ID: 1132609879

View in Genome Browser
Species Human (GRCh38)
Location 16:810344-810366
Sequence CCCCTCTGGTTCCCTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 243}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132609879 Original CRISPR CCCCTCTGGTTCCCTGAGGA GGG Intronic
900329148 1:2125526-2125548 CACCCCTGCTCCCCTGAGGAGGG + Intronic
902337089 1:15759788-15759810 CTCCTCTGTTTCCCTGGGGTGGG + Intronic
902399739 1:16151348-16151370 CCCCTCTGCTTCCTTGAACAAGG + Intronic
902640848 1:17765190-17765212 CTCCTCTGGGTCCCTGAGTGTGG + Intronic
902672981 1:17987861-17987883 CCCCTCTGGATGCAGGAGGAAGG + Intergenic
903086363 1:20863230-20863252 CCCCTCTGGTCTCTTTAGGAAGG - Intronic
903255104 1:22092089-22092111 CCCATCTGGTGCTCTTAGGAAGG + Exonic
903812026 1:26039899-26039921 CCCTTGGGGGTCCCTGAGGACGG + Exonic
904489254 1:30848079-30848101 CCCAGCTGGAGCCCTGAGGAAGG + Intergenic
905104968 1:35558725-35558747 TCCCTCTGTGTCCCTGTGGAGGG + Intronic
906285063 1:44581735-44581757 CCAGTCAGGTTCCCAGAGGAAGG - Intronic
906515071 1:46433983-46434005 ACCCTCTAGTTCCCTTAGGCAGG - Intergenic
906571475 1:46845429-46845451 CCCCTCTACTTCCCAGGGGATGG + Intergenic
906826565 1:48987864-48987886 CCACACTGGATCCCTGAGGATGG - Intronic
906957429 1:50386777-50386799 CCAATCTGGTTCCCTGGTGAGGG + Intergenic
907329802 1:53663526-53663548 CCCCTCTGGATTCTAGAGGAGGG - Intronic
910324870 1:85995563-85995585 CCCCCATGGTACCCTGAGGAGGG + Intronic
912513315 1:110202660-110202682 CCCCTGTCCTTCCCTGAGGTGGG - Intergenic
912746520 1:112249814-112249836 CCCCTCTTTTGGCCTGAGGAAGG - Intergenic
913061915 1:115216458-115216480 CCCATCTGGTTCAGGGAGGAGGG - Intergenic
913660649 1:121003626-121003648 CTCCTCTGGGTCACTGGGGAGGG + Intergenic
916173506 1:162019685-162019707 CCTCTCTGGCTCCATAAGGAGGG + Intronic
916535759 1:165701671-165701693 CTCCTCTGGTTGTCTGGGGAAGG - Intergenic
916770048 1:167899129-167899151 CCCTTCTGGTTCCTTAAGCAAGG + Intronic
917059223 1:171018162-171018184 CCCCTCGAGATCCCAGAGGAAGG + Intronic
917906495 1:179591355-179591377 CAACTCTGGCTCCCTGATGAAGG - Intergenic
919865679 1:201781218-201781240 CCACCCTGGTTCCCTGAAGAAGG + Exonic
920052695 1:203173220-203173242 GCTCCCTGGTTCCCTGGGGAAGG + Intronic
920431356 1:205921244-205921266 CCACCCAGGTTCTCTGAGGAGGG - Intronic
922874445 1:228928924-228928946 CCCAGCTGGTGCCCTGAGGAAGG + Intergenic
924566865 1:245206070-245206092 CCCGCCTGGTTCTCTGAGGATGG - Intronic
1063636649 10:7788478-7788500 CCCGCCCGGTTCCCTGAGGTCGG + Intronic
1064205214 10:13317614-13317636 GCCCACTGGTTCCTGGAGGAGGG + Exonic
1067044033 10:42974589-42974611 TCCCCCTGGGTCCCTGGGGAAGG + Intergenic
1068030294 10:51698067-51698089 CCTGTCTGGGTCCCTGAGGAGGG + Exonic
1071473878 10:86008150-86008172 CCCCTCTGGTCTCCAGGGGAGGG - Intronic
