGGGG + Intronic
1125561616 15:40638246-40638268 AGGGAGGGGGGAGGGGGAGGGGG + Intronic
1125577997 15:40768083-40768105 AGGGAGGGGTCAGGGACAGCAGG + Intronic
1126709920 15:51443884-51443906 AGTGAGGGGCCTGGGGCTGCAGG + Intergenic
1127395280 15:58539684-58539706 AGGGAGAGGTGAGGGGAGGCAGG - Intronic
1127485173 15:59412058-59412080 AGTGAGGTGGGAGGGGCAGAGGG + Intronic
1127841131 15:62833066-62833088 AGTTAGGGGGAAGGGGCTGCAGG + Intronic
1127991553 15:64122574-64122596 GGTGAGGGGTGAGGGGCCAAGGG - Intronic
1129318673 15:74761841-74761863 AGTGCAGGGTGATGGGCATCGGG - Intergenic
1129383726 15:75184274-75184296 ACTGAGGGGCCAGGGGTAGCTGG + Intergenic
1129417281 15:75392757-75392779 AGTGAGAGGTGTGGGCCAACAGG + Exonic
1129462613 15:75707498-75707520 AGTGTGGAGTGAGGGCCAGCAGG + Intronic
1129644706 15:77419739-77419761 AGGGAGGGGGCAGGGGCGGCAGG + Intronic
1129718948 15:77867184-77867206 GGAGAGGGGAGAGGGGCAGCAGG - Intergenic
1129722256 15:77883918-77883940 AGTGTGGAGTGAGGGCCAGCAGG - Intergenic
1129750368 15:78058713-78058735 TCTGAGGGGTGGGGGGCAGATGG - Intronic
1129874151 15:78961714-78961736 GGTGGGGGGTGGGGGGCGGCGGG - Exonic
1129920096 15:79312193-79312215 AATGAGGGGCCACGGGCAGCAGG + Intronic
1130270651 15:82445282-82445304 GTTGAGGGGTGAGGGGCGACGGG + Intergenic
1130459983 15:84153669-84153691 GGAGAGGGGAGAGGGGCAGCAGG + Intergenic
1130462995 15:84172605-84172627 GTTGAGGGGTGAGGGGCGACGGG + Intronic
1130489679 15:84422183-84422205 GTTGAGGGGTGAGGGGCGACGGG - Intergenic
1130501270 15:84500945-84500967 GTTGAGGGGTGAGGGGCGACGGG - Intergenic
1130599284 15:85264905-85264927 AGTGAGGGGTGACCGGGGGCTGG + Intergenic
1130981152 15:88812538-88812560 AGTGAGAGGCCAGGGGCTGCAGG - Intronic
1131426064 15:92346366-92346388 AGGGAGGGGAGAGGGGCTGAAGG + Intergenic
1131545494 15:93312646-93312668 AGTGGGTGGTGGGGGGCAGATGG + Intergenic
1131764479 15:95660451-95660473 ACTGAGTGGTGGGGGGCAGGAGG - Intergenic
1131922046 15:97338649-97338671 AAAGAGGGGAGAGGGGCTGCAGG - Intergenic
1132143431 15:99412907-99412929 AGGGAGGGGAGAGGGGCATAGGG - Intergenic
1132366591 15:101262223-101262245 AGGGAGGGGAGAGGGGCTGAAGG - Intergenic
1132583601 16:696179-696201 AGGGGGAGCTGAGGGGCAGCTGG - Intronic
1132606948 16:797534-797556 AGTGAGGGGTGAGGGGCAGCTGG + Intronic
1132681064 16:1141943-1141965 CGTGAGGACTCAGGGGCAGCAGG - Intergenic
1132716480 16:1292631-1292653 AGAGAGGGGAGAGGGGGAGGGGG - Intergenic
1132746798 16:1439552-1439574 GGGGAGGGGGGAGGCGCAGCCGG + Intronic
1132776325 16:1596776-1596798 AGTCAGGGGTGAGGAGCAGAGGG - Intronic
1133041125 16:3060104-3060126 AGTGAGGGGTGGGTGGAACCTGG + Exonic
1133842766 16:9425047-9425069 AGTGAGGGGGGAGAGGGAGGGGG + Intergenic
1133883778 16:9807262-9807284 AGGGAGGGGGGAGGGGGAGGGGG + Intronic
1135517222 16:23146230-23146252 AGTGTGGGGTGGGGGGCGGGGGG + Intronic
1136062949 16:27739200-27739222 AGAGAGAGGCGAGGGACAGCTGG + Intronic
1136297482 16:29311956-29311978 AGTGAGGTGTGAGGGGCTCCAGG + Intergenic
1136454332 16:30371744-30371766 AGTGAGGGGAGAGGGGTTGACGG - Intronic
1137253437 16:46756965-46756987 ATTGTGGGGTGAGGGGCAGGAGG + Intronic
1137338410 16:47573476-47573498 AGGGAGGGGAGAGGGGTAACAGG + Intronic
1137619739 16:49868403-49868425 AGCTAGGGGTGCGGGGCCGCCGG + Intergenic
1137988737 16:53131349-53131371 GGGGAGGGGGGAGGGGCAGGCGG + Intronic
1138604322 16:58078118-58078140 AGTGAGGTCAGAGGGGCTGCCGG + Intergenic
1138694237 16:58796846-58796868 AGTTGGGGGTGAGGGGCAGGGGG - Intergenic
1139475010 16:67198726-67198748 AGAGAGGGTTATGGGGCAGCAGG - Exonic
1139531891 16:67546482-67546504 AGTGGGGGGAAAGGGGCACCAGG - Exonic
1140002584 16:71040122-71040144 TGTGAGGGGTGGAGTGCAGCAGG + Intronic
1140122936 16:72099045-72099067 GGTGAGGCCTGTGGGGCAGCAGG + Exonic
1140482962 16:75272377-75272399 AGTGGGGGGTGGGGGGCACTAGG + Intergenic
1141033199 16:80607257-80607279 AGTCAGGGATGAGGCCCAGCAGG + Intronic
1141439865 16:84023186-84023208 AGAGAGGGGAAAGGGGCAGTGGG - Intronic
1141524772 16:84604242-84604264 AGTGTGGGGTGGGGAGCAGGGGG - Intronic
1141618252 16:85222139-85222161 AGGGAGCGGGGAGGGGCAGTGGG - Intergenic
1141970357 16:87477782-87477804 TGTGTGCGGTGAGGGGCAGCAGG - Intronic
1141970388 16:87477908-87477930 TGTGTGCGGTGAGGGGCAGCAGG - Intronic
1142059033 16:88018033-88018055 AGTGAGGTGTGAGGGACCCCGGG + Intronic
1142171010 16:88622793-88622815 AGTGAGGGATGATGGAAAGCAGG + Intronic
1142292981 16:89201226-89201248 GGGGAGGGCTGCGGGGCAGCAGG + Intronic
1142638665 17:1272328-1272350 AGTGAGGGCAGAGGGGCCTCAGG + Intergenic
1142978007 17:3656633-3656655 GCTGGGTGGTGAGGGGCAGCCGG - Intronic
1143031694 17:3971501-3971523 TGGGAGGGCTGGGGGGCAGCGGG + Intergenic
1143130656 17:4675020-4675042 AGAGGGGGGTGAGGGGGTGCAGG - Intronic
1143164300 17:4890188-4890210 GGTGTGGGGTGGGGGGCAGAGGG - Intronic
1143187780 17:5020871-5020893 AGCGACTGGTGAGGGGCAGCAGG + Exonic
1143382143 17:6503231-6503253 AGTGAGGGGTGGGAGGCTGGTGG - Intronic
1143473943 17:7192499-7192521 AGGGCAGGGTGAGGAGCAGCGGG + Intronic
1143473968 17:7192580-7192602 AGGCAGGGGAGAGGGCCAGCGGG + Intronic
1143832235 17:9661770-9661792 AGGCTGGAGTGAGGGGCAGCAGG - Intronic
1144078127 17:11737315-11737337 AGGGGTGGGTGGGGGGCAGCTGG - Intronic
1144143682 17:12376379-12376401 AGGGAGGGGGGAGGGGGAGGGGG + Intergenic
1144220169 17:13092587-13092609 AGAGTGGGGTGGGGTGCAGCTGG + Intergenic
1144600537 17:16608816-16608838 AGTGGAGGTTGAGGGGCACCTGG - Intergenic
1144805521 17:17964065-17964087 GGTGAGGGCTGATGGGCATCAGG + Intronic
1144993577 17:19250838-19250860 AGTGAGGGGGGAGGTGCAGGGGG - Intronic
1145033129 17:19520462-19520484 ATTGTGGGGAGAGGGTCAGCAGG - Intronic
