ID: 1132611619

View in Genome Browser
Species Human (GRCh38)
Location 16:819608-819630
Sequence TATTTAGCACAGCCTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132611615_1132611619 6 Left 1132611615 16:819579-819601 CCTCTGAGCATGTCCTTGTGGCC 0: 1
1: 0
2: 1
3: 14
4: 187
Right 1132611619 16:819608-819630 TATTTAGCACAGCCTGAGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 120
1132611616_1132611619 -7 Left 1132611616 16:819592-819614 CCTTGTGGCCTGCGTTTATTTAG 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1132611619 16:819608-819630 TATTTAGCACAGCCTGAGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 120
1132611614_1132611619 7 Left 1132611614 16:819578-819600 CCCTCTGAGCATGTCCTTGTGGC 0: 1
1: 0
2: 0
3: 7
4: 158
Right 1132611619 16:819608-819630 TATTTAGCACAGCCTGAGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132611619 Original CRISPR TATTTAGCACAGCCTGAGCT GGG Intergenic
901228534 1:7629162-7629184 CAGTTGGCAGAGCCTGAGCTTGG - Intronic
903347714 1:22697920-22697942 GAGTTGGCCCAGCCTGAGCTAGG - Intergenic
906161087 1:43649712-43649734 TTTTCAGCACTCCCTGAGCTCGG + Intergenic
907159910 1:52362303-52362325 CAGTTAGCACAGACTGAACTGGG - Intronic
908528174 1:65008085-65008107 TGATTAGCACAGCTTGAGTTTGG + Intergenic
909197271 1:72643431-72643453 TATTTACCACAGTATGAGCTAGG + Intergenic
909383851 1:75034437-75034459 TATTTAAACCAGCCTGAGCAAGG + Intergenic
911592874 1:99767906-99767928 TATTTTGCAGAGCCTGGACTCGG - Intergenic
914702310 1:150146295-150146317 TATTTAAGACAGCCTGCACTTGG + Intergenic
918619943 1:186591609-186591631 TATTTAGCACACCCTTAGGCAGG - Intergenic
920515359 1:206581215-206581237 TATTAATAACAGCCTGTGCTGGG - Intronic
923816011 1:237379772-237379794 TATGTAGCACAGGCTGGGCAAGG - Intronic
924175462 1:241387020-241387042 ACTTTAGCACAGCCTGAGCAAGG - Intergenic
924190718 1:241549611-241549633 AATTTTGCTCATCCTGAGCTAGG + Intronic
1071953077 10:90727414-90727436 TATAAAGAACTGCCTGAGCTGGG + Intergenic
1074517524 10:114184407-114184429 TAATAAGCACAGCCTGAGGATGG - Intronic
1074690544 10:116000517-116000539 TCCTTGGCCCAGCCTGAGCTGGG + Intergenic
1078006897 11:7538896-7538918 TAATCAGAACAGCCTGATCTAGG + Intronic
1078444699 11:11395418-11395440 TATGTAGCAGGGCCTGTGCTAGG + Intronic
1080547110 11:33331483-33331505 TACTGGGCACAGCCTGAGGTAGG - Intronic
1080931175 11:36812916-36812938 AATTTTGCACAGACTGAGCTTGG - Intergenic
1082653121 11:55819018-55819040 TAATTAGTACAGCCTGATTTTGG + Intergenic
1083819759 11:65162344-65162366 TTTTTTGCATAGCGTGAGCTAGG - Intergenic
1085855737 11:80173631-80173653 CACCTAGCACAGCCTAAGCTGGG - Intergenic
1085867872 11:80316203-80316225 TATTTAGCACAGGCTTAGCCTGG - Intergenic
1087504635 11:99003740-99003762 TATTAAGAACAGCCTGAGACTGG - Intergenic
1089249620 11:117148527-117148549 TATTTACCAGACCCTGTGCTAGG - Intronic
1089320819 11:117625608-117625630 TACTTGGCACAGCTTGAGGTAGG + Intronic
1090260323 11:125314655-125314677 TCTGCAGCACAGCCAGAGCTGGG - Intronic
1091689911 12:2588900-2588922 TAGTCAGCACCGCCTGTGCTGGG + Intronic
1095735255 12:45548946-45548968 TAATTAGCACTGCCTGGGCCTGG - Intergenic
1096692425 12:53329170-53329192 TCATTAGCATAGCCTGAGGTGGG + Exonic
1098154020 12:67578499-67578521 TATTAAACACAGCCTTAGATAGG + Intergenic
1099783307 12:87228698-87228720 TATTTATCATAGTCTTAGCTGGG - Intergenic