1074537745 10:114340826-114340848 ACCCTCTGGTCCCAAGAGGAAGG + Intronic
1075346963 10:121689637-121689659 CCCTTCTGGATTGCTGAGGAAGG + Intergenic
1076674249 10:132140149-132140171 TCCCTGCGGTTCCCTGAGGGTGG - Intronic
1076722621 10:132399300-132399322 ACCCACAGGTTCCCTGAGGTGGG - Intronic
1076871107 10:133195575-133195597 CCCCTCAGGGTGCCTGAGGTGGG + Intronic
1083547027 11:63556515-63556537 CCCCTCTGTTGAGCTGAGGAGGG - Intronic
1084476287 11:69391510-69391532 CCCCTCTGGCTCCCTCAGTAGGG - Intergenic
1084724232 11:70930216-70930238 GCCTTCTGCTTCCCTGTGGAAGG + Intronic
1084956898 11:72696453-72696475 CCCAGCTGGCTCCCAGAGGAGGG + Intronic
1085365973 11:75945239-75945261 CCCCTCTGTATTTCTGAGGAAGG + Intronic
1089129598 11:116201260-116201282 CACCTCTTTTTCTCTGAGGAAGG + Intergenic
1089195017 11:116689231-116689253 CCCCTCTGCTTGGCTGTGGATGG - Intergenic
1089305113 11:117521691-117521713 TCCCTCTGGCTCACTGAGGAGGG + Intronic
1089331581 11:117692690-117692712 CCCCTCTGCTTCCCTGACCAAGG + Intronic
1089524492 11:119088050-119088072 CTTCTCTGGATCCCTGAGGAGGG + Intronic
1089768213 11:120783974-120783996 CCCCTCAGCCTCCCTGAGGCTGG - Intronic
1091994534 12:4982813-4982835 ACTCTCTGGGTCCCTGAGGATGG + Intergenic
1092396826 12:8134479-8134501 CCCCTCTGGTGCCGTGAAGCTGG - Intronic
1095849051 12:46780446-46780468 CCCCTCTGGTTTTCTGCAGATGG + Intronic
1103344851 12:120242390-120242412 CCCCTCTTTTTCCTGGAGGACGG - Intronic
1104244351 12:127023224-127023246 CCCCTCTGATTCAATCAGGATGG - Intergenic
1104531359 12:129573926-129573948 TTCCTCTGGTTACCTAAGGATGG + Intronic
1105629107 13:22143595-22143617 CTTCTCTGTATCCCTGAGGAAGG - Intergenic
1105927676 13:25021890-25021912 CTCGTCCGGCTCCCTGAGGAGGG + Intergenic
1106719764 13:32426422-32426444 CCTCTCTGGCTCGCTGGGGAGGG - Intronic
1110311695 13:74057354-74057376 TCCCTCTCGGTCCCTGGGGATGG - Intronic
1114670403 14:24408009-24408031 CCCCCCTGGCTCCCTGATGGTGG + Exonic
1115909184 14:38236495-38236517 TCCCTGAGGTTCCCTGATGAGGG + Intergenic
1118224626 14:63887453-63887475 CCTCTGTGGGTCCCTGGGGAAGG + Intronic
1118906039 14:70023969-70023991 TCCATCTGGTTGACTGAGGATGG - Intronic
1119740262 14:77009458-77009480 CCCCTCTGGAGGCCTGAGCAGGG - Intergenic
1121014417 14:90539584-90539606 CCTCTCTGGCTCACTGAGGCAGG - Exonic
1121685382 14:95831631-95831653 CCCCACTGGCTCCCTGGAGAGGG + Intergenic
1122854329 14:104552924-104552946 TCCCGCTGGTTCCCAGAGGGAGG - Intronic
1123538317 15:21261546-21261568 CTACTCGGGCTCCCTGAGGAGGG - Intergenic
1123931709 15:25175166-25175188 GCACTCTGGTTCCCTGGGGTGGG + Intergenic
1123936768 15:25197828-25197850 GCACTCTGGTTCCCTGTGGTAGG + Intergenic
1126783715 15:52159817-52159839 CCCCTCTGGCTCCCTGACCCTGG - Intronic
1128052724 15:64677892-64677914 CCCATCTTGTTCCCTGTGGGTGG + Intronic
1128178480 15:65579086-65579108 CCGGTCAGGTTTCCTGAGGAAGG + Intronic
1128313622 15:66646697-66646719 TCCCGCTGGCTCCCTGAGGAAGG + Intronic
1129239928 15:74245153-74245175 CCTCTGGGGCTCCCTGAGGACGG + Intronic
1129869778 15:78932873-78932895 CCCTACTGGTTCCCTGCAGAAGG + Intronic
1130894604 15:88160320-88160342 TACCCCTGGTTGCCTGAGGATGG + Intronic
1130976136 15:88776660-88776682 ACTCTCAGGCTCCCTGAGGAAGG + Intergenic
1132352843 15:101150595-101150617 CTCCTCTGCTCCCCTGAGGAAGG - Intergenic
1132609879 16:810344-810366 CCCCTCTGGTTCCCTGAGGAGGG + Intronic
1132616254 16:842422-842444 CCCTTCTGGTTCCCGGCGGCTGG + Intergenic
1132896633 16:2232405-2232427 CCCCTCCTGTTCCCCCAGGAGGG + Intronic
1133975304 16:10596163-10596185 CACCCCTGGTTCCCTGGGGCTGG + Intergenic
1134138653 16:11697677-11697699 CTCCTCTGCTGTCCTGAGGATGG + Intronic
1136640824 16:31563754-31563776 CCCCTCTGTCTCCCTAAGCAAGG + Intergenic
1136664141 16:31793560-31793582 CCCCTCTGTCTCCCTAAGCAAGG - Intronic
1136923467 16:34350618-34350640 CCTTTCTGGGTCCCGGAGGAAGG - Intergenic
1136981106 16:35061188-35061210 CCTTTCTGGGTCCCGGAGGAAGG + Intergenic
1137528679 16:49261872-49261894 CCCCTCTGGTCACCTAATGAAGG - Intergenic
1137668729 16:50266867-50266889 CGCCTCTGGTCCCCTGTTGAAGG - Intronic
1139601500 16:67990195-67990217 ACCCTCTGGATCCCTGGAGAGGG + Intronic
1140397218 16:74637957-74637979 CCCCTCTAGTTCCCTACTGAAGG - Exonic
1141638678 16:85328979-85329001 CCCCTCTTGGGCCCTGATGAAGG - Intergenic
1141948656 16:87326743-87326765 CTCCTCTGGGTCCCTGGGTAGGG + Intronic
1142494582 17:299539-299561 CCCGTCTTGTTCCCTGTGGGAGG - Intronic
1142851449 17:2706730-2706752 CCCCACAGGGTCCCTGAGAAAGG + Intronic
1142933532 17:3308727-3308749 ACCCTCTGGAGACCTGAGGACGG + Intergenic
1142994437 17:3752230-3752252 CCCCTCTAGTTCCATGGGCAGGG + Intronic
1143549630 17:7622193-7622215 CCACTCTGTTTCCCTTAGAATGG + Intronic
1143871371 17:9959316-9959338 CCATTCAGGTTCCCTGAGGGTGG + Intronic
1144060463 17:11579663-11579685 CCCACCTACTTCCCTGAGGAGGG + Intergenic
1144149403 17:12428798-12428820 GTCCTCTGGTCCCCTGTGGAAGG - Intergenic
1144699312 17:17326499-17326521 TCCCTTTGATTCCCTGAGCAAGG - Intronic
1145403768 17:22568972-22568994 CTACTCAGGCTCCCTGAGGAGGG - Intergenic
1146676402 17:34776378-34776400 TCCATCTGGGTCCCTGAGTAAGG + Intergenic
1146939873 17:36836954-36836976 TCTCTGTGGTGCCCTGAGGAAGG + Intergenic
1147120233 17:38331277-38331299 CCCCTCGGGTTCCTGGAGGCTGG + Exonic
1147392836 17:40121323-40121345 GACCTCTGGTTCCCAGAGGGAGG - Intergenic
1148896765 17:50843429-50843451 CACGTCTGCTTCCCTGATGAAGG + Intergenic
1149663992 17:58352950-58352972 CCCTTCTGCTTCCCCGAGAAAGG - Intronic
1151258506 17:72898423-72898445 CCCAGCTGGTCCCCAGAGGAGGG + Intronic
1151819485 17:76489958-76489980 CCTCTCTGGCTCCCTGAGAGGGG - Intronic
1152206414 17:78976877-78976899 CCCCTCTGGTTCCCTCTGGACGG + Intronic
1152239095 17:79152296-79152318 CCTCTCAGCTTCACTGAGGATGG - Intronic
1152298387 17:79481587-79481609 CCTCTCTGCTCCCCTGAGGTGGG - Intronic
1152694074 17:81735056-81735078 CCCCTTTTGTGCCCTGAGGGCGG - Intergenic
1152816622 17:82411955-82411977 CCCCTCTGGTGGCCTCAGGAGGG - Intronic
1154949717 18:21197471-21197493 CCCCTGTGGTAAACTGAGGATGG - Intergenic
1158344965 18:56506998-56507020 CCCCTCTTGTTACCAGTGGAAGG - Intergenic
1158403073 18:57138802-57138824 CTGCTCTGGTGCCCTGAGGAAGG + Intergenic
1159954258 18:74508148-74508170 CTCCTCTGGTTCCATGAGGCCGG + Intronic
1162141590 19:8588688-8588710 CTCCTCTGGCTCACAGAGGATGG + Intronic
1163129951 19:15266089-15266111 CCCCTGTGGTTCCAGGAGGTGGG - Intronic
1164553644 19:29233210-29233232 ACCCTCAGGTTGCCTAAGGAGGG - Intergenic
1165345085 19:35240989-35241011 CCCCTTTTGTTCCCTTTGGAAGG + Intergenic
1165861396 19:38911341-38911363 CCCTTGTGGTTCCCTGCAGAGGG - Intronic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
1168629394 19:57945340-57945362 CTCCACTGGTCCCCAGAGGAGGG + Intronic
925170036 2:1744599-1744621 CCCCTCTGAATCCCCGAGGGCGG + Intronic
925218447 2:2117389-2117411 ACCCTCAGGATCCCTGAGGGTGG - Intronic
925229591 2:2221216-2221238 GCCTTCTTGCTCCCTGAGGAGGG + Intronic
926120852 2:10240573-10240595 GCCCTCTGCTTCCCTGAGGTAGG - Intergenic
926197175 2:10771117-10771139 CCACGCAGGCTCCCTGAGGAGGG + Intronic
926289267 2:11515731-11515753 CACCTCCTGTTCCCGGAGGAGGG - Intergenic
927156264 2:20223532-20223554 CCCCTCTGCATCCCTGGGGATGG + Intronic
927745755 2:25619000-25619022 CCCCACCTGTTCCCTGTGGATGG + Intronic
927916205 2:26938342-26938364 GCCCTCTGGATACCTGAGCAGGG - Intronic
927945065 2:27130674-27130696 CCCCTCTGGGTCCTGGAAGATGG - Exonic
931630693 2:64295931-64295953 CCACTCTGCTACCCTGAAGATGG + Intergenic
932075559 2:68659565-68659587 CTCCTCTGATTTCCTGGGGAGGG - Intergenic
932216055 2:69966488-69966510 CCCCTCTGCTTAACTGAGGTTGG + Intergenic
932428631 2:71659874-71659896 CCCCTCTTGTCTCCTGAGGCAGG + Intronic
932436443 2:71704923-71704945 CCCCTCCTGGTCCCTGAGGGAGG - Intergenic
932986653 2:76733867-76733889 CCCCTGTTGATCTCTGAGGAGGG - Intergenic
933198528 2:79421088-79421110 CCCCTCCACTTCCCTAAGGAGGG + Intronic
933268099 2:80203701-80203723 CCACTCTGGTTTCTGGAGGATGG + Intronic
934846690 2:97665503-97665525 CCCCTCTTGCTTTCTGAGGATGG - Intergenic
935180834 2:100690004-100690026 TCTCTCTGTTTCCCTGTGGATGG + Intergenic
937262690 2:120596515-120596537 CCACACTGCTGCCCTGAGGAGGG - Intergenic
938481832 2:131669485-131669507 CCCCCCCGGGTCTCTGAGGAGGG + Intergenic
942045584 2:172097471-172097493 CCCCGCTGGTTTCGGGAGGAGGG + Intergenic
