ID: 1132607252

View in Genome Browser
Species Human (GRCh38)
Location 16:798753-798775
Sequence GGGTTGTTCTTCATCAGGTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132607245_1132607252 -8 Left 1132607245 16:798738-798760 CCCTTTTCCACCCATGGGTTGTT 0: 1
1: 0
2: 1
3: 12
4: 148
Right 1132607252 16:798753-798775 GGGTTGTTCTTCATCAGGTCGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1132607246_1132607252 -9 Left 1132607246 16:798739-798761 CCTTTTCCACCCATGGGTTGTTC 0: 1
1: 0
2: 0
3: 12
4: 134
Right 1132607252 16:798753-798775 GGGTTGTTCTTCATCAGGTCGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1132607241_1132607252 24 Left 1132607241 16:798706-798728 CCGGGTGCGGGGCTCACAGGATG 0: 1
1: 0
2: 3
3: 12
4: 154
Right 1132607252 16:798753-798775 GGGTTGTTCTTCATCAGGTCGGG 0: 1
1: 0
2: 0
3: 4
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132607252 Original CRISPR GGGTTGTTCTTCATCAGGTC GGG Exonic
904746114 1:32712294-32712316 GGGTCGTTCCTCCCCAGGTCGGG + Intergenic
910024957 1:82638802-82638824 GGAATGTTCTTCCTGAGGTCTGG + Intergenic
916693671 1:167215946-167215968 GGCTTGTTTTTCATCAAGGCTGG + Intergenic
918503589 1:185226585-185226607 GGTTTGTAGCTCATCAGGTCAGG + Intronic
1071490675 10:86134474-86134496 TTGTTGTTCTTCTCCAGGTCAGG - Intronic
1074449165 10:113545227-113545249 GTGCTGTTCTTCATAAGGCCAGG - Intergenic
1075256796 10:120931729-120931751 GGGTCATTCTTCATGAGGACAGG + Intergenic
1077523949 11:3053118-3053140 GGGTTGTTGTTCATTTGGTGTGG - Intronic
1081855450 11:46300463-46300485 GGGTTGTGATTCAGCAGGTTGGG - Intronic
1082765238 11:57162586-57162608 GTGTTCTTATTGATCAGGTCTGG + Intergenic
1083813020 11:65116157-65116179 AGGTTGTTCATCCTCAGGGCTGG - Exonic
1089406429 11:118201377-118201399 GGGATGTTCTGCATGAGATCTGG + Intronic
1090250262 11:125246014-125246036 AGGTTCTTCTTCCTGAGGTCTGG - Intronic
1090827996 11:130401436-130401458 GGCTCGTTCTTCTTCAGGTGGGG - Intergenic
1090991253 11:131818907-131818929 TGGTTGTTCTGCATGAGTTCTGG + Intronic
1091911053 12:4230948-4230970 GGGTTGTTGCTCATCTGGGCTGG + Intergenic
1095928520 12:47603487-47603509 GGGTTGTTCCTGATCAGACCTGG - Intergenic
1096324831 12:50650447-50650469 GAGTTGTTGTTCAACAGGTATGG - Intronic
1097577608 12:61414657-61414679 GGGTGATTCATCATCAGGACAGG + Intergenic
1100524907 12:95410109-95410131 GGGTTGGTCTTCATTCTGTCCGG - Intergenic
1104204564 12:126625777-126625799 GGGCTGTTCTCCATCAGGAAGGG + Intergenic
1112509222 13:99994050-99994072 GGGTTGTTTTTAATCAAGTTTGG + Intergenic
1114335448 14:21684708-21684730 GTGTTTTCCTTCATCAGCTCAGG - Intergenic
1114402129 14:22419703-22419725 GGCTAGTGCTTCACCAGGTCAGG - Intergenic
1117215922 14:53551610-53551632 GGGTTGTTCTGCATTATGACTGG + Intergenic