1100960076 12:99953164-99953186 TATTTAGAAATGCCTAAGCTAGG + Intronic
1101071960 12:101085048-101085070 TATTTTGGCCAGTCTGAGCTAGG + Intronic
1103912208 12:124358736-124358758 TAAGTAGCCCTGCCTGAGCTTGG - Intronic
1104253188 12:127116093-127116115 TATTTAGCACAGTATTTGCTAGG + Intergenic
1106190762 13:27450496-27450518 TATTTAGCATTACCTGTGCTGGG + Exonic
1107655297 13:42586990-42587012 TATTTGGTATAGTCTGAGCTGGG + Intronic
1108181725 13:47846630-47846652 TAGTTAGCTCAGCCTGAGACAGG + Intergenic
1114393629 14:22337083-22337105 TTTTCAGCAAAGCCTGTGCTTGG + Intergenic
1114726597 14:24944303-24944325 TATTTACCTCTGCCTGAGGTTGG - Intronic
1121443528 14:93964162-93964184 TACCTGGCACAGCCAGAGCTTGG + Intronic
1128188542 15:65667039-65667061 TATTTAGCATAGGCTGGGCACGG + Intronic
1128584873 15:68839762-68839784 TGGATATCACAGCCTGAGCTAGG + Intronic
1132611619 16:819608-819630 TATTTAGCACAGCCTGAGCTGGG + Intergenic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1136057114 16:27698702-27698724 TATTTCACAAAGCCTAAGCTGGG + Intronic
1136177607 16:28528646-28528668 TATTTACCAAAGCCTGCACTAGG - Intergenic
1141647413 16:85375158-85375180 CAGCTCGCACAGCCTGAGCTGGG - Intergenic
1149126541 17:53241291-53241313 TGTGTACCACAGCCTGAGATAGG - Intergenic
1150156210 17:62855582-62855604 CAGTTAGTACAGCCTGGGCTTGG + Intergenic
1155036159 18:22026588-22026610 TAATTAGCACAGCCAAACCTTGG - Intergenic
1156991717 18:43416841-43416863 TTATTAGCAAAGCCTGAGCTGGG - Intergenic
1158355561 18:56614804-56614826 TATTTACCACAGTGTTAGCTCGG - Intronic
1158787063 18:60726763-60726785 TATTTACAACAACCTGATCTTGG - Intergenic
1159092133 18:63861201-63861223 CATTTAGACCAGCCTGAGCCAGG - Intergenic
1162331860 19:10034792-10034814 TGTTTAGCTCTGCCTGGGCTGGG - Intergenic
1163043970 19:14625273-14625295 TATTAAGCCCAGCATTAGCTGGG - Intronic
1163291659 19:16383313-16383335 GAGCTAGCAGAGCCTGAGCTAGG - Intronic
1167570015 19:50281069-50281091 TCTGTAGCACAGCCTGATATAGG + Intronic
926806912 2:16719563-16719585 TGTTAAGCACAGTCTGAGCTGGG + Intergenic
927323731 2:21779058-21779080 TATGTTGCACAGGCTGATCTTGG + Intergenic
927489220 2:23509735-23509757 AATACAGCAAAGCCTGAGCTTGG + Intronic
927602635 2:24457482-24457504 TGTCAAGCACAGCCTCAGCTGGG - Intergenic
929202547 2:39252455-39252477 TATTGAGCACTTCCTTAGCTAGG - Intronic
933156087 2:78977131-78977153 TATTTTACAAAACCTGAGCTAGG - Intergenic
935945522 2:108282848-108282870 TATTTAAAATAGCATGAGCTGGG + Intergenic
936953485 2:118001730-118001752 TTCTCAGCTCAGCCTGAGCTGGG + Intronic
938321665 2:130370337-130370359 TGTTCAGCACAGACTCAGCTGGG + Intronic
939134755 2:138280030-138280052 TATCTATCACAGCCTGAGTGTGG + Intergenic
940033759 2:149291821-149291843 TATTTTGGCCAACCTGAGCTGGG - Intergenic
940551487 2:155163085-155163107 TATTACAAACAGCCTGAGCTTGG - Intergenic
947776642 2:232717149-232717171 TATTTAACACAACTGGAGCTGGG + Intronic
1169200598 20:3707349-3707371 TCCTGGGCACAGCCTGAGCTGGG - Intergenic
1172097044 20:32465544-32465566 TATTTCTCACCGCCTGTGCTTGG - Intronic
1173178920 20:40786868-40786890 TATGTATTAGAGCCTGAGCTGGG - Intergenic
949484589 3:4525852-4525874 TATTTAGCACCGGGGGAGCTGGG - Intronic
950706239 3:14784271-14784293 TATTTCCCAAGGCCTGAGCTGGG - Intergenic
950972269 3:17201306-17201328 TAGTGAACACAGCGTGAGCTCGG + Intronic
951024340 3:17814069-17814091 GAGATAACACAGCCTGAGCTGGG + Intronic
