ID: 1132609393

View in Genome Browser
Species Human (GRCh38)
Location 16:807681-807703
Sequence CCCAGGGCGTGGCGGGCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132609380_1132609393 21 Left 1132609380 16:807637-807659 CCTCTTACAGGTGGGGAAACTGA 0: 1
1: 17
2: 131
3: 564
4: 1643
Right 1132609393 16:807681-807703 CCCAGGGCGTGGCGGGCCCTCGG 0: 1
1: 0
2: 0
3: 13
4: 271
1132609379_1132609393 22 Left 1132609379 16:807636-807658 CCCTCTTACAGGTGGGGAAACTG 0: 1
1: 47
2: 498
3: 2808
4: 8386
Right 1132609393 16:807681-807703 CCCAGGGCGTGGCGGGCCCTCGG 0: 1
1: 0
2: 0
3: 13
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132609393 Original CRISPR CCCAGGGCGTGGCGGGCCCT CGG Intronic
900269074 1:1778085-1778107 CCCAGGGCGAGGCTCGGCCTTGG - Intronic
901796253 1:11681173-11681195 GCCTGGGCGGGGCGGGCGCTAGG - Exonic
902450148 1:16491519-16491541 CCCTGGGCTTGGAGGGCTCTAGG - Intergenic
902502694 1:16921629-16921651 CCCTGGGCTTGGAGGGCTCTAGG + Intronic
903883991 1:26530614-26530636 GGCAGGGCGTGGGGGGACCTTGG + Intronic
904517288 1:31066027-31066049 CCGAGGGCGCGGCGGGCGCGAGG - Intergenic
904606524 1:31700935-31700957 CCCAGGGCGAGGGAGGCCCATGG - Intronic
904664290 1:32108169-32108191 CTCAGGGAGTGTCGGGGCCTGGG + Intronic
905771970 1:40644188-40644210 GCCAGCGCAGGGCGGGCCCTAGG - Intronic
906939781 1:50245899-50245921 CTCAGGGACTGGCAGGCCCTGGG - Intergenic
912557775 1:110528626-110528648 CCCAGGTTGTGGTGGGACCTTGG + Intergenic
912568626 1:110606465-110606487 CCCAGGGCGGGGAGGGGTCTGGG + Intronic
912800866 1:112719080-112719102 CGCAGGGCGGGCCGGGCTCTGGG - Intergenic
922675134 1:227544961-227544983 CTCAGGCCTTGGTGGGCCCTAGG + Intergenic
923698775 1:236281220-236281242 CCCTGCGCCTGGCGGGGCCTCGG + Intronic
1069842429 10:71348171-71348193 CACAGGGCCTGGCAGGCACTGGG - Intronic
1071546728 10:86535446-86535468 CCCCGGGCGTGGCGGCCTCCTGG + Intergenic
1071559237 10:86632411-86632433 CGCAGTGTGCGGCGGGCCCTGGG - Intergenic
1072821305 10:98560453-98560475 CCAAGGGAGTGGCAGGCCATGGG - Intronic
1073509558 10:104034699-104034721 CCCAGGGCCTCGAGGGCCCCCGG - Exonic
1074086178 10:110210156-110210178 CCCCGCGCGGGGCGGGCCCGTGG + Intronic
1074208090 10:111301947-111301969 ACCAGGGAGTGGCAGGGCCTTGG - Intergenic
1074819598 10:117168338-117168360 CCGAGGGCGTGGTGCGCGCTCGG - Intergenic
1075646845 10:124102430-124102452 ACCAGGGTATGGAGGGCCCTTGG - Intergenic
1076715430 10:132361680-132361702 TCCAGGCTGTGGCGGGCCCCAGG + Intronic
1076715437 10:132361697-132361719 CCCAGGCTGTGGCGGGCTCCAGG + Intronic
1076884971 10:133258078-133258100 GTCAGGGCGGGGCTGGCCCTTGG - Intergenic