1146094795 17:29918965-29918987 GGTTAGGGGTGAGTGGCAGGAGG - Intronic
1146161734 17:30563425-30563447 ATAGTGGGGTGAGGGTCAGCAGG + Exonic
1147157117 17:38549594-38549616 AGGCAAGGGTGAGGGGCAGTGGG - Intronic
1147341758 17:39756520-39756542 AGTGATGGGGGAGGGGAAGAAGG + Intergenic
1147628909 17:41917873-41917895 AATGTGGGGTGAGGGACAGCTGG - Intronic
1147660137 17:42112953-42112975 AGGGAGAGGTGGGGGGCTGCAGG + Intergenic
1147725485 17:42564083-42564105 AGGGAGGGGTCAGAGCCAGCGGG - Exonic
1147769293 17:42856596-42856618 TGTGAGGGATGGGGAGCAGCTGG + Exonic
1147772027 17:42874415-42874437 TGTGAGGGATGGGGAGCAGCTGG + Intergenic
1147939891 17:44038957-44038979 AGTGTGGGGTGGGGGGAGGCGGG + Intronic
1148547986 17:48531359-48531381 TGGGAAGAGTGAGGGGCAGCTGG - Intergenic
1148646511 17:49222486-49222508 GGTGGGGGGTGAGGGGGAGAGGG + Intronic
1148875010 17:50681897-50681919 AGTGAGGGGTGAGGGGCCAGAGG - Intronic
1150004207 17:61459841-61459863 TGTGAGGGGTGAGGGGTTGGGGG - Intronic
1150288397 17:63966862-63966884 AGTGAAGGGTGAGTGGGGGCTGG + Intronic
1150294825 17:64002079-64002101 AGAGAGGGGTGAGGGAGAGAGGG - Exonic
1150445593 17:65225153-65225175 TCTGATGGGTGAGGGGCAGATGG - Exonic
1150520834 17:65865709-65865731 AGTGGCAGGTGAGGGGCAGGTGG - Intronic
1151744136 17:76002431-76002453 AAAGAGGAGAGAGGGGCAGCAGG + Intronic
1151966004 17:77432036-77432058 AGCTGGGGGTGGGGGGCAGCAGG + Intronic
1152098381 17:78286446-78286468 AGGCAGGGGTGGGGGGCAGGAGG - Intergenic
1152589674 17:81205377-81205399 AGTGGGGTAGGAGGGGCAGCGGG + Intronic
1152596905 17:81242219-81242241 AGGCAGGGGTGGGGGGCAGCCGG - Intergenic
1152619932 17:81358072-81358094 AGTGCGGGCTAAAGGGCAGCAGG + Intergenic
1154139615 18:11811338-11811360 TGTGAGGGGCAAGGGGCAGGAGG - Intronic
1154241515 18:12657794-12657816 AGTGGGCGGCGAGGGGCCGCGGG - Exonic
1154309174 18:13254266-13254288 GGTGAGGAGTGAGGGGCCCCAGG + Intronic
1154316672 18:13309746-13309768 AGTGAGGGGTGAAGGAAAGGTGG + Intronic
1155157504 18:23169908-23169930 TGTGTGGGGTCATGGGCAGCCGG + Intronic
1157273602 18:46294745-46294767 AGTGGGGGGTGGGGGGCGGTTGG - Intergenic
1157521557 18:48348943-48348965 TGTGAGAGCAGAGGGGCAGCAGG - Intronic
1157562022 18:48654969-48654991 TGTGTGGGGTGGGGGGCAGGGGG + Intronic
1159359410 18:67381409-67381431 GGTGGGGGGTGAGGGGCCGCAGG + Intergenic
1159756443 18:72371428-72371450 TGTCAGGGGTCAGGGGCAGAAGG + Intergenic
1160592637 18:79952544-79952566 GGTGAGGGGTGAGGGGCGCGCGG + Intergenic
1160592669 18:79952646-79952668 AGTGAAGGGTGAGGGGCGCCTGG + Intergenic
1160686141 19:437712-437734 AGGTGGCGGTGAGGGGCAGCTGG - Intronic
1160728494 19:629629-629651 GGTGGTGGGCGAGGGGCAGCTGG + Exonic
1160752560 19:741392-741414 AGTGAGGGGAGACGGGCTGCAGG + Intronic
1160752568 19:741415-741437 GGTGAGGGGAGACGGGCTGCAGG + Intronic
1160752576 19:741438-741460 GGTGAGGGGAGACGGGCTGCAGG + Intronic
1160752584 19:741461-741483 GGTGAGGGGAGACGGGCTGCAGG + Intronic
1160752606 19:741522-741544 GGTGAGGGGAGACGGGCTGCAGG + Intronic
1160752614 19:741545-741567 GGTGAGGGGAGACGGGCTGCAGG + Intronic
1160757905 19:767297-767319 AGAGCGGGGTGGGGGGCAGCAGG + Intergenic
1160914377 19:1489828-1489850 AGTGCGGGGTCAGGGACTGCTGG + Exonic
1161072970 19:2271441-2271463 AGGGGTGGGTGAGGGGCATCAGG - Exonic
1161076225 19:2287097-2287119 GCTGAGGGATGAGGGGCTGCTGG - Intronic
1161083692 19:2324058-2324080 AGTGGGGTGAGGGGGGCAGCGGG - Intronic
1161196263 19:2988153-2988175 TGGGCGGGGTGAGGGGCAGCGGG + Intronic
1161253948 19:3295873-3295895 AGGGGGTGGTGAGGGGCAGGGGG - Intronic
1161282781 19:3454708-3454730 AAAGGGGGGTGAGGGGCAGATGG - Intronic
1161283417 19:3457430-3457452 GGTGGGGGGTGAGGGACACCTGG - Intronic
1161301393 19:3544608-3544630 AGAGAAGAGTGAGGGGCAGTGGG + Exonic
1161393566 19:4033345-4033367 AGCTGGGGGTGAGGGGCACCGGG + Intronic
1161496909 19:4591481-4591503 GGTGAGGGTTGAGGAGCATCTGG - Intergenic
1161590621 19:5127669-5127691 AGGGAGGGCTGTGGGGAAGCGGG + Intronic
1161783217 19:6307293-6307315 AGAGAGGGGAGAGGGGGACCAGG + Intronic
1161793967 19:6376002-6376024 AGGGTGGGGTGTGGGGCAGAAGG - Intronic
1161983580 19:7642716-7642738 AGTGAGGGGAGAGGAGCCACAGG - Intronic
1162032880 19:7925016-7925038 AGTCGGGGGTGGGGGCCAGCCGG + Exonic
1162059431 19:8085849-8085871 ACAGAGGGAAGAGGGGCAGCAGG + Intronic
1162787638 19:13045640-13045662 AGGTAGGAGAGAGGGGCAGCAGG + Intronic
1163350003 19:16770615-16770637 ACTGAGGGCTGTGGGGCAGGGGG - Intronic
1163427223 19:17246125-17246147 GGTGCGGGGGGAGGGGCAGAGGG - Intronic
1163673693 19:18644712-18644734 AGTGAGGCTTGTGGGGCTGCTGG + Intronic
1163754959 19:19101139-19101161 AGGGAGGGCTGTGGGGGAGCAGG + Intronic
1164578367 19:29419180-29419202 AGGGAGGAGTGTGGGGCAGGTGG - Intergenic
1164958613 19:32407259-32407281 AGTAATGGGTGGGGGGGAGCAGG - Intronic
1165157176 19:33795913-33795935 CGTCACGGGAGAGGGGCAGCGGG + Intronic
1165315014 19:35049443-35049465 AGGGAGGGGTGAGGGCAGGCAGG - Intronic
1165326781 19:35118667-35118689 GGTGTGGGATGAGGGGCAGGAGG + Intronic
1165452036 19:35889457-35889479 AGTGAAGGGAAAGGGGCTGCTGG + Intronic
1165472063 19:36009558-36009580 AGGGCGGGTTGAGGGTCAGCAGG + Intronic
1165720172 19:38073465-38073487 AATGAGGAGTGAGTGGCAGTGGG - Intronic
1165741199 19:38206288-38206310 AGTGGAGGGAGAGAGGCAGCAGG - Exonic
1166259371 19:41627144-41627166 AATGAGAGGGGAGGGGCAGAGGG - Intronic
1166324767 19:42042487-42042509 AGTGAGGGAGGGCGGGCAGCTGG - Intronic
1166328930 19:42067698-42067720 AGACAGGGTTGAGGGGCAGCAGG + Intronic
1166619250 19:44280831-44280853 ATTGTGGGGAGAGGGTCAGCAGG + Intronic
1166634538 19:44438688-44438710 AGTGAGGGGAGAGGAGCTGAGGG + Intronic
