ID: 1132611814 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:820698-820720 |
| Sequence | GACCAGCCTAGCGACCAACA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1132611814_1132611820 | 28 | Left | 1132611814 | 16:820698-820720 | CCGTGTTGGTCGCTAGGCTGGTC | No data | ||
| Right | 1132611820 | 16:820749-820771 | TCCTCAGCCTCTCAAAGTGTTGG | No data | ||||
| 1132611814_1132611822 | 29 | Left | 1132611814 | 16:820698-820720 | CCGTGTTGGTCGCTAGGCTGGTC | No data | ||
| Right | 1132611822 | 16:820750-820772 | CCTCAGCCTCTCAