ID: 1132611193

View in Genome Browser
Species Human (GRCh38)
Location 16:817099-817121
Sequence GCCTCCAGAAAGGCCGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132611193_1132611199 -4 Left 1132611193 16:817099-817121 CCCGCAGCGGCCTTTCTGGAGGC No data
Right 1132611199 16:817118-817140 AGGCTGCTTCTTGGTGACTGGGG No data
1132611193_1132611198 -5 Left 1132611193 16:817099-817121 CCCGCAGCGGCCTTTCTGGAGGC No data
Right 1132611198 16:817117-817139 GAGGCTGCTTCTTGGTGACTGGG No data
1132611193_1132611203 27 Left 1132611193 16:817099-817121 CCCGCAGCGGCCTTTCTGGAGGC No data
Right 1132611203 16:817149-817171 GAGCCGTCCCCAGCCTCAAGCGG No data
1132611193_1132611200 -3 Left 1132611193 16:817099-817121 CCCGCAGCGGCCTTTCTGGAGGC No data
Right 1132611200 16:817119-817141 GGCTGCTTCTTGGTGACTGGGGG No data
1132611193_1132611197 -6 Left 1132611193 16:817099-817121 CCCGCAGCGGCCTTTCTGGAGGC No data
Right 1132611197 16:817116-817138 GGAGGCTGCTTCTTGGTGACTGG No data
1132611193_1132611201 5 Left 1132611193 16:817099-817121 CCCGCAGCGGCCTTTCTGGAGGC No data
Right 1132611201 16:817127-817149 CTTGGTGACTGGGGGCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132611193 Original CRISPR GCCTCCAGAAAGGCCGCTGC GGG (reversed) Intergenic