1076995043 11:293706-293728 CCCAGGTCATGGCGGGGCCCTGG - Exonic
1077008925 11:371442-371464 CCCAGGGCGTGGAACCCCCTGGG - Intronic
1077186726 11:1238800-1238822 GCCAGGGGGTGGCTGGCCCAGGG - Intronic
1077262240 11:1628940-1628962 CCCACTGCGTGGCCGGCCCAGGG - Intergenic
1077437645 11:2550496-2550518 CCCAGGGCGGGCAGTGCCCTTGG - Intronic
1078429767 11:11280134-11280156 CCCCGGGCGGGGGGTGCCCTGGG - Intronic
1081654804 11:44850149-44850171 TCCAGGACTTGGCGGGCCCTGGG - Intronic
1083562186 11:63681727-63681749 CCCAGGGCGGGGCAGGCTCCTGG - Exonic
1083665097 11:64269877-64269899 CCCAGGGCATCGCGGGGGCTCGG + Exonic
1083667648 11:64284588-64284610 CCACGGGCGGGGCGGGGCCTGGG - Exonic
1083992820 11:66257561-66257583 CCTCGGGGCTGGCGGGCCCTGGG + Intronic
1084084592 11:66849196-66849218 CCCACCGCCTGGCTGGCCCTGGG + Intronic
1084156764 11:67317500-67317522 CCCAGGCTGGGGCGGGGCCTCGG + Intergenic
1084943422 11:72626314-72626336 CCCGGGGCGTGCAGGGACCTGGG - Intronic
1086449950 11:86906137-86906159 GCCAGGGCCTGGCGGGGCCGGGG + Intronic
1089273281 11:117315918-117315940 GCCAGGGCCTGCAGGGCCCTGGG + Exonic
1089539189 11:119179823-119179845 TCCTGGGCGTGGAGGGCCCCCGG + Exonic
1090146780 11:124332984-124333006 CGCAGCACATGGCGGGCCCTGGG - Intergenic
1095965333 12:47863645-47863667 GCCAGGGCGTGGCAGGGACTAGG + Intronic
1096585808 12:52618853-52618875 CCCAGGGAGTGGTGGGGCCTGGG + Intergenic
1101504061 12:105330653-105330675 CCCCGGGCGGGGCGGGGCCGGGG + Exonic
1101918710 12:108915844-108915866 CCCACGGCAACGCGGGCCCTCGG - Exonic
1102254117 12:111406225-111406247 CCCATGGCGTCGCGCGCCCCCGG - Exonic
1103026843 12:117580870-117580892 CCAAGGGCGTGGCTGAGCCTGGG + Intronic
1103400529 12:120640531-120640553 CCCAGGGCGGGGCGGGGCAAGGG + Exonic
1103612982 12:122135340-122135362 GCCAGGGTGAGGAGGGCCCTAGG + Exonic
1104047354 12:125172785-125172807 CCCAGGGGCTGGTGGGCACTCGG + Intergenic
1104961501 12:132490370-132490392 CCCAGGCCGCGCCGGGCCCGGGG + Exonic
1107793041 13:44021790-44021812 CCCAAGGCCTGGCAGGGCCTTGG + Intergenic
1108582310 13:51837957-51837979 CCCAGGCCTTGGGGGTCCCTGGG - Intergenic
1111395979 13:87671372-87671394 CCCGGGGCGAAGCGGGCGCTCGG - Intergenic
1111912647 13:94329330-94329352 CCCAGGGTGCGGTGGGCCCTGGG - Intronic
1112326144 13:98443901-98443923 GCCAGGGAGTGGCGGGCACGGGG + Intronic
1114120921 14:19669522-19669544 TCCCGGGCGTGGCGGGGCCGAGG - Intergenic
1118382632 14:65229878-65229900 CCTAGGGCTGGGCGGGCCCACGG - Intergenic
1121866094 14:97364124-97364146 CCCAAGGTGGGGAGGGCCCTAGG + Intergenic