1166714535 19:44958275-44958297 GGTGAGGGGAGAGGGGTGGCTGG + Intronic
1166811631 19:45517893-45517915 AAAGGGGGGTGAGGGGCGGCGGG - Intronic
1167128641 19:47569690-47569712 AGAGATGGGTGGGGGGCGGCGGG - Intergenic
1167178035 19:47879503-47879525 AGGGAGGAGTGAGTGCCAGCAGG + Intronic
1167298807 19:48667460-48667482 AGTGAGGGGTGAGACTCACCAGG - Intronic
1167618681 19:50549654-50549676 AGGGAGGGCTGGGAGGCAGCAGG + Intronic
1167648950 19:50719442-50719464 GGGGAGGGGGGAGGGGCCGCGGG - Intronic
1168086257 19:54049574-54049596 AGTGAGGTGTGAGGGGGAGGAGG - Intronic
1168097061 19:54121943-54121965 AGTGAGTGCTGGGGGGCAGGCGG + Exonic
1168098054 19:54126624-54126646 AGGGAAAGGTGAGGGGCGGCCGG + Intronic
1168185793 19:54698587-54698609 AGTGAAGGGAGAGGGTCCGCAGG + Intronic
1168219401 19:54949712-54949734 AGGGAGGGGAGAGGGGCTGAAGG + Intronic
1168252669 19:55149322-55149344 AGTGTGGAGCCAGGGGCAGCAGG - Exonic
1168254230 19:55157217-55157239 AGTGAGGGGTCTGGGGCGGGAGG - Intronic
1168302038 19:55410626-55410648 TGGGAGAGGTGAGGGGCTGCTGG + Intergenic
1168525770 19:57087765-57087787 AGAGAGGGGAGAGGGGGAGGGGG + Intergenic
1168543498 19:57231620-57231642 AGCGAGAGGTGAGGGGAAGAAGG - Intronic
1168558321 19:57362274-57362296 GGTCAGGGGTGGGGGGCAGGGGG - Intergenic
925347925 2:3183488-3183510 AGGAAGGGGTGAGGGACAGAAGG - Intergenic
925465846 2:4106781-4106803 AGTGACAGGTGAGAAGCAGCAGG - Intergenic
926117592 2:10223351-10223373 AGTGAGTAGTGAGGGACTGCTGG + Intergenic
926168078 2:10534124-10534146 TGTGCGGGTTGTGGGGCAGCAGG - Intergenic
926297705 2:11580706-11580728 AGTGAGGGGTGATCAGAAGCTGG - Exonic
926346978 2:11955839-11955861 AGGGTGGGGTAAGGGGTAGCTGG + Intergenic
926364029 2:12116420-12116442 AGTGAGGGGGGAGGGGGTGGAGG - Intergenic
927195259 2:20542378-20542400 AGTCAGGGGTGAGGAGAACCGGG - Intergenic
927557940 2:24049417-24049439 TGTGGGGGGTGGGGGGCAGAAGG - Intronic
927922144 2:26981240-26981262 AGTGAGTGGGGACGGGCACCAGG + Intronic
927943162 2:27118536-27118558 AGTCCTGGGGGAGGGGCAGCTGG - Intronic
928093563 2:28391023-28391045 GGAGAGGGGTGTGGGGCAGGCGG - Intergenic
928201815 2:29252074-29252096 AGGAATGGGTGAGGGGGAGCTGG - Intronic
929121069 2:38484488-38484510 GGAGCGGGGAGAGGGGCAGCAGG - Intergenic
929431456 2:41890807-41890829 AGGGAGGGGAGAGGGGCTGAAGG + Intergenic
929852410 2:45604367-45604389 AGGGAGGGGAGAGGGGAAGGGGG + Intronic
931184640 2:59938201-59938223 AGGGTGGGCTGAGGTGCAGCAGG - Intergenic
932229270 2:70069157-70069179 TGTGAGGTGTGAGGCTCAGCAGG - Intergenic
932238649 2:70141025-70141047 TGTGTGGGGTGAGGGGTAGAAGG + Intergenic
932321673 2:70827026-70827048 AGTGTGGTGTGAGGTGAAGCAGG - Intergenic
932437020 2:71707946-71707968 AGTGAGGGGTGGAGGGCAGGTGG - Intergenic
932621184 2:73265662-73265684 AGTAAGGGGTAAGAGGCACCAGG + Intronic
933871589 2:86571146-86571168 AGTGAGGGGTTTGGGGAAGGTGG + Intronic
933988263 2:87612197-87612219 AGTGAGGTGAGAGGGGCAGCTGG + Intergenic
934575364 2:95397237-95397259 AGCGATGTGGGAGGGGCAGCTGG + Intergenic
936305577 2:111338611-111338633 AGTGAGGTGAGAGGGGCAGCTGG - Intergenic
937128193 2:119487897-119487919 TGTGTGGGGGGAGGGGCTGCTGG - Intronic
937412868 2:121691481-121691503 AGTGTGGAGTGAGGGCCAGAGGG + Intergenic
937433367 2:121859758-121859780 AGGGAGGGGAGAGGGGCTGAAGG + Intergenic
937911026 2:127075749-127075771 AGAGGGTGGTGGGGGGCAGCTGG - Intronic
938288695 2:130138256-130138278 CGTGAGGGCTGAGGCCCAGCTGG - Intergenic
938467838 2:131534676-131534698 CGTGAGGGCTGAGGCCCAGCTGG + Intergenic
938963491 2:136363798-136363820 AGAAAGGGGTGAAGGGCAGTCGG - Intergenic
939997833 2:148936964-148936986 AGTGTGGGGTGAGGAGGAGGAGG - Intronic
941036075 2:160570608-160570630 AGGGAGGTGTGAGATGCAGCCGG - Intergenic
941088006 2:161141478-161141500 AGTCAGGGTTGAGGGGCAAGAGG - Intronic
941182682 2:162279722-162279744 AGTGAGGGGCCATGGGCAGAGGG - Intronic
942457294 2:176147200-176147222 AAGCAGGGGTGAGGGGCAGATGG + Intergenic
945628328 2:212238375-212238397 AGTGAAGGGTGAGCTGAAGCAGG - Intronic
946305811 2:218856497-218856519 AGTGGTGGGGGAGAGGCAGCTGG - Intergenic
946321289 2:218955900-218955922 AGGGTGGGGGGGGGGGCAGCAGG + Intergenic
946325057 2:218980824-218980846 AGAGTGGGGTGAAGGGCAACCGG + Intergenic
946848330 2:223880949-223880971 AGTGATGGGATTGGGGCAGCTGG - Intronic
947139542 2:227008482-227008504 AGTGAGGGATGAGGGGATGAGGG - Intronic
947367140 2:229408411-229408433 AGAGAGGGAGGAGGGGCAGGAGG - Intronic
947586827 2:231361703-231361725 AGGAAGTGGTGAGGGGCAGCTGG - Intronic
947714895 2:232334513-232334535 AGAGGGAGGTGAGGGGCACCAGG - Intronic
947733970 2:232445464-232445486 AGAGGGAGGTGAGGGGCACCAGG - Intergenic
948155581 2:235778492-235778514 AGTGAGGGGCCTGGGGCAGGAGG - Intronic
948360909 2:237419524-237419546 AGGGAATGGGGAGGGGCAGCTGG - Intergenic
948908782 2:240992707-240992729 AGTCAGGGGTGGAGGACAGCAGG + Intronic
1168881596 20:1210949-1210971 AGTCAGGGGTGGGGGGCAAGGGG - Intergenic
1169260718 20:4136188-4136210 AAGGTGGGGTGAGGGGCAGGAGG + Intronic
1169273376 20:4217288-4217310 AGGGAGTGGAGAGGGCCAGCAGG + Intergenic
1169293505 20:4372729-4372751 AATGAGGGGTGAGAGACAGGAGG - Intergenic
1169375740 20:5065599-5065621 AGTGAGGAGTGAAGGGCAGTAGG - Intergenic
1169468123 20:5859274-5859296 GGGGAGGGGTGAGGGGCAGGGGG + Intronic
1171171959 20:23023423-23023445 GGTGAGGGGTGGGGGACCGCAGG + Intergenic
1171448094 20:25218723-25218745 AGTGGGGTGGGAGGGGCAGAGGG - Intronic
1172010706 20:31844358-31844380 ACTTGGGGGTGAGGGGAAGCAGG - Exonic
1172151394 20:32792843-32792865 TGGGTGGGGTGTGGGGCAGCAGG - Intronic
1172274871 20:33673997-33674019 GCTGAGGGGTGGGAGGCAGCAGG + Intronic
1172294460 20:33798786-33798808 AGTGAGGAGTGAGGGGGAGGTGG - Intergenic
1172310562 20:33915191-33915213 ACTGGGGGGTGGGGGGAAGCTGG - Intergenic
1172324642 20:34024963-34024985 GCTGAGGGGTTAGGGGGAGCTGG + Intronic
1172353576 20:34262754-34262776 AGTGAAGTGAGAGGGGCAGAGGG - Intronic
1172441128 20:34967494-34967516 CTTGAGGGGTGAGGGGCAGAGGG - Intergenic
1172442648 20:34977045-34977067 AGAGAGGGGGGAGGGGTAGGGGG - Intronic
1172455366 20:35067831-35067853 AGTGTGGGGAGAGGGGGAGGAGG + Intronic
1172578736 20:36030277-36030299 AGGGAGGGGAGAGTGGCAGGAGG + Intronic
1172696453 20:36826352-36826374 AGGGAGGGGGGAGGGGGAGGGGG - Intronic
1173939357 20:46896139-46896161 AGCGAGGGCGGAGGGGCAGGAGG + Intronic
1173972858 20:47165840-47165862 AGAGAGGGGTCAGTGGCATCTGG - Intronic
1173990970 20:47303179-47303201 GGAGATGGGTGAGGAGCAGCAGG + Intronic
1174053875 20:47785317-47785339 AGTGGGGCGTGGGGGGCAGGTGG - Intronic
1174199892 20:48799800-48799822 GGTGAGGGGGCAGGGGCTGCGGG + Intronic
1174267317 20:49341146-49341168 AGGGAGGGGGGAGGGGGAGAGGG - Intergenic
1174379202 20:50146013-50146035 AGGGAGGGACCAGGGGCAGCAGG - Intronic
1174471320 20:50763211-50763233 AGTGAGTGGTGAAGGACAGCTGG - Intergenic
1174805103 20:53598498-53598520 AGTGAGGTCTGAGGGACCGCAGG + Intronic
1175175968 20:57112317-57112339 TGTGAGGGGTGAGGGAAAGGAGG + Intergenic
1175221630 20:57420707-57420729 AGTGTGGGCTGGTGGGCAGCAGG + Intergenic
1175226130 20:57444980-57445002 GGGGAGGAGGGAGGGGCAGCAGG + Intergenic
1175254043 20:57628149-57628171 AGTGGGGGGTGAGGGTGAGAAGG + Intergenic
1175487347 20:59355621-59355643 AGAGAGGGGAGAGGGGGAGAGGG - Intergenic
1175744471 20:61445553-61445575 AGGGAGGGGAGAGGGGGAGGAGG - Intronic
1175767473 20:61601424-61601446 GGTGAGGGGTGTGGGGCACTGGG - Intronic
1175816134 20:61884133-61884155 AGTGAGAGGGGAGGGTCTGCTGG + Intronic
1175918126 20:62437023-62437045 AACCAGGGGAGAGGGGCAGCAGG - Intergenic
1176010058 20:62888459-62888481 AGTGCTGGGTGAGGGTCTGCAGG - Intronic
1176195385 20:63834504-63834526 TATGAGGGATGAGCGGCAGCAGG + Intergenic
1176239010 20:64067382-64067404 AGTGCCGGGAGAGGGGAAGCGGG + Intronic
1176284656 21:5012954-5012976 ACTGAGGGGGCAGGGGCAGGAGG - Intergenic
1178420727 21:32441261-32441283 AGTTAGGGGTGTGGGGCAGGAGG + Intronic
1178443570 21:32618315-32618337 AGTGAGTGCTGAGGGACCGCTGG + Intergenic
1178461446 21:32806252-32806274 AGTGAGGAATGAGGGACAGATGG + Intronic
1178567174 21:33698338-33698360 TGTTAGGGGGGAGTGGCAGCAGG - Intronic
1179141807 21:38732484-38732506 GGTGAGGGGTGAGGGGTATAGGG - Intergenic
1179333027 21:40423881-40423903 TGTGAGGGGTGTGGGGAAGAGGG + Intronic
1179872525 21:44250521-44250543 ACTGAGGGGGCAGGGGCAGGAGG + Intronic
1180118188 21:45725865-45725887 AGGAAGGGGTGGGGGGCAGCTGG + Intronic
1180655248 22:17414796-17414818 GGTGAGGCGTTAGGGGCAGTGGG + Intronic
1181108262 22:20587270-20587292 CGTGAGGGCTGAGGCCCAGCTGG - Exonic
1181939060 22:26461499-26461521 GGGGTAGGGTGAGGGGCAGCAGG - Intronic
1182239811 22:28906867-28906889 ATTGGGAGGTGAGGGGGAGCTGG - Intronic
1182267534 22:29129722-29129744 GGTGGAGGGTGAGGGGCAGCTGG + Intronic
1182444312 22:30381179-30381201 TGTGAGGAGGGCGGGGCAGCGGG - Intronic
1182447811 22:30399718-30399740 GGTGAGGGAAGAGGGGCTGCGGG + Exonic
1182975643 22:34621676-34621698 AGTGAGGGGTAAGGGTTAGAAGG + Intergenic
1182988566 22:34744231-34744253 AGTGAGGGGTGGTGGGGGGCAGG - Intergenic
1183121341 22:35732324-35732346 ACTGAGGGAAGAGGGGCACCAGG + Intergenic
1183218630 22:36497512-36497534 ACAGAGGGGTGAGGGGCGGGGGG - Intronic
1183352926 22:37343886-37343908 AGGGGGGTGTGAGGGGCATCAGG - Intergenic
1183409848 22:37648428-37648450 AAAGAAGGGTGAGGGGCCGCGGG + Exonic
1183481820 22:38069395-38069417 GGTGAGGGGTAAGGGGCTGAGGG - Intronic
1183485923 22:38087793-38087815 TGTGAGTGGTGAGGGGGTGCTGG - Intronic
1183719847 22:39556503-39556525 AATGTGTGGTGAGGGGCACCAGG - Intergenic
1184040387 22:41939602-41939624 AGGAAGGAGGGAGGGGCAGCGGG + Intronic
1184483886 22:44764865-44764887 AGAGAGGGGAGAGGGGCTCCCGG + Intronic
1184530063 22:45049698-45049720 AGTGAGGGGTGATGGCAAGTTGG - Intergenic
1184561879 22:45268464-45268486 AGTGAGGGGTGAGCGGGTGGAGG - Intergenic
1184662269 22:45970867-45970889 CCTGAGGGGGGCGGGGCAGCAGG - Intronic
1184757041 22:46522736-46522758 ACAGAAGGGTGAGAGGCAGCAGG + Intronic
1185339314 22:50284477-50284499 ACTGTGAGGGGAGGGGCAGCAGG - Intronic
1185416637 22:50714240-50714262 AGTGATGGGTGGGGTGCAGTGGG + Intergenic
949991344 3:9581866-9581888 AGTAAGGAGTCAGGGGCAACAGG - Intergenic
950042848 3:9931265-9931287 GGTGAGGGGTGAGGGGCTCAGGG + Intronic
950154894 3:10714012-10714034 AGTGAGGGGAGAGGAGTGGCAGG - Intergenic
950433791 3:12966996-12967018 GGTGTGAGGTGAGGGGCAGGAGG - Intronic
950459224 3:13111330-13111352 CGTGGGTGGTGAGGGGCTGCTGG + Intergenic
950476904 3:13220415-13220437 AGTGGGGTGTGAGGGGCAACTGG - Intergenic
950569403 3:13790781-13790803 AGTGGGGAGTGAGGAGCAGTGGG - Intergenic
950569407 3:13790798-13790820 AGTGGGGAGTGAGGAGCAGTGGG - Intergenic
950799727 3:15540370-15540392 GGTGAGGGATGAGGGGCATGAGG + Intergenic
951131858 3:19055984-19056006 TGTCAGGGGTGAGGGGCTGGGGG + Intergenic
951827966 3:26889569-26889591 GGTGAGGGTTGAGGGGCAGGTGG - Intergenic
952079937 3:29745583-29745605 AGTGATGGGTGGGGGACAGGGGG + Intronic
952211251 3:31231279-31231301 AGTGGGGGGTGGGGGGGAGGCGG + Intergenic
952497422 3:33928280-33928302 GGTGAAAAGTGAGGGGCAGCAGG - Intergenic
953126375 3:40095109-40095131 AGTTGGGGGTGAGGGGAGGCAGG + Intronic
953771388 3:45780687-45780709 AGAGAGGGGTGGGAGGCAGCAGG + Intronic
953951353 3:47192859-47192881 GATGAGTGGTGAGGGGCAGAGGG - Intergenic
954617538 3:51977079-51977101 GCTGAGGAGTGAGGGGCTGCAGG - Intronic
954793754 3:53150904-53150926 AGGGAAGGCTGAGGGGCTGCAGG - Intergenic
954994291 3:54867278-54867300 GGTGAGGGGCGAGGGGGAGTAGG + Intronic
955201413 3:56855154-56855176 GGAGAGAGGTGAGGGGCAGGAGG + Intronic
955377514 3:58410663-58410685 AGAGCTGGGTGAAGGGCAGCTGG - Intronic
955543302 3:60000860-60000882 AGTGTAGGGAGAGTGGCAGCAGG - Intronic
956432094 3:69197591-69197613 GGAGAGGGGAGAGGGGGAGCGGG + Intronic
956458055 3:69443160-69443182 AGGGAGGGGAGAGGGGCTGGAGG + Intronic
958431165 3:94043542-94043564 AGGGAGGGGGGAGGGGGAGGAGG - Intronic
959224932 3:103568267-103568289 TCTGGGGGGTGAGGGGCAGGAGG + Intergenic
959501643 3:107113629-107113651 TGTGAGGGGTGAGGGCGAGGAGG + Intergenic
959958910 3:112273558-112273580 AGGGAGGGGTGAGGGGGTGGTGG + Intronic
960709605 3:120514567-120514589 AGGGAGGGGGGAGGGGGAGGGGG - Intergenic
960816591 3:121679784-121679806 AGTGGGGGAGGAGGGGCAGTCGG - Intronic
961001687 3:123378501-123378523 AGTGAAGGGAGAGGGACAGACGG + Intronic
961057191 3:123799177-123799199 GGTGAGGGGTGAGGGGTAAGGGG - Intronic
961370241 3:126424276-126424298 AGGGATGGGTGAGGGCCATCTGG + Intronic
961402786 3:126658750-126658772 AGATAGAGGAGAGGGGCAGCCGG + Intergenic
961456691 3:127028117-127028139 ACTGGGGGGTGGGGGGCACCAGG - Intronic
961464162 3:127071426-127071448 AGTGTGGGGTGAGGACCAGGTGG + Intergenic
961588643 3:127958150-127958172 TGTGAGGAGTTAGGAGCAGCTGG + Intronic
961671192 3:128532644-128532666 AGTGGGGGGTGCTGGGCAGAAGG + Intergenic
961877919 3:130038264-130038286 AGTGAGTGCTGAGGGACAGTCGG - Intergenic
962263453 3:133929146-133929168 AGGGAGGCGTGAGGGACAACTGG + Exonic
962317575 3:134368367-134368389 AGTGGGGGGTGGGGGGTGGCAGG - Intronic
962686890 3:137856596-137856618 CTTCAGGGGTGATGGGCAGCTGG - Intergenic
963942410 3:151108230-151108252 GGGGTGGGGTGAGGGGCAGGTGG + Intronic
964270570 3:154951146-154951168 TTTGTGGGGTGAGGGACAGCGGG + Intergenic
964751676 3:160059403-160059425 AGGGAGGTGTGAAGTGCAGCAGG + Intergenic
966819829 3:183915633-183915655 AGTAAGGGGAGCGGGGCAGTGGG + Intergenic
967147464 3:186618193-186618215 AGTGAGGGCTGGGGGGAGGCAGG + Intronic
967149733 3:186637581-186637603 AGTGAGGAGGGAGAGGCAGGGGG - Intronic
967276889 3:187784690-187784712 AGTGGGAGGTGAGGGGCTGGAGG + Intergenic
967290868 3:187918867-187918889 AGGGAGGAGTGGGGGGCAGTTGG + Intergenic
967437845 3:189471371-189471393 AGTGAGGGGTAAGTGGAAACTGG - Intergenic
967455063 3:189675702-189675724 AGTGGTGGGTGAGGGGGAGCAGG - Intronic
967850232 3:194077016-194077038 TGGGAGGGGTGGGGAGCAGCTGG - Intergenic
968086551 3:195876589-195876611 GGTGGGAGGTGAGGGGCAGGAGG - Intronic
968602844 4:1518486-1518508 GATGAGGGGTGAGGGGTCGCCGG + Intergenic
968649201 4:1753721-1753743 GGTGTGGGGCGAGGGGCACCCGG + Intergenic
968666102 4:1823181-1823203 GGACAGAGGTGAGGGGCAGCAGG - Intronic
968734200 4:2286784-2286806 CGGGAGGGGTGAGGGGCTGGAGG + Intronic
968883378 4:3313454-3313476 GGTGAGGGGAGAGGGAAAGCAGG - Intronic
969091090 4:4694432-4694454 AGTTAGAGCTGAGCGGCAGCAGG - Intergenic
969660882 4:8526753-8526775 AGTGAGGGCAGAGGGGCCCCTGG - Intergenic
970109646 4:12623375-12623397 TGTCAGGGGTGGGGGGCAGTGGG + Intergenic
970223801 4:13836656-13836678 AATGGGGGGTGAGAGGCAGATGG + Intergenic
970813778 4:20128440-20128462 AGTGAGCTGTGATGGGCAACAGG + Intergenic
971653893 4:29316963-29316985 GTTGTGGGGTGAGGGGCAGGGGG - Intergenic
972090039 4:35269995-35270017 GGTGTGGGGTGGGGGGCAGAAGG - Intergenic
972581988 4:40403222-40403244 AGGCAGGGGTGCTGGGCAGCAGG - Intergenic
972726089 4:41747278-41747300 GGTGTGGGGTGAGGGGCGGCTGG - Intronic
972959693 4:44437967-44437989 AGTGAGTGGTGGGAGGTAGCAGG - Intronic
973896081 4:55414599-55414621 ATTGAGGGGTCAGGGGCAAGGGG - Intronic
974684720 4:65212455-65212477 AGGGAGGTGAGAGGGGCTGCAGG + Intergenic
975558077 4:75683800-75683822 AGTTAGGGGTCAGGCCCAGCAGG - Intronic
975781257 4:77842456-77842478 AGGGAGGGGTGAGGACCAGTGGG - Intergenic
976161118 4:82200807-82200829 ACTGAGGGGTGAGCGGCGGCGGG + Intergenic
977462955 4:97348508-97348530 ACTGAGGGGTGAGAGACAGGAGG + Intronic
978118034 4:105045673-105045695 AGTAAGGGGTGAGGAGGAACAGG - Intergenic
978821533 4:112972339-112972361 GTTGAGGGGTGAGGGGCAAAGGG - Intronic
978879527 4:113684942-113684964 AGGGAGAGATGAGGAGCAGCAGG - Intronic
981289409 4:143056770-143056792 GGTGGGGGGTGAGGGGATGCTGG + Intergenic
982114537 4:152086833-152086855 AGAGAGGGGTGAGGGTGATCTGG + Intergenic
982120067 4:152134520-152134542 AGTGGGGGATGAGGGGCTTCTGG + Intergenic
982205619 4:152995417-152995439 GGTGAAGGGAGATGGGCAGCAGG + Intergenic
982517949 4:156375625-156375647 GTTGAGGGGTGAGGGGCAAGAGG + Intergenic
982836984 4:160131280-160131302 TGTTAGTGGTGAGGAGCAGCTGG - Intergenic
984796815 4:183669302-183669324 AGAGAGAAGAGAGGGGCAGCTGG + Intronic
985369224 4:189267553-189267575 TGTGAGGGGGGAGGAGCAGGTGG + Intergenic
985389304 4:189478554-189478576 AGTGAGGGGGCCTGGGCAGCTGG + Intergenic
985402768 4:189608028-189608050 AGTGTGGAGTCAGGTGCAGCAGG - Intergenic
985823680 5:2178046-2178068 GGTCAGGCCTGAGGGGCAGCTGG + Intergenic
986009212 5:3697054-3697076 TGTGTGTGGTGAGGTGCAGCGGG + Intergenic
986028658 5:3874587-3874609 AGTTAGGGGTGAGGGGGAAAGGG + Intergenic
986386296 5:7237485-7237507 AGGGAGGGCTGAGAGGCAGAAGG + Intergenic
986444028 5:7805710-7805732 AGAGTGGGGAGAGAGGCAGCAGG + Intronic
988845122 5:35119873-35119895 AGTGAGGGCTTCGGGGCAGGCGG + Intronic
989181932 5:38587148-38587170 GGGGAGGGGTAAGGGGCAGGAGG - Intronic
989242631 5:39218315-39218337 AGTGATAGGTGAGGGGGAGGAGG - Intronic