945003655 2:205378385-205378407 CACCTCTGTTTCCCTTAGGGAGG - Intronic
945046908 2:205789649-205789671 CCCCTCTGCCTCCCAGAGGCCGG + Intronic
946323030 2:218964637-218964659 CCCATCTGGTTGCCTGGGGTAGG - Intergenic
946411481 2:219517325-219517347 GCCCTCTGGTACCCTGGGGCTGG + Intronic
947705327 2:232270183-232270205 CCCCTCTTCTTCCTTTAGGAAGG + Intronic
948405860 2:237718409-237718431 CCCCTCTGCCTTCCTGTGGATGG + Intronic
948466093 2:238152240-238152262 CCCCTCTGGTCCCCAGGGGCGGG - Exonic
948790522 2:240374331-240374353 CTTCTCTGGTCCCTTGAGGAGGG - Intergenic
1168752085 20:289998-290020 CTGCTCTGGTTTCCTGAGGGTGG - Intronic
1169888789 20:10431816-10431838 CCCCTTTGGTCCACAGAGGATGG + Intronic
1171184365 20:23114320-23114342 CCTCTCTGGTTCCTGGAGCAAGG + Intergenic
1172130080 20:32649780-32649802 CCCTTCTGTTTCCCTGAAGAAGG - Intergenic
1173115926 20:40242823-40242845 GCCCTAAGGTTCCCTTAGGATGG - Intergenic
1174449588 20:50611010-50611032 CCCCTCACCATCCCTGAGGAAGG + Intronic
1175132006 20:56796369-56796391 CCCCTCTGACTCCCAGGGGAAGG + Intergenic
1175155347 20:56967644-56967666 AGCCTCTGCTTCCCTGAAGATGG + Intergenic
1175667418 20:60872113-60872135 CCCACCAGGTGCCCTGAGGAGGG - Intergenic
1175769521 20:61614799-61614821 CTCTTCAGGCTCCCTGAGGATGG + Intronic
1176205494 20:63885925-63885947 CCCCTGGGGCTCCCCGAGGAGGG + Intronic
1176218375 20:63958696-63958718 CCCCTTTGTGGCCCTGAGGACGG - Exonic
1176410884 21:6448851-6448873 ACCCTCTGCTGCCCTGAGGGTGG - Intergenic
1179065769 21:38023721-38023743 CCCCTCTGGGTGGTTGAGGAAGG - Intronic
1179148204 21:38787583-38787605 CCCCTCTGGGCCCCTGGGGGAGG + Intergenic
1179686377 21:43057173-43057195 ACCCTCTGCTGCCCTGAGGGTGG - Intronic
1179886045 21:44314646-44314668 GCCCTCTGGTTCCCTTGGGGTGG + Intronic
1180045346 21:45302618-45302640 CCCCTCAGCTTCCGTGTGGAGGG + Intergenic
1180995062 22:19961487-19961509 GTCCTCTGGTGCCCTGAGGCTGG + Intronic
1181466140 22:23111733-23111755 CCCTGCTGGCTCCCTGAGGAAGG - Intronic
1181742308 22:24931097-24931119 CCCCTCAGCATCACTGAGGATGG + Intergenic
1183191942 22:36327231-36327253 TCCCACTGGCTCCTTGAGGAAGG + Intronic
1183250953 22:36730066-36730088 CCTCTCTGGTACCCTAAGCATGG + Intergenic
1183316219 22:37138469-37138491 CCCCACTGCTTCCCTGGAGATGG + Intronic
1183333966 22:37236271-37236293 TCCCTCTGGTCCTCTGGGGAGGG - Intronic
1183587480 22:38761196-38761218 TGCCTCTGTTTCCCTGGGGACGG + Intronic
1184062056 22:42089226-42089248 CCTCTCTGGTTGCAGGAGGAAGG - Intronic
1184741529 22:46431508-46431530 GCCCTATGCTTCCCTGACGATGG + Intronic
1185230328 22:49677002-49677024 CCCCTCTGCCCACCTGAGGAGGG - Intergenic
1185262944 22:49880296-49880318 CCCCTTTGGTTCTCTGAGGGTGG + Intronic
1185267141 22:49910308-49910330 CCCCACTGGGTTCCTCAGGATGG - Intronic
950416207 3:12870209-12870231 CCTCTTTGGTTCCATGGGGAAGG - Intronic
952554877 3:34520731-34520753 CCCCTCTCCTTCCCTTTGGATGG + Intergenic
952604260 3:35125176-35125198 CCCCTCTTCTTCCATGGGGATGG - Intergenic
952722700 3:36549659-36549681 ACCTTCTGGAGCCCTGAGGAAGG - Intergenic
952732067 3:36649164-36649186 CCCATCTGGTCCCCTGTGTAAGG + Intergenic
952990043 3:38823922-38823944 CCCCTGTGGGCCCCTGAGGTGGG + Intergenic
953752284 3:45618034-45618056 CCCTTCTGGTTCCGTGTGGTGGG + Intronic
954539029 3:51381640-51381662 CCTCTCTGGCTCCCTGGGGTGGG - Exonic
954699498 3:52443875-52443897 CCCCTCTGGTTTCCTCAGGAAGG + Intronic
955772933 3:62404742-62404764 CCCCTCCTGCTCCCTGGGGAGGG - Intronic
955927334 3:64021000-64021022 CCCCTCTGGTGCCCTGATGGTGG + Intronic
956650249 3:71498339-71498361 CAGCTGTGGTTCCCTGAGGCCGG + Intronic
957736493 3:84210619-84210641 CTCCTCTAGGTCCCTGAGAAAGG + Intergenic
961166308 3:124766221-124766243 CCTACCTGGCTCCCTGAGGACGG + Exonic
962658941 3:137581127-137581149 CCCCTGTTATTCCCTGAGCAAGG + Intergenic
963007638 3:140740854-140740876 CGCCTCTGCTTCCCTGAGAGGGG - Intergenic
967172104 3:186829824-186829846 GCACTCTCCTTCCCTGAGGACGG + Intergenic
967438344 3:189477560-189477582 ACCCTCTCTTTCCCTGAGAAAGG - Intergenic
969400526 4:6952437-6952459 CCCCTCTGGTCCCCTGGGCCAGG + Intronic
969633194 4:8350518-8350540 CCCCTCTGTTCCCCTGACCAGGG - Intergenic
971038768 4:22726787-22726809 CCCATCTGGTGCTCTTAGGAAGG - Intergenic
972640833 4:40923589-40923611 CCGCTCTGGTGCCATCAGGATGG + Intronic
976491592 4:85676966-85676988 CCCTTCTGGTAGCCTCAGGAAGG - Intronic
980746616 4:137025824-137025846 CGTCTCAGGTTCCCTCAGGAGGG - Intergenic
981315808 4:143338034-143338056 CCACTCTGGTTCCCTGGGAAAGG - Intronic
984554104 4:181193538-181193560 TGCCTCTGGTTCCCTGTAGATGG - Intergenic
984940009 4:184922679-184922701 CCACTCTGCTTCCCTGGGTAAGG - Intergenic
985517249 5:353393-353415 CCACTACGGATCCCTGAGGAGGG - Intronic
985775807 5:1841167-1841189 CCCCTCCTGTCCCCTGAGGAGGG - Intergenic
985789202 5:1916233-1916255 TCCTTCTGGTTCCCGGAGCAGGG - Intergenic
987055101 5:14183728-14183750 CCCCTCCCGTTTGCTGAGGAGGG + Intronic
993940694 5:94054673-94054695 CTCCTCTTTTTCCCTGAGGGTGG - Intronic
995024471 5:107403158-107403180 TCCTTCTGCTTCCCTGTGGATGG - Intronic
997264669 5:132488198-132488220 CCACTCTGGATCTCTCAGGAGGG + Intronic
997654543 5:135545411-135545433 CCCCTGTGGCTGCCTGGGGATGG + Intergenic
998093441 5:139383897-139383919 CCCCTCAGGGTCCCTGAGGCAGG + Intronic
998452377 5:142244928-142244950 CTCCACTGGTACCCTGAGAATGG + Intergenic
999206147 5:149849524-149849546 CCACTCAGGTTCCCTGAGCCTGG + Exonic
1000171849 5:158709861-158709883 TCCTGCTGGTTCACTGAGGAAGG + Intronic
1000254516 5:159525256-159525278 CCCCTGGGGCTGCCTGAGGATGG + Intergenic
1000959814 5:167586499-167586521 AATCTTTGGTTCCCTGAGGATGG + Intronic