1122582357 14:102778237-102778259 CCCCGGGAGTCGCCGGCCCTCGG - Intronic
1122956192 14:105072665-105072687 CCCAGTGAGTGGCTGTCCCTGGG + Intergenic
1123044146 14:105503253-105503275 CCCAGGGTGCGGTGGGCCCGGGG + Intergenic
1123067527 14:105626114-105626136 CCCAGGGCGCAGAGGCCCCTCGG + Intergenic
1123071544 14:105644838-105644860 CCCAGGGCGCAGAGGCCCCTCGG + Intergenic
1123091208 14:105743119-105743141 CCCAGGGCGCAGAGGCCCCTGGG + Intergenic
1123096975 14:105771454-105771476 CCCAGGGCGCAGAGGCCCCTCGG + Intergenic
1123632765 15:22273386-22273408 CCAAGTGCGCGGCCGGCCCTGGG + Intergenic
1125344558 15:38705888-38705910 CCCAGTGCATGGGGGGCACTGGG + Intergenic
1126137020 15:45402526-45402548 CCCAGGGCGTGGAGGGCGGCCGG - Exonic
1126823774 15:52529321-52529343 CCCGGGGTGTGCCGCGCCCTCGG - Intergenic
1127103357 15:55588619-55588641 CGCGGGGCGGGGCGGCCCCTAGG - Intronic
1127395006 15:58537538-58537560 GCCAGAGCATGGAGGGCCCTGGG - Intronic
1128526768 15:68417630-68417652 CGCAGGGCCTGGTGGGCCCTGGG - Intronic
1129412228 15:75356351-75356373 TCCAGGAGGTGGCGGGCGCTGGG + Exonic
1132055302 15:98647658-98647680 CAGAGGGCGCGGCGGGCGCTGGG - Intergenic
1132163703 15:99565525-99565547 CCCAGGGCGGGGCGGCCCGGCGG - Intronic
1132555507 16:570225-570247 CCCAGGTCGGCGCGGGCCCGGGG - Intronic
1132555932 16:572673-572695 CTAAGGGCGTGGTGGGCACTGGG + Intronic
1132555976 16:572838-572860 CTAAGGGCGTGGTGGGCGCTGGG + Intronic
1132578464 16:674638-674660 CCCAGGGCGTGGCCTTCCCAAGG + Intronic
1132587055 16:710173-710195 CCCAGGGTCTGGCAGGCTCTTGG + Intronic
1132609393 16:807681-807703 CCCAGGGCGTGGCGGGCCCTCGG + Intronic
1132672145 16:1106354-1106376 CCCAGGGGTTGGGGGGCCATGGG - Intergenic
1132711231 16:1268898-1268920 CCCAGGGCGGAGCCGGCTCTGGG + Intergenic
1133125162 16:3641749-3641771 CCCAGGGTGTGGGAGGCCATGGG - Intronic
1133155569 16:3872894-3872916 CCCAGTGGGAGGCAGGCCCTGGG - Intronic
1134363278 16:13552674-13552696 CCCAGGGGGTGGTGGAGCCTGGG + Intergenic
1138142699 16:54582521-54582543 GCCAGGGGGTGGCGGGCCACTGG - Intergenic
1138507503 16:57485717-57485739 TCTAGGGCCTTGCGGGCCCTGGG + Intronic
1139281589 16:65775086-65775108 CCCCAGGTGTGGCGGGCCGTGGG - Intergenic
1140858756 16:79000971-79000993 CCCAGGCGGTGGTAGGCCCTAGG - Intronic
1141086111 16:81096503-81096525 TCCAGGGCCTGGCGCGACCTCGG + Intergenic
1141132581 16:81445630-81445652 CCCAGGGCCTGGGGGGCGGTGGG + Intronic
1141173580 16:81705367-81705389 CCCAGGGCTTGGTGGGCCATGGG + Intronic
1141524955 16:84605125-84605147 CCCAGGCCATGGGGGGCCGTGGG - Intronic
1141564445 16:84891824-84891846 CCCAGGGTGTGGGGGGCTGTCGG + Intronic
1142267736 16:89072261-89072283 CCCAGGTCCTGCTGGGCCCTTGG - Intergenic
1143099762 17:4498752-4498774 CCCTGGGGGTGGGGGGCCCGGGG - Intergenic
1143543510 17:7583105-7583127 CCCAGCACGTGGTGCGCCCTCGG + Intergenic
1144573601 17:16415798-16415820 GCCAGGGCGTGGCGGCTGCTGGG - Exonic
1144742569 17:17592087-17592109 CCCTGGGCGTGTGGGGCCCTGGG - Intergenic
1145291654 17:21551427-21551449 CCGGGCGCGTAGCGGGCCCTGGG + Exonic
1145388413 17:22435601-22435623 CCGGGCGCGTAGCGGGCCCTGGG - Intergenic
1145900395 17:28487172-28487194 CACAGGAAGTGGCAGGCCCTGGG + Intronic
1145963825 17:28902969-28902991 TCCAGGGCGGTGCGGGGCCTGGG - Exonic
1147603948 17:41763452-41763474 CACAGGGTGTGGCGGGTCATAGG - Intronic
1147882874 17:43665321-43665343 CCCTGGACGGGGTGGGCCCTGGG + Intergenic
1148454184 17:47802104-47802126 CCCAGTGTGTGACGGGCTCTGGG + Intergenic
1148735604 17:49863009-49863031 CCCAGGACGTGGCCAGGCCTGGG + Intergenic
1150134822 17:62689873-62689895 CCCTGGGCATGGGGGGCCATGGG - Exonic
1150675742 17:67245028-67245050 CCCCGGGCGCGGCGGCCCCGGGG - Intronic
1151244477 17:72783921-72783943 CCCAGGGCATGGCTGTCCCATGG + Intronic
1151453550 17:74213488-74213510 CCCAGGGAGAGGCGGGGCCGGGG + Intergenic
1151812400 17:76452501-76452523 CCCGGGACCGGGCGGGCCCTGGG - Intronic
1154331172 18:13430030-13430052 CCCAGGCAGTGACGGGCTCTTGG + Intronic
1155053069 18:22165061-22165083 GCCAGGGAGTGCCAGGCCCTAGG - Intergenic
1155238572 18:23845192-23845214 CCCAGGGAGGGGCTGGCCCATGG + Intronic
1155254069 18:23979364-23979386 CCCAGTGAGTGGCAGGCCTTGGG + Intergenic
1157445052 18:47738222-47738244 CCCAAGGTGTGGCTGCCCCTTGG - Intergenic
1159105708 18:64000568-64000590 CACAGGGCATGGCTGGCCCAGGG - Intronic
1160594477 18:79964455-79964477 CCCAGGCCGTCCCGGGGCCTCGG + Intergenic
1160697598 19:492190-492212 CCCAGGGAGAGGCGGGGCCTGGG - Intronic
1160836681 19:1127809-1127831 TCCAGTGCGTGGAGGGGCCTTGG - Intronic
1160953747 19:1680005-1680027 CCCAGCCCGTGTTGGGCCCTTGG - Intergenic
1161161306 19:2763105-2763127 CCCAGGAGGAGGCGGGTCCTGGG + Intronic
1161374712 19:3933513-3933535 CCCCGGGGGAGGCGGCCCCTGGG - Exonic
1161405184 19:4087596-4087618 GCCAGGCCTTGGGGGGCCCTGGG - Intergenic
1161768010 19:6217419-6217441 CCCAGAGTGGGGAGGGCCCTGGG - Intronic
1162398306 19:10430674-10430696 CCCAGGGCGGGGCGGGTCTGGGG - Intronic
1162965003 19:14151377-14151399 CTCAGGCGGTGGAGGGCCCTTGG + Exonic
1163091136 19:15021259-15021281 CTCAGGTGGTGGTGGGCCCTGGG - Intronic
1163578064 19:18122142-18122164 CCCAGGGGGTGGGGGGTCATGGG + Intronic
1163638931 19:18450749-18450771 GCCAGGGGGTCGTGGGCCCTCGG + Exonic
1164556490 19:29256690-29256712 CCCAGGGCCAGGAGGGCACTGGG - Intergenic
1166270251 19:41709129-41709151 CCCAGGCTGTGGAGGGCCCTGGG + Intronic
1166369399 19:42292794-42292816 GGCAGGGGCTGGCGGGCCCTTGG - Exonic
1166411947 19:42561339-42561361 CTCAGGCCATGGAGGGCCCTGGG - Intergenic
1166881856 19:45934820-45934842 CCCAGGGTGGGGCAGACCCTAGG + Exonic
1166930598 19:46299080-46299102 GCCAGGGCCTGGCGGGCTCAGGG - Intronic
1167495838 19:49818355-49818377 CCCGGCGCGGGCCGGGCCCTCGG - Exonic
1168063613 19:53907546-53907568 CCCAGAGAGTGGCAGGCACTGGG - Exonic
1168110080 19:54187270-54187292 GCCAGGGCGTGGCAGGAGCTGGG + Exonic
1168292200 19:55362202-55362224 ACCAGGGCATGGCAGGCCCCAGG - Intronic
925899995 2:8502478-8502500 CCCATGACCTGGCGGGCACTGGG - Intergenic
926135154 2:10331163-10331185 CAGAGGGCGGGGCGGGCTCTGGG + Intronic
928683824 2:33728119-33728141 TCCACGGGGTGGCGGGTCCTGGG - Intergenic
928964951 2:36966746-36966768 GCCGGGGCGGGGCGGGCCCGAGG - Intergenic
929952722 2:46428827-46428849 CCCAGGGTTTGGAGGGCCCCAGG - Intergenic
932731853 2:74227169-74227191 CCCAGGACCCAGCGGGCCCTCGG - Intronic
934563220 2:95323790-95323812 CCCAAGGCCTGCGGGGCCCTAGG - Intronic
935088094 2:99867920-99867942 CCCTGGGCGAGGCGGGCACGTGG + Intronic
935215160 2:100970197-100970219 CCCTGGGGGTAGGGGGCCCTTGG - Intronic
935590674 2:104843739-104843761 CCGCGGACCTGGCGGGCCCTAGG + Intergenic
937097820 2:119247313-119247335 CCAAGGCCGTGGCCTGCCCTGGG - Intronic
937207371 2:120245476-120245498 CTCAGGGCCTGCCGAGCCCTGGG + Intronic
937984808 2:127633633-127633655 CCCAGGACTTGGGGGCCCCTAGG + Intronic
938068272 2:128293296-128293318 CCCAGGCCCAGGCTGGCCCTTGG - Intronic
941111584 2:161423439-161423461 GCCATGGCGTAGCGGGCCCCGGG - Exonic
946407424 2:219499011-219499033 CCGAGGTCCTGGCTGGCCCTCGG + Exonic
946431102 2:219627792-219627814 TCCCGGGCGTGGCTGGGCCTCGG + Intronic
947715841 2:232338459-232338481 CCCAGAGCATGGCGGGTCCCTGG + Intronic
947734865 2:232449205-232449227 CCCAGAGCATGGCGGGTCCCTGG + Intergenic
947875469 2:233464750-233464772 CGCAGGGCATAGCGGACCCTGGG + Intronic
948258400 2:236584809-236584831 CCCAAGGCATGGCGGGCGGTGGG + Intergenic
948654369 2:239467233-239467255 CCTAAGGAGTGGGGGGCCCTAGG + Intergenic
948899622 2:240949751-240949773 CCCGGGGAATGGCAGGCCCTTGG + Intronic
948983784 2:241508244-241508266 GCCCGGGCGTGGCGGGGCCCCGG - Intronic
948992822 2:241563391-241563413 CCCTGGGTGTGGCAGGCGCTGGG + Intronic
949040135 2:241844185-241844207 CCCTGGGTGTGGCCGGGCCTCGG - Intergenic
1171454101 20:25257270-25257292 CCCAGGGCCTGCCGGGCCACAGG - Intronic
1172006690 20:31823014-31823036 CCCATGGCGGGGCGGGACCGGGG - Intronic
1173085202 20:39909458-39909480 CCCAGGGCATGGCGCAGCCTTGG - Intergenic
1173813603 20:45971350-45971372 CCCTGGGCCTGGCCGGCCCGAGG - Exonic
1175440951 20:58990962-58990984 CCGAGAGCCTGGCAGGCCCTGGG - Exonic
1175440952 20:58990962-58990984 CCCAGGGCCTGCCAGGCTCTCGG + Exonic
1175707463 20:61191188-61191210 GCCAGGCCATGGCGGCCCCTGGG - Intergenic
1175783748 20:61699351-61699373 CCCAGTGCAGGGCGGGCACTGGG + Intronic
1176044277 20:63084286-63084308 CCCCGGGCGAGGAGGGCACTGGG - Intergenic
1176110265 20:63407724-63407746 CCCAGGAGGTGGGGGGACCTGGG + Intronic
1176181593 20:63752089-63752111 CCCAGAGCGGGGCGGCCCCAAGG - Intronic
1178210305 21:30523535-30523557 CCCAGGGCTGGGGAGGCCCTAGG + Intergenic
1179902906 21:44403018-44403040 TCCAGGACTTGGCGGGGCCTGGG + Intronic
1180955402 22:19739125-19739147 CACAGGGTGTGGGGGGCCCTGGG + Intergenic
1181256853 22:21568171-21568193 CCCAGGGCGGGGCGGTTCCGCGG - Intronic
1181465972 22:23110840-23110862 CTCAGAGTGTGGTGGGCCCTTGG - Intronic
1181573195 22:23778949-23778971 CCCACATCGTGGAGGGCCCTGGG - Intronic
1182054193 22:27337042-27337064 CCCAGGGCTTGGCTGGCTGTTGG + Intergenic
1183506965 22:38214755-38214777 CCACGAGCGTGGCGGGCCCGCGG - Exonic
1183591450 22:38781439-38781461 CCCAGCTCCTGGAGGGCCCTGGG + Intronic
1184454201 22:44599787-44599809 TCCAGGGCTTGGCCTGCCCTTGG + Intergenic
1184609515 22:45593868-45593890 CCCAGGCCCTGGCAGGCCCATGG - Intronic
1184663369 22:45975742-45975764 CGCAGGGCGCGGCGGGGCCCGGG + Intronic
1184669936 22:46007190-46007212 CCCTGCGCTGGGCGGGCCCTAGG - Intergenic
1185339301 22:50284430-50284452 CACAGGGCATGGCGAGCCCCTGG + Intronic
951728391 3:25783788-25783810 CGCAGGGAGAGGCGGGGCCTGGG + Intronic
954292173 3:49655426-49655448 CACAGGGGGTGGTGGGGCCTGGG + Exonic
955347304 3:58170600-58170622 CGCAGGGGGTGGTGGGCCCATGG - Exonic
962751003 3:138434823-138434845 CCCAGGGCGCTGGGGGCCCCGGG - Exonic
964824662 3:160811936-160811958 CCCAGGGCTTGCCAGGCACTTGG + Intronic
968106686 3:196006487-196006509 CCCATGGCGTGGCTGGGCTTAGG + Intergenic
968305394 3:197647279-197647301 CCCATGGCGTGGCTGGGCTTAGG + Intergenic
968555185 4:1243359-1243381 CCCAGGGAGTGCAGGGCCCCAGG - Intronic
968659401 4:1793041-1793063 CCCAGGGGGCGGCGGGCACGGGG - Intergenic
968671730 4:1855831-1855853 CCCAGGGCGGGGCCGGCTCCCGG - Intronic
968913268 4:3486288-3486310 CCCAGGTCGGGGCGGGTGCTGGG + Intronic
968960358 4:3740146-3740168 CCCAGGTCCTGGAGGGCCCAAGG - Intergenic
969240202 4:5892515-5892537 CCCAGGGCATGGGGCGCCCGAGG - Intronic