1118894622 14:69935567-69935589 GTGTTTTTCTGGATCAGGTCAGG + Intronic
1120806446 14:88756121-88756143 GGGGTGGTATTCATCAAGTCAGG + Intronic
1125585408 15:40815935-40815957 GGGATGTTCTTCTGCTGGTCTGG - Intronic
1129514994 15:76151959-76151981 AGGTTGTTGTTCAGGAGGTCTGG + Intronic
1130397331 15:83514225-83514247 GAGATGTTCTTCTTTAGGTCTGG - Intronic
1130539656 15:84813048-84813070 CTGTTGTTTTTCATCAGTTCAGG + Intergenic
1132607252 16:798753-798775 GGGTTGTTCTTCATCAGGTCGGG + Exonic
1133404409 16:5511482-5511504 GTGTTGTTCTTCACCATGTTTGG - Intergenic
1135271683 16:21075020-21075042 GGGTTCTGATTCAGCAGGTCTGG - Intronic
1151628571 17:75293955-75293977 GGGTTGGTCATCTTGAGGTCAGG + Intergenic
1161251277 19:3281647-3281669 GGGTGGAGCTTGATCAGGTCAGG - Intronic
1161441825 19:4296256-4296278 TAGTTTTTCCTCATCAGGTCGGG - Intronic
1166333518 19:42091884-42091906 GGGTTGTTGCTCATGAGGGCTGG + Intronic
1167720667 19:51178102-51178124 GGGGTGTCCTCCCTCAGGTCGGG - Intergenic
929386251 2:41410901-41410923 AGGATGTGCTTCATCAGCTCAGG + Intergenic
932488897 2:72105836-72105858 GGGTTCTTGCTCAGCAGGTCTGG + Intergenic
933708541 2:85308815-85308837 GGGTGGATCTTCATCAGTTTGGG + Intronic
935251584 2:101266743-101266765 GGGTTGTTTTCCACAAGGTCAGG - Exonic
937858122 2:126687358-126687380 GTGTTTTTCTTCAGTAGGTCTGG + Intronic
941559742 2:167029882-167029904 GACTTGTTATTCATCAGTTCAGG + Intronic
944333536 2:198501687-198501709 GGGTAGTTATTGATCAGGTCAGG + Intronic
945276906 2:207997335-207997357 AGGGTCTTCTTCATCAGGTAGGG - Intronic
948239158 2:236414657-236414679 GGGATGTTCGTCTTCAGCTCAGG - Intronic
1175025363 20:55896023-55896045 AGGATGTTGTTCATTAGGTCTGG + Intergenic
1176024033 20:62976849-62976871 GGGTTGGTCTTAATCCAGTCTGG - Intergenic
1177478382 21:21653245-21653267 GGGTTGTTCTTTACCAAGGCTGG + Intergenic
1185186693 22:49405184-49405206 GGGCTGTGCTTGATCAGGGCAGG + Intergenic
949959364 3:9299463-9299485 GGGTTGTTCTTCCACTAGTCTGG - Intronic
950122188 3:10489186-10489208 GGGTTGTTTTGAATCAGGTCAGG - Intronic
953417538 3:42731545-42731567 GGGTTCTGATTCAGCAGGTCTGG - Intronic
954633418 3:52058836-52058858 GGGTAGTTCTTCCTCATGCCTGG - Intergenic
956274518 3:67483789-67483811 GGGGTGTTCTCCAGCATGTCAGG - Intronic
966855194 3:184189040-184189062 GGGTGGGTGTTCATCAGGGCAGG - Intronic
968402585 4:311476-311498 GGGTTGTTCTGGAACATGTCTGG + Intergenic
970010345 4:11451922-11451944 GGGTTGTGATTCATCAGATCTGG - Intergenic
973724896 4:53765206-53765228 CAGTTGTTCCTCAGCAGGTCTGG + Intronic
976661532 4:87545290-87545312 AGGTGGTTCGTCTTCAGGTCAGG - Intergenic
980302486 4:131012128-131012150 GGGTTGTTCTTTAGCAGGCAGGG - Intergenic
980455355 4:133033672-133033694 GAGTTGTTCTTGATCTTGTCAGG - Intergenic