953511578 3:43546031-43546053 TATTTTAAACAGCTTGAGCTTGG + Intronic
955254176 3:57312706-57312728 TAGTTGGTACAGCCTAAGCTTGG - Intronic
959661444 3:108873190-108873212 TCTTTAGCAAAGACTTAGCTTGG - Intergenic
962206522 3:133439551-133439573 TACCTAGCACAGCCTGAGCCAGG + Intronic
963465830 3:145680813-145680835 TTTTTATTACAGGCTGAGCTAGG - Intergenic
963608712 3:147438008-147438030 TATTAAGAACATCCTGGGCTGGG - Intronic
970892629 4:21065299-21065321 TATCTGGCACAGCCTTGGCTGGG + Intronic
975714875 4:77195985-77196007 TATTTTGCTCTGCCTGAGGTGGG - Intronic
986692859 5:10328166-10328188 TATGTTGCCCAGGCTGAGCTGGG + Intergenic
989232708 5:39104225-39104247 TAGCTAGAACAGCCTGATCTTGG + Intergenic
989772773 5:45164518-45164540 TATTCAGCACAGGCTGGGCGCGG + Intergenic
990168649 5:53022352-53022374 AATGTAGCAAAGCCTGAGCATGG - Intronic
993498123 5:88631363-88631385 TATGTATCAGAGTCTGAGCTAGG - Intergenic
994301998 5:98157935-98157957 TATTTAGAGAAGCCTTAGCTAGG + Intergenic
998399067 5:141838556-141838578 TAGTTAGCGCAGGCAGAGCTGGG - Intergenic
1004052873 6:12105786-12105808 TATTTAGCTCACCTTGGGCTGGG - Intronic
1007187381 6:39983867-39983889 TATTTTGCTCAACCTAAGCTAGG + Intergenic
1012622869 6:101368485-101368507 TATTTAGCACTATCTTAGCTTGG - Intergenic
1014281040 6:119442766-119442788 TATATGGCAGGGCCTGAGCTAGG - Intergenic
1016524847 6:144990209-144990231 TATTTAGTACAGGCAGAGGTAGG + Intergenic
1016792950 6:148085675-148085697 TATTAAACCCAGTCTGAGCTTGG + Intergenic
1017142723 6:151206482-151206504 TACTTAGCAAAGCCTGCTCTTGG + Intergenic
1017567025 6:155698367-155698389 TCATTAACAGAGCCTGAGCTGGG - Intergenic
1018937994 6:168286292-168286314 CCTTCAGCACAGCCTGAGCTCGG + Intergenic
1021658029 7:22891092-22891114 TATTTACCAGGTCCTGAGCTAGG + Intergenic
1023333724 7:39146622-39146644 GATGTAGCTCAGCCTGAGTTAGG + Intronic
1026953930 7:74365107-74365129 TAATTAGAACATGCTGAGCTGGG - Intronic
1030425043 7:109365504-109365526 TATTTAGCACACCATAATCTTGG + Intergenic
1034626196 7:152494672-152494694 CACTGAGCACAGCCAGAGCTGGG + Intergenic
1037100459 8:15037461-15037483 TATTTATCACAGCATGAGAATGG + Intronic
1039276729 8:35940659-35940681 TATTTAACACACCATGAGATTGG + Intergenic
1039872968 8:41562464-41562486 TATTTAGCTCAGCGTGATCCTGG - Intergenic
1044478757 8:92660071-92660093 ATTTTAGCACAGCCAGACCTGGG + Intergenic
1046607783 8:116389924-116389946 TATATAGAACTGCCTGAGATTGG - Intergenic
1051682192 9:19618640-19618662 TATTTAGCAAAGCCTTATATTGG + Intronic
1056364969 9:85895186-85895208 TTTTTAGCACAGCCTAGGCCAGG - Intergenic
1058164104 9:101601442-101601464 TGTCTAGAAGAGCCTGAGCTGGG + Intronic
1059044867 9:110855565-110855587 TAGTTAGCACAGACTCTGCTAGG + Intergenic
1059163499 9:112057243-112057265 TATTTCTCACAGTCTGTGCTGGG - Intronic
1059814590 9:117898321-117898343 ATTTTAGCAAGGCCTGAGCTAGG - Intergenic
1061050928 9:128194519-128194541 TTTTAAGGACAGCCTCAGCTGGG + Intronic
1061687354 9:132292389-132292411 AATGTACCCCAGCCTGAGCTGGG + Intronic
1189291875 X:39892082-39892104 TATCTAGGACAGCCTCAGCTGGG - Intergenic
1195959793 X:110374418-110374440 ATTTTAGTACAGCCTGAGATTGG + Intronic
1196912883 X:120501671-120501693 TATTTAGAAGTGCCTGACCTAGG - Intergenic
1197462176 X:126755872-126755894 TATTGAGCACATACTAAGCTAGG - Intergenic
1199524063 X:148771791-148771813 GATTTAATACAGCCTGATCTTGG + Intronic
1200055019 X:153455744-153455766 TACTTTGCACAGCATGAGCAAGG - Exonic