989583847 5:43058871-43058893 AGGGTGGGGAGAGGGTCAGCAGG - Intergenic
990277723 5:54215788-54215810 AGTCAGGGGTGGGGGGCTGGGGG + Intronic
990999455 5:61768216-61768238 AGTGATGGCTGAGGGTCAGATGG - Intergenic
991930784 5:71750772-71750794 AGAGAGGGGGGAGGGGGAGGGGG - Intergenic
992743154 5:79793970-79793992 AGGGAAGAGGGAGGGGCAGCTGG + Intronic
994778216 5:104062008-104062030 GGTGAGGGGTGGGGGGAGGCGGG - Intergenic
996127569 5:119744257-119744279 AGTGAGAGGTGATGGACAGGAGG + Intergenic
996373349 5:122775642-122775664 AGTGAGCGCTGAGGGGCCGAGGG + Intronic
997049105 5:130357842-130357864 TGTGAGGTGTGAGGGTCAGCGGG - Intergenic
997239641 5:132296849-132296871 CGTGAGGGGTGAGTAGCTGCTGG + Intronic
997285163 5:132672752-132672774 AGTAAGGGCTCATGGGCAGCAGG - Intergenic
997621325 5:135298165-135298187 GGTGAGGGGTGAGAGGGAGAAGG - Intronic
997964497 5:138346778-138346800 AGAGAGGGGTGGGGGGCTACAGG - Exonic
999095907 5:148978170-148978192 AATGAGGGGTGAGAGGAACCTGG + Intronic
999240529 5:150124887-150124909 AGTGGGGGGAGGGGGGCAGCTGG - Intronic
999360603 5:150982976-150982998 ACTGTGGGGTGGGGGGCGGCGGG + Intergenic
999944061 5:156576069-156576091 ATTGTGGGGTGGGGGGCAGGGGG - Intronic
1000228277 5:159290893-159290915 AGGGAGGGGTTCGGGGCATCAGG - Intergenic
1000731431 5:164838778-164838800 AGGGAGGGGGGAAGGGGAGCGGG - Intergenic
1001328988 5:170749074-170749096 AGGGAGGGAGGAGAGGCAGCTGG - Intergenic
1001928347 5:175655648-175655670 ACTGAGGCGTGAGGTTCAGCAGG - Intergenic
1002107048 5:176884782-176884804 AGGGAGGGGGCAGGGGGAGCAGG + Intronic
1002164931 5:177338275-177338297 ACTGAGGGGAGAGGAGCAGCTGG - Intronic
1002481283 5:179502615-179502637 AGTGAGGGGAGAGCTGCAGGAGG + Intergenic
1002575675 5:180172450-180172472 AATGAGGGCTGAGGGGCAGAGGG + Intronic
1003842365 6:10135094-10135116 ATTGTGGGGTGGGGGGCGGCGGG + Intronic
1004510402 6:16279722-16279744 GGGCAGGCGTGAGGGGCAGCAGG + Intronic
1005511767 6:26518004-26518026 AGTGGGGGGTGCGGGGTTGCGGG + Intergenic
1005711900 6:28511404-28511426 GGTGATGGGGGAGGGGCGGCCGG + Intronic
1006152425 6:31996600-31996622 GGTGAGGGGTGAGGCGCTCCTGG + Exonic
1006361697 6:33590504-33590526 GATGAGGGGGGAGGGGCAGAGGG + Intergenic
1006516197 6:34546999-34547021 AAGGAGGGGTGGGGGGCTGCGGG - Intronic
1006670002 6:35724272-35724294 GGTGAAGGGTGAGGGGCAGCAGG + Intronic
1006736038 6:36273311-36273333 AGTGGGGGATTAGGGGCAGCCGG - Intronic
1006791506 6:36704195-36704217 ACAGAGGAGTGAGGGGCACCGGG - Intronic
1007250371 6:40491010-40491032 ATAGAGGGGTGAGGGGGAGGAGG + Intronic
1007729470 6:43937171-43937193 AGTGAGTGATGACTGGCAGCAGG - Intergenic
1007750583 6:44068448-44068470 AGGGTGGGGTGAGGGGGAGGGGG - Intergenic
1007772168 6:44200854-44200876 AGTGGGGGGTGGGGGGCAGTGGG + Intergenic
1007840449 6:44711903-44711925 ACTAAGGTGAGAGGGGCAGCAGG + Intergenic
1008488824 6:52064266-52064288 AGTCAGGGATGAAGGGCAGTTGG - Intronic
1008517320 6:52330358-52330380 AGTGAAGGGTGAGGGGAGGGTGG + Intergenic
1008778364 6:55069328-55069350 ATGGAGGGTTGAGAGGCAGCTGG - Intergenic
1008806426 6:55434602-55434624 AGTCAGGGATGAGGAGCAGGAGG - Exonic
1009860836 6:69329710-69329732 AGGGAAGTGTGAGGGGCTGCTGG - Intronic
1010240905 6:73614616-73614638 AGAGAGGGGAGAGGGGCTGAAGG + Intronic
1010781221 6:79947621-79947643 AGGGAGGGAGGAGGGGCGGCCGG - Intergenic
1011414761 6:87106572-87106594 AGTGAGTGGTGGAGGGCAGGTGG - Intergenic
1012793544 6:103732349-103732371 GGTGAAGAGTGAGGGGCAGAAGG + Intergenic
1013860340 6:114628157-114628179 ATTGGGGGGTGGGGGGCTGCGGG - Intergenic
1013962000 6:115911940-115911962 AGTGGGTTGTGAGGGGCATCAGG - Intergenic
1014704852 6:124733149-124733171 AGTGAGGGGTGAGGAGAGGAAGG + Intronic
1015658988 6:135552663-135552685 GGTGAGGGGTCAGGGGAAGAAGG - Intergenic
1016341477 6:143066042-143066064 AGTGCGGGCTGAGGACCAGCAGG + Intronic
1016731625 6:147433454-147433476 AGTCAGTGGTGAGGGGCACAGGG - Intergenic
1016857469 6:148685378-148685400 AGTTAGTGCTAAGGGGCAGCTGG - Intergenic
1017052738 6:150408578-150408600 TGTGAGGAGTTTGGGGCAGCAGG + Intergenic
1017279496 6:152608029-152608051 GTTGAGGGGTGAGGGGCAAGGGG + Intronic
1017302540 6:152879205-152879227 AGTGGGGAGTCAGGGGCAGAGGG + Intergenic
1017603111 6:156104932-156104954 GGTGGGGGGTGAGGGGCTGATGG - Intergenic
1017653007 6:156600282-156600304 TGTGAGGGGTAAAGGGCAGTTGG - Intergenic
1018050777 6:160006075-160006097 CGTGAGGGGTGAGGCGCATGGGG - Intronic
1018312805 6:162528076-162528098 CGGGAGGGGTGCGGGGCGGCGGG + Intronic
1018340923 6:162850499-162850521 AGGGAGGGGAGAGGGGCTGAGGG + Intronic
1018669936 6:166169251-166169273 GGCGAGGGGCGAGGGGCAGGGGG - Intergenic
1018698818 6:166411496-166411518 AGTGAGAGGTTCCGGGCAGCAGG - Exonic
1018721006 6:166572703-166572725 AGTGAGGGGTCACAGGCAGGAGG - Intronic
1018781072 6:167066096-167066118 AGGGAGGGGAGAGGGGCTGAAGG + Intergenic
1018857242 6:167683508-167683530 AGTCAGGGCTGAGGGCCAGCGGG - Intergenic
1018948532 6:168363940-168363962 GGTGAGGGGTGAGGGGCAAAGGG - Intergenic
1018978202 6:168581784-168581806 AGGGAGGGGAGGGGGGCTGCAGG - Intronic
1019180754 6:170186252-170186274 AGAGATGGGGGTGGGGCAGCAGG - Intergenic
1019271650 7:152542-152564 AGTGAGGTGAGAGGGGAAACTGG + Intergenic
1019403501 7:869612-869634 AGAGAGGGCGGAGGGGCAGCGGG - Intronic
1019420451 7:948268-948290 AGGGAGGGGTGAGGGGCAGAGGG - Intronic
1019481766 7:1270223-1270245 GCTGAGGGATGAGGGGCCGCTGG - Intergenic
1019498953 7:1354934-1354956 TGTGAGGGGTCAGGGGCACAGGG + Intergenic
1019512332 7:1423964-1423986 AGTGAGGGGGAAGAGGCGGCAGG + Intergenic
1019514189 7:1432610-1432632 ACTTAGTGGAGAGGGGCAGCCGG - Intronic