980755928 4:137160608-137160630 GGGCTGTACTTCATCTGTTCAGG - Intergenic
982729412 4:158939973-158939995 GGATTGATCTGCATCAGGTTGGG + Intronic
986426801 5:7640033-7640055 TGCTTGTTCTTCCTCAGATCTGG - Intronic
989249400 5:39291538-39291560 TTGTTGTTTTTCACCAGGTCTGG - Intronic
991403917 5:66283320-66283342 TGGTTCTTCTTCATCAGATTAGG + Intergenic
992871137 5:81006769-81006791 GTTTTCTTCTTCAGCAGGTCTGG - Intronic
1000905755 5:166963826-166963848 GGCATGTTCTTCAACAGGCCAGG + Intergenic
1002711714 5:181198916-181198938 GGGTTTTTCTGCATGAGGTCTGG - Intronic
1006850183 6:37092721-37092743 GGGTTAAGCATCATCAGGTCTGG + Intergenic
1007577543 6:42935681-42935703 GGATTGTCCTTCATCCGCTCTGG + Intronic
1009378855 6:63005693-63005715 GGGTTGTTCTTTGTCAGGCAGGG - Intergenic
1011035518 6:82969800-82969822 GGGTTGGTTTTCATCAGAACTGG + Intronic
1019096040 6:169579914-169579936 GGGATTTCCTGCATCAGGTCTGG + Intronic
1025187818 7:56874734-56874756 GGCTTGTTACTCATCAGCTCTGG - Intergenic
1025288518 7:57689552-57689574 GGGTTGCTGTTCACCAGGTGTGG - Intergenic
1025684104 7:63702192-63702214 GGCTTGTTACTCATCAGCTCTGG + Intergenic
1030942299 7:115668301-115668323 GTGTTGTTCTGCATCATGTTAGG + Intergenic
1031306917 7:120139792-120139814 GGGTTGTTCTTACTCTGTTCTGG - Intergenic
1032386745 7:131530441-131530463 TGGGTGTTATTAATCAGGTCAGG + Intronic
1032581027 7:133103665-133103687 AGGTTGTGTTTCATTAGGTCTGG + Intergenic
1033765966 7:144490682-144490704 GGGTAATTCTTCATCAGGATAGG + Intronic
1034912294 7:155006757-155006779 GGGTTACTCTTCATGATGTCAGG - Intergenic
1040514852 8:48126360-48126382 AGGTTGTTCTCCATCAGCCCTGG - Intergenic
1041395906 8:57391005-57391027 GGGTTGTTCTTCTGGAGGGCAGG - Intergenic
1043608566 8:82032996-82033018 GGGTGGTTTTTCATTAGGTGAGG + Intergenic
1050919931 9:11188077-11188099 GGGTAGTTATCCAACAGGTCAGG + Intergenic
1052260112 9:26505203-26505225 GGTTGGTTCTTCTTCAGGTATGG - Intergenic
1055190414 9:73514328-73514350 GGATTTTTATTCATTAGGTCAGG - Intergenic
1055663275 9:78528563-78528585 GGGTTAGTCTTCTTAAGGTCAGG + Intergenic
1056765258 9:89441217-89441239 GGGTTGGTATTCGTAAGGTCTGG - Intronic
1059185189 9:112262429-112262451 TGGAAGTTCTTCATCAGGTAAGG - Exonic
1059717129 9:116923657-116923679 TGGTTGTTCTGCATTAGGGCTGG + Intronic
1060483076 9:124029429-124029451 GGTTTGTTCTTCATGTTGTCAGG - Intronic
1187699243 X:21948992-21949014 GGGTTGTTTTTCCTGGGGTCTGG - Intronic
1189030709 X:37446821-37446843 GGGAGGTTCCTCCTCAGGTCTGG - Intronic
1197517277 X:127449083-127449105 TGGTTGTTCTTCATCCCTTCTGG - Intergenic
1199143659 X:144339432-144339454 GGGTTGCCCTTCATGAGGTTGGG + Intergenic
1199860690 X:151798268-151798290 GGGTGGTTTTTCATGAGATCAGG + Intergenic
1200915989 Y:8571650-8571672 GGGTTGCTCTTCCCCAGGTGGGG + Intergenic