ID: 1132608339

View in Genome Browser
Species Human (GRCh38)
Location 16:802748-802770
Sequence CCTCCTCCTGCCCTTGGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132608339_1132608346 -8 Left 1132608339 16:802748-802770 CCAAGGCCAAGGGCAGGAGGAGG No data
Right 1132608346 16:802763-802785 GGAGGAGGTTGAGGGAAGTGGGG No data
1132608339_1132608353 15 Left 1132608339 16:802748-802770 CCAAGGCCAAGGGCAGGAGGAGG No data
Right 1132608353 16:802786-802808 GCAGGGCCAGGGCAAGCTGAGGG No data
1132608339_1132608349 -2 Left 1132608339 16:802748-802770 CCAAGGCCAAGGGCAGGAGGAGG No data
Right 1132608349 16:802769-802791 GGTTGAGGGAAGTGGGGGCAGGG No data
1132608339_1132608344 -10 Left 1132608339 16:802748-802770 CCAAGGCCAAGGGCAGGAGGAGG No data
Right 1132608344 16:802761-802783 CAGGAGGAGGTTGAGGGAAGTGG No data
1132608339_1132608350 3 Left 1132608339 16:802748-802770 CCAAGGCCAAGGGCAGGAGGAGG No data
Right 1132608350 16:802774-802796 AGGGAAGTGGGGGCAGGGCCAGG No data
1132608339_1132608352 14 Left 1132608339 16:802748-802770 CCAAGGCCAAGGGCAGGAGGAGG No data
Right 1132608352 16:802785-802807 GGCAGGGCCAGGGCAAGCTGAGG No data
1132608339_1132608345 -9 Left 1132608339 16:802748-802770 CCAAGGCCAAGGGCAGGAGGAGG No data
Right 1132608345 16:802762-802784 AGGAGGAGGTTGAGGGAAGTGGG No data
1132608339_1132608356 22 Left 1132608339 16:802748-802770 CCAAGGCCAAGGGCAGGAGGAGG No data
Right 1132608356 16:802793-802815 CAGGGCAAGCTGAGGGTTTTGGG No data
1132608339_1132608351 4 Left 1132608339 16:802748-802770 CCAAGGCCAAGGGCAGGAGGAGG No data
Right 1132608351 16:802775-802797 GGGAAGTGGGGGCAGGGCCAGGG No data
1132608339_1132608355 21 Left 1132608339 16:802748-802770 CCAAGGCCAAGGGCAGGAGGAGG No data
Right 1132608355 16:802792-802814 CCAGGGCAAGCTGAGGGTTTTGG No data
1132608339_1132608348 -3 Left 1132608339 16:802748-802770 CCAAGGCCAAGGGCAGGAGGAGG No data
Right 1132608348 16:802768-802790 AGGTTGAGGGAAGTGGGGGCAGG No data
1132608339_1132608347 -7 Left 1132608339 16:802748-802770 CCAAGGCCAAGGGCAGGAGGAGG No data
Right 1132608347 16:802764-802786 GAGGAGGTTGAGGGAAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132608339 Original CRISPR CCTCCTCCTGCCCTTGGCCT TGG (reversed) Intergenic
No off target data available for this crispr