1001620875 5:173084162-173084184 CCCATCTGGTGCTCTCAGGAAGG - Intronic
1002857967 6:1055110-1055132 CCCCTTTGATTCCATGTGGAGGG + Intergenic
1004816519 6:19317047-19317069 CCCCTGTGGTTGCGTGAGGGTGG + Intergenic
1007210797 6:40192080-40192102 ACACTGGGGTTCCCTGAGGATGG - Intergenic
1007324778 6:41051622-41051644 TCCTTCTGCTTCCCTGAGAATGG + Intronic
1008042881 6:46820500-46820522 CCCATCTGCCTCCCTGAGGCAGG - Intronic
1009609401 6:65920909-65920931 CCAGTTTGGCTCCCTGAGGATGG + Intergenic
1016839301 6:148509949-148509971 CCCGTCTGGCACCCGGAGGAGGG - Intronic
1016881962 6:148920432-148920454 CTCTTCTGATGCCCTGAGGATGG + Intronic
1019520556 7:1458889-1458911 CCCCTCTGTGTCCCTGGGAAAGG - Intronic
1019558734 7:1645457-1645479 CCCCTCTGGTTCCCTGTGCTAGG - Intergenic
1019618113 7:1975765-1975787 CACCTCTCGTCCCCTGAGGCAGG + Intronic
1019702493 7:2480693-2480715 CCTCTCTGCCTCCCTCAGGACGG + Intergenic
1019996901 7:4730440-4730462 CAGCTCTGGTTCCTGGAGGAGGG + Intronic
1021420101 7:20437332-20437354 CCGCTCTCCTTCCCAGAGGATGG - Intergenic
1022950111 7:35330557-35330579 TCCACCTGGTTCCCTGAGGCTGG + Intergenic
1023654603 7:42406998-42407020 CCCCCCGGGTGCCCTGAGGTGGG + Intergenic
1025040320 7:55637722-55637744 CCCATCTGGTGCTCTTAGGAAGG - Intergenic
1026808289 7:73441834-73441856 CCCCTCTGGTCTCCAGGGGAGGG - Intronic
1031923873 7:127620237-127620259 GCCCTCTGGTCCCTTGAGGAAGG - Intergenic
1033241379 7:139682534-139682556 CTCCTCTGGGTCCCTGTGGTGGG + Intronic
1035285970 7:157807464-157807486 CTCCTCTGGTCCCAGGAGGATGG + Intronic
1036794078 8:11742913-11742935 CCCCTTTGGTTCCCAGGGAACGG + Intronic
1037733855 8:21551104-21551126 CCCCTGTGGCTTCCTGCGGAGGG - Intergenic
1038482376 8:27910505-27910527 GGCCTCTGGTGCCCTCAGGAGGG - Intronic
1040294181 8:46140766-46140788 CCCCTCTGAGTCCCTGTGGCCGG + Intergenic
1048193053 8:132307971-132307993 ATCCTCTGGTCCCCGGAGGATGG + Intronic
1049343210 8:142124816-142124838 CCCCTGGGGTCCCCTGAGGCTGG + Intergenic
1049476958 8:142801298-142801320 AGCCTCTGGGTCCCTGGGGATGG + Intergenic
1050122768 9:2324945-2324967 CCCATCTTGTTCCCTGCTGATGG - Intergenic
1051507631 9:17843594-17843616 TCTGTCTGGATCCCTGAGGATGG + Intergenic
1052275895 9:26676275-26676297 ACCATCTGTTTCCCTGAGGCTGG + Intergenic
1057063861 9:92029772-92029794 CCCTAGTGGTTCCCTCAGGAAGG + Intergenic
1057526880 9:95810749-95810771 CCTCTCTGGTTCCTGGAGGTGGG + Intergenic
1061386839 9:130295482-130295504 CCCCTGGGGATCCCTGAGGGTGG + Intronic
1062089433 9:134667369-134667391 TCCCTCTGACTCCCTGAAGAAGG - Intronic
1062093757 9:134692252-134692274 CCACTCTGGTACCCAGAGGTGGG - Intronic
1192170937 X:68854307-68854329 CACCTCTGGCTCCATGAGGGTGG - Intergenic
1197146666 X:123179570-123179592 CCTTTCTGTTTCCCTGAAGATGG - Intergenic