1019529753 7:1497430-1497452 AGTGTGGGGTGCGGGGTGGCGGG + Intronic
1019664584 7:2245253-2245275 TGTGAGGGTTGAGGGGCGTCTGG - Intronic
1019666040 7:2252756-2252778 GGGCAGGGGTGAGGGGGAGCAGG - Exonic
1019684603 7:2374037-2374059 AGTGAGAAGTGAAGGCCAGCTGG - Intronic
1019775362 7:2909373-2909395 GCTGAGGGGTGAGGGGCAGCGGG - Intronic
1020135648 7:5586533-5586555 AGGGAGGAGTGAGTGGCAGATGG + Intergenic
1020135655 7:5586565-5586587 AGGGAGGAGTGAGTGGCAGGTGG + Intergenic
1020428426 7:8095237-8095259 AGTGGGGGGTGGGGGGCTGGGGG + Intergenic
1021092775 7:16502440-16502462 AGCGAGGGGTGGAGAGCAGCGGG + Intronic
1021597533 7:22333266-22333288 AGTGGGGGGTCAGGGGGAGGAGG + Intronic
1022444418 7:30457977-30457999 AGGGAGGGCAGAGGGGCAGGAGG + Intronic
1022525378 7:31033801-31033823 AGTGAGGGATGGGGGCCAACTGG - Intergenic
1023025022 7:36042343-36042365 GGTGAGGGGTGATGGGCTCCAGG + Intergenic
1023129032 7:36984186-36984208 ACTGAGGAGTGTGGTGCAGCAGG + Intronic
1023461097 7:40398039-40398061 AGTGAGGTGTGGGGGTCAGAGGG + Intronic
1023705201 7:42933455-42933477 AGAGGGGGGAGAGGGGAAGCGGG - Intronic
1023872747 7:44271675-44271697 AGTCAGAGGAGAGGGGCTGCTGG - Intronic
1023931477 7:44708931-44708953 AGTGATAAATGAGGGGCAGCTGG - Exonic
1023957083 7:44895103-44895125 GGCCAGGGGTCAGGGGCAGCTGG - Intergenic
1023968374 7:44975227-44975249 ACTGAGGAGAGAGGGGCAGATGG + Exonic
1023990933 7:45127850-45127872 GGTGTGGGGTGGGGGGCAGGGGG - Intergenic
1024055269 7:45656540-45656562 AGTGGGTAGTGATGGGCAGCTGG + Intronic
1024558898 7:50627469-50627491 TGTGAGGGGTGAGGTGCTGCGGG - Intronic
1025057448 7:55776449-55776471 TGTGGGGTGTGAGGGTCAGCGGG - Intergenic
1025144656 7:56493186-56493208 AGTGAGGGGTGTGTGCCACCTGG + Intergenic
1025627186 7:63232998-63233020 AGGGAGGGCTGGGGGGCAGGTGG - Intergenic
1025654946 7:63510183-63510205 AGGGAGGGCTGGGGGGCAGGTGG + Intergenic
1025764949 7:64435337-64435359 GGGGAGGAGTGAGGGGAAGCAGG - Intergenic
1026486977 7:70830166-70830188 GGGGAGGGGGGAGGTGCAGCTGG - Intergenic
1026495114 7:70895153-70895175 AGTGAGGGGTGAAGATGAGCTGG - Intergenic
1026789811 7:73324360-73324382 AGTGAGGGTGCAGGGGCGGCTGG - Intronic
1027218842 7:76201693-76201715 GGTGAGGGGCGAGGGGAAGGGGG + Intergenic
1027419038 7:78002245-78002267 TGTTAGGGGTGAGGGGAAGCAGG + Intergenic
1029425069 7:100489696-100489718 CATCAGGGGTGGGGGGCAGCTGG + Intronic
1029679189 7:102096261-102096283 AGTCAGGGGTTAGCGGCCGCAGG - Intronic
1029938452 7:104453810-104453832 AGTGAGGGAAGTGGGGCAGGGGG - Intronic
1030327518 7:108236413-108236435 ACGGAGGGGGGAAGGGCAGCTGG - Intronic
1030876013 7:114814361-114814383 AGTGAGGAGTTAGGGGCTGGAGG - Intergenic
1032056490 7:128688776-128688798 AGGGAGGGGGGAGGGGGAGGGGG - Intergenic
1032058047 7:128699254-128699276 GGTGGGGGGGGGGGGGCAGCAGG - Intergenic
1032446792 7:131991072-131991094 AGGGAGGGGTGGTGGGGAGCAGG + Intergenic
1032459544 7:132100382-132100404 GGTTAGAGGTGAGGGGAAGCAGG - Intergenic
1033423691 7:141224600-141224622 AGTAAGGAGAGAGAGGCAGCAGG + Intronic
1034063724 7:148117178-148117200 AATGAGTGGGGAGAGGCAGCTGG + Intronic
1034133114 7:148739193-148739215 AGTGAGGTGTGAGGAGGGGCTGG + Intronic
1034283625 7:149870370-149870392 AGTGTGGGTTGAGGGGCACTGGG - Intergenic
1034458934 7:151187437-151187459 CCAGAGGGGTGAGGGGCATCTGG - Intronic
1034536831 7:151730646-151730668 TATGAGGGGTGAGGAGGAGCAGG + Intronic
1034676949 7:152898716-152898738 AGCCGGGGGTGGGGGGCAGCTGG + Intergenic
1034838025 7:154370382-154370404 GGGGAGGGGGGATGGGCAGCTGG + Intronic
1035026741 7:155831288-155831310 AGTGAGGGAGGCTGGGCAGCCGG + Intergenic
1035050632 7:155996935-155996957 CGTGAGGCGTGAGGAGCAGAGGG + Intergenic
1035243828 7:157549815-157549837 AGTGTGGGATGAGGAGCAGGAGG + Intronic
1035281174 7:157779436-157779458 AGTGTGTGGTGAGGGGCAGCGGG - Intronic
1035373866 7:158395282-158395304 AGTGAGGGGTGAGGGGTGAGGGG + Intronic
1035373869 7:158395289-158395311 GGTGAGGGGTGAGGGGCGAGGGG + Intronic
1035373921 7:158395414-158395436 GGTGAGGGGTGAGGGGCGAGGGG + Intronic
1035520768 8:273798-273820 GGTGAGGGGTGAGGGGTGGGAGG + Intergenic
1035564376 8:631384-631406 AGAGAGGTGTGCGGGGCAGGGGG + Intronic
1035979078 8:4348621-4348643 AGGGAGGGGAGAGGGGGAGAGGG + Intronic
1036555523 8:9856393-9856415 AGTGGGGGGTGGGGGGAAGTGGG - Intergenic
1036818905 8:11923548-11923570 AGTGAGTGCTGAGGGACAGTCGG - Intergenic
1037141086 8:15521374-15521396 GGGAAGGAGTGAGGGGCAGCAGG + Intronic
1037580037 8:20239637-20239659 AGTGGGGGGCAAGGGGCAGAAGG + Intergenic
1038268294 8:26052879-26052901 GTTGAGGGGTGAGGGCCAGAAGG - Intergenic
1038542627 8:28402249-28402271 AGGGAGGGGGGAGGGGTAGATGG + Intronic
1039010576 8:33089023-33089045 AGTGATGGAAGAGGGGCACCTGG + Intergenic
1039150955 8:34504812-34504834 GGTGAGGGGTGAGGGGAGGTGGG + Intergenic
1040897676 8:52385675-52385697 AGCGAGGGCTCTGGGGCAGCAGG - Intronic
1044083017 8:87908269-87908291 AGGGAGGGGAGAGGGGCTGAAGG - Intergenic
1044325497 8:90853174-90853196 TGTGAGGGGTGGAGTGCAGCGGG + Intronic
1044683805 8:94807980-94808002 AGTGAGGGGTGGGGGGAGGTGGG - Intergenic
1045651125 8:104342560-104342582 AGTGTGGGGTGTGGGCCAGTGGG - Intronic
1046071621 8:109262448-109262470 AGTGATGGGTGAGGGGATTCTGG - Intronic
1047704938 8:127488689-127488711 GGTGAGGGGTGTGGGGGAGTTGG + Intergenic
1048292891 8:133193963-133193985 AGTGAGGTCTGAGGTGCAACGGG - Intronic
1048799951 8:138186157-138186179 AGCGAGAGGTGAGGGGCTGCAGG - Intronic
1048925136 8:139264860-139264882 AGGGAGGCGGGAGGGGCAGGAGG - Intergenic
1049023154 8:139971257-139971279 GGTGAGGCTGGAGGGGCAGCAGG - Intronic
1049356794 8:142193039-142193061 AGGGAGGGGGGAGGAGCAGAAGG + Intergenic