970332543 4:15001977-15001999 CCCAGAGCGGGGCTGGCCCGCGG - Intergenic
972923108 4:43968173-43968195 CCCTGGGGGTTGGGGGCCCTTGG - Intergenic
974952920 4:68603751-68603773 CCCAGAGCATGGGGGGCCCTAGG - Intronic
984065556 4:175043721-175043743 CACAGGGCAGGGGGGGCCCTGGG - Intergenic
984945930 4:184968865-184968887 CCCTGGGCAGGGCAGGCCCTGGG + Intergenic
985523707 5:391328-391350 CGCAGGGCGAGGCGGGCGCAGGG + Intronic
985591394 5:767185-767207 TCCAGGGTGTGGAGGACCCTGGG + Intergenic
985624305 5:977133-977155 CCCAGGGCGTGAAGCGGCCTTGG + Intergenic
985655395 5:1129131-1129153 CCCCTGGCCTGGCAGGCCCTAGG - Intergenic
985680413 5:1252991-1253013 CCCATGGCCTGGCTGGGCCTGGG - Intergenic
987532804 5:19143065-19143087 GCGTGGGCTTGGCGGGCCCTGGG - Intergenic
990553699 5:56909572-56909594 CCCGGGCCGGGGCGGGCCCGAGG + Exonic
996517327 5:124386110-124386132 CCCAGGACCTGACGGGTCCTGGG + Intergenic
997470490 5:134114657-134114679 CCGGGGGCGGGGCGGGCACTGGG - Intergenic
998094703 5:139390666-139390688 CCGATGGCATGGAGGGCCCTGGG - Exonic
999325041 5:150638669-150638691 CCCAGAGTGTGTCAGGCCCTGGG + Intronic
1002000626 5:176194652-176194674 CCCAGGGCTTGGTGGACCCGAGG + Intergenic
1002253713 5:177944329-177944351 CCCAGGGCTTGGTGGACCCGAGG - Intergenic
1002339281 5:178504398-178504420 CCCATGGTGGGGCGGACCCTGGG + Intronic
1002368003 5:178728744-178728766 CCCAGGCAGTGGCGGGATCTCGG - Intronic
1002428183 5:179187957-179187979 CCCAGGGGATGGTGAGCCCTGGG + Intronic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1007465687 6:42049586-42049608 CCCAGGGCGTGGGGTGCCCGCGG - Intronic
1007897455 6:45377649-45377671 GCCAGGGCGTGGCCGGCGCGGGG + Intronic
1012717949 6:102701178-102701200 CCCAGGGCCTGGCTCGCCCTTGG - Intergenic
1012717950 6:102701178-102701200 CCAAGGGCGAGCCAGGCCCTGGG + Intergenic
1013599550 6:111691612-111691634 GCCAGGGCAGGGCAGGCCCTCGG + Intronic
1017705337 6:157117558-157117580 CCCAGGGCCTGCATGGCCCTCGG + Intronic
1017719927 6:157236762-157236784 CCGCGGGCCTGGCGGGCCCCGGG - Intergenic
1018956367 6:168413050-168413072 ACGCGGGCGTGGCGGGCTCTGGG + Intergenic
1020234985 7:6348514-6348536 CCGCGGGCGAGGCGGGCGCTCGG + Intronic
1022526123 7:31038477-31038499 CCCAGGCCTTGATGGGCCCTGGG + Intergenic
1022530060 7:31061420-31061442 CCAGGGGCGTGGCAAGCCCTGGG + Intronic
1022955300 7:35374936-35374958 CCCTGGGAGGGGTGGGCCCTCGG - Intergenic
1023868834 7:44252018-44252040 CCCTCCCCGTGGCGGGCCCTGGG - Intronic
1024164821 7:46720439-46720461 CCCAGGGAGGAGCGAGCCCTGGG + Intronic
1024766795 7:52669239-52669261 CCCAGGGCGCGGCTCGCCGTTGG - Intergenic
1027545835 7:79526512-79526534 CCCAGGGTGTGGGGGGCTCAGGG - Intergenic
1030722422 7:112885159-112885181 CACAGGGCAGGGGGGGCCCTGGG + Intronic
1033417825 7:141179778-141179800 CCCAGGGCCAGGCTGACCCTTGG + Intronic
1035553535 8:546331-546353 CCCAAGGCCTGGGGGGACCTGGG + Intergenic
1038105902 8:24433629-24433651 CCTAGGGAGTGGCAGGCCCAGGG - Intergenic
1039436298 8:37561589-37561611 CCCAAGGCTTGGCAAGCCCTGGG + Intergenic
1040487717 8:47889556-47889578 CCCAGGGCCTGGCGTGCCACAGG + Intronic
1042529050 8:69796040-69796062 CACAGGGCAGGGGGGGCCCTGGG + Intronic
1047951492 8:129939441-129939463 CCCGGGGCGTCGCGGGGCCGGGG + Intronic
1049408361 8:142461617-142461639 CCCAGGGCGGGGCAGGTTCTAGG - Intronic
1049446854 8:142635187-142635209 CCCAGGGCTGGGCGGGAGCTGGG - Intergenic
1049639880 8:143710697-143710719 CCCTGGACGTGGCGTGGCCTGGG - Intronic
1049803750 8:144529861-144529883 CCCGGGGCCTGGCAGGCTCTCGG - Exonic
1050061372 9:1713062-1713084 CCCATGGCATGGCTGGGCCTCGG - Intergenic
1053409574 9:37906842-37906864 CCAAGGGGCTGGCTGGCCCTTGG - Intronic
1056329589 9:85510588-85510610 CCCAGGGCATGGCTGGCGCAGGG + Intergenic
1058348966 9:103999329-103999351 CGAAGGGCCTGGAGGGCCCTGGG - Intergenic
1058584705 9:106494578-106494600 CCCAGGCAGTGGCGGGATCTCGG + Intergenic
1060399595 9:123340548-123340570 GGCAGGGAGTGGGGGGCCCTGGG - Intergenic
1060744298 9:126120139-126120161 CCCAGGATGTGTCTGGCCCTTGG - Intergenic
1060941476 9:127545397-127545419 CCCTGGGCCTGGCGGGAGCTGGG - Intronic
1061904917 9:133691853-133691875 CCCAGGGCTCTGCGGGTCCTGGG - Intronic
1062044698 9:134419608-134419630 CCCAGCGCGGGGCAGGGCCTGGG + Intronic
1062082304 9:134630526-134630548 CCCAGGGCCTGGCGGGGGCACGG - Intergenic
1062113718 9:134796556-134796578 CCCAGGGCGTGACCCACCCTTGG - Intronic
1062169256 9:135125652-135125674 CCCAGGGAGAGGAGGGCCCAGGG - Intergenic
1062277204 9:135736664-135736686 CCGAGGGCAAGGCGGGCCCGGGG + Intronic
1062342764 9:136101053-136101075 CCCAAGGGGTGGAGGGCCCAGGG - Intergenic
1062363537 9:136198476-136198498 CCCAGGGCGGGGAGGGTGCTGGG + Intronic
1189250585 X:39598268-39598290 CCCAGGGAGAGGTGGGACCTTGG + Intergenic
1190319627 X:49172420-49172442 GGCAGGGCGTGGCGCGGCCTGGG + Intronic
1190597720 X:52064393-52064415 GCAAGGGCGTGGGGTGCCCTGGG - Intronic
1190611104 X:52189680-52189702 GCAAGGGCGTGGGGTGCCCTGGG + Intronic
1194682008 X:96865601-96865623 CCCAGGGCCTGGCAGGCCCCTGG + Intronic
1195905523 X:109840562-109840584 CCCAGGGCATGGCATCCCCTTGG - Intergenic
1199711198 X:150470767-150470789 CATAGGGCATGGCGGGCCCCAGG - Exonic
1200213641 X:154357865-154357887 CCCAGGGCCTGGCCAGCACTAGG + Intronic