1049452637 8:142670197-142670219 AGGGAGGGGAGAGGGGAAACGGG + Intronic
1049492767 8:142913924-142913946 AAGGAGGGTTGAGAGGCAGCTGG - Intronic
1049815174 8:144595866-144595888 AGGGAGGGGTGATGGGAAGATGG - Intronic
1050371323 9:4924294-4924316 AGTGTGGGATGAGGGGCCGCAGG - Intergenic
1051621036 9:19049582-19049604 AGGGAGGGGTCGGGGGCTGCCGG - Exonic
1051698239 9:19791261-19791283 AGTGAAGGGTGAAAGGCAGAAGG + Intergenic
1052607667 9:30725356-30725378 AGTGAGAGGTGAGGGGAAAGTGG + Intergenic
1052807539 9:33025743-33025765 AGGCAGGGGCGAGGGGCTGCGGG + Intronic
1052989615 9:34511497-34511519 AGTGGGGGGTGAAGAGGAGCAGG - Intronic
1053000936 9:34577119-34577141 AGTGATGGGGGCGGGGCTGCAGG - Intronic
1055031323 9:71773556-71773578 GGTGAGGGGTTAGGGCCATCAGG - Intronic
1055032550 9:71785076-71785098 AGTCAGGGGTGGGGGGCAAGGGG + Intronic
1055376038 9:75649007-75649029 AGTGAGGGGTGGAAGGCAGTGGG - Intergenic
1055505332 9:76942339-76942361 AATGACTGGTGAGGAGCAGCAGG - Intergenic
1055987233 9:82063812-82063834 AGTGAGAGGGGAGGGGCAGTGGG + Intergenic
1056489699 9:87093330-87093352 GGGGAGGGGTGGGTGGCAGCAGG + Intergenic
1056617430 9:88180504-88180526 AGCCAGGGGTTCGGGGCAGCAGG - Intergenic
1056714783 9:89020306-89020328 GGTGGAGGGTGAGAGGCAGCAGG + Intronic
1056764390 9:89435983-89436005 ATTTGGGGGTGGGGGGCAGCGGG - Intronic
1057794420 9:98145302-98145324 AGTGGGAAGTGAGGGGAAGCAGG - Intronic
1057914591 9:99046097-99046119 AGTTAGTGGTGGGGGTCAGCAGG + Intronic
1057921032 9:99097070-99097092 AGTTAGGGCTGTGGGCCAGCAGG - Intergenic
1059253105 9:112904878-112904900 TGTGAGGGGTAAGGGACTGCTGG + Intergenic
1059392042 9:114005505-114005527 AGTGAGGGGTCAGGCCCAGCTGG + Intronic
1059722695 9:116976686-116976708 AGTGAAGGGTGAGTGGCAAAGGG - Exonic
1060046962 9:120349092-120349114 GGGGAGGGGAGAGGGGCTGCTGG - Intergenic
1060279349 9:122205561-122205583 AGTAAAGTGTGAGGGGCATCTGG + Intronic
1060283293 9:122228046-122228068 AGAGATGGGTGAGGGGCGGAGGG + Intronic
1060291935 9:122311292-122311314 AGGGAGGGCTGAGGGGGAGAAGG - Intronic
1060301358 9:122376234-122376256 AGGGAGGGGTCAGGGGAAGAAGG - Intronic
1060351594 9:122866363-122866385 AGGGAGGGGGGAGGGGGAGGGGG - Intronic
1060369832 9:123058046-123058068 AGAGAGGGGAGAGGGGGAGAGGG + Intronic
1060726793 9:126011501-126011523 GGTGAGTGGTGACGGGCACCAGG + Intergenic
1060936939 9:127521538-127521560 AGTGGGGGGTGGGGGGAAGGAGG - Intronic
1060949076 9:127589342-127589364 AGAGAGGGGGGAGGGGAGGCGGG + Intergenic
1061012703 9:127964766-127964788 AGAGAGGGGTGAGGTCCAGCAGG + Intronic
1061270281 9:129536432-129536454 AATGAGGGGTGAGAGACAGAAGG + Intergenic
1061274595 9:129562129-129562151 AGGCAGGGGTGAGGGGCAGCTGG + Intergenic
1061348260 9:130043363-130043385 AGGGAGGTGTGAGGGACGGCGGG + Intergenic
1061544831 9:131298613-131298635 ACTGCGGGAAGAGGGGCAGCTGG - Intronic
1061920831 9:133781482-133781504 GGTCAGGGGTGGGGGGCAGCTGG + Intronic
1062059774 9:134488918-134488940 AGTGTGAGATGAGGGGCAGAGGG + Intergenic
1062084316 9:134641108-134641130 AGTGAGGGGTGAGAGCCTGGGGG + Intergenic
1062160455 9:135076761-135076783 AAAGAAGGGTCAGGGGCAGCTGG - Intronic
1062186207 9:135219995-135220017 AGGCCTGGGTGAGGGGCAGCTGG - Intergenic
1062426033 9:136506673-136506695 GGTGGGGCGTGTGGGGCAGCAGG - Intronic
1062446863 9:136598828-136598850 AGTGTGGGCAGCGGGGCAGCTGG + Intergenic
1062540011 9:137037401-137037423 AGTGAGAGGTGAGAGGCAAGGGG + Exonic
1062678866 9:137765634-137765656 AGTGAGGGGAGTGGGGCTGGGGG - Intronic
1185591837 X:1282531-1282553 AATGAGGGGTCATGGCCAGCTGG - Intronic
1185679295 X:1875197-1875219 GCTGAGGGGTGAGGGGAAGGGGG + Intergenic
1186611345 X:11140645-11140667 TGTGAGGGGTGAGGAGGGGCGGG - Intronic
1186785801 X:12955155-12955177 AGGAAGGGGTGAGGGGAAGTAGG - Intergenic
1186899337 X:14036933-14036955 AGTGGGGGGTGATGGGGAGATGG + Intergenic
1189509949 X:41652597-41652619 AGGGAGGGGAGAGGGGCTGAAGG + Intronic
1189516501 X:41718034-41718056 AGAGAGGGGAGAGGGGCTGAAGG + Intronic
1190918897 X:54831347-54831369 GCTGAGGGAGGAGGGGCAGCAGG - Intergenic
1190957909 X:55214481-55214503 AGTGGGGGGTTAGGGGTAGATGG - Intronic
1190985050 X:55492350-55492372 AGTGAGGGGACAGGGGCAGGAGG - Intergenic
1192068261 X:67909866-67909888 AGGGAGAGGTGTGGGGAAGCTGG + Intergenic
1192369562 X:70502045-70502067 TGTGAGGGGTGAGGGGGTGGAGG + Intronic
1192504663 X:71674132-71674154 AGTGAGGGGTGAGGGAGAGGTGG + Intergenic
1192775421 X:74239809-74239831 ATTGATGGGAGAGGGGCAGAGGG - Intergenic
1193004179 X:76597229-76597251 GTTGTGGGGTGAGGGGAAGCTGG - Intergenic
1193163171 X:78252358-78252380 AGTGGGGGGTGGGGAGCAGGGGG - Intergenic
1193321677 X:80130267-80130289 ACTGAGGGGTGGGGGGCTGGGGG - Intergenic
1195911596 X:109893773-109893795 AGTGGGGGGTCAGGGGAAGTTGG - Intergenic
1196032007 X:111101691-111101713 AGGGTGGGGTGAGGGGGAGAGGG - Intronic
1196834660 X:119803034-119803056 AGTGAGGGGTGAATGGCAGGTGG - Intergenic
1196835817 X:119812807-119812829 AGTGAGGGGTGAATGGCAGGTGG - Intergenic
1196837855 X:119829825-119829847 AGTGAGGGGTGAATGGCAGGTGG - Intergenic
1196871352 X:120116091-120116113 AGTGTGGGGTGGGGTGCAGGTGG + Intergenic
1196892638 X:120305905-120305927 AGGGAGGTGGGAGGGGCAGGCGG + Intronic
1197547278 X:127840375-127840397 AGGGAGTGGTGAGGGGAAGTAGG + Intergenic
1199319409 X:146420647-146420669 ATAGAGGGTTGAGGGGCATCAGG - Intergenic
1199544980 X:148998895-148998917 AATGAGGGGTGATGGACAGAGGG - Exonic
1200001225 X:153060771-153060793 AAGGAAGGGTGAGGGACAGCAGG + Intergenic
1200230196 X:154440132-154440154 ACTGATGAGTGAGGGGAAGCTGG + Exonic
1200323823 X:155216814-155216836 GGCGAGGGGCGAGGGGCGGCGGG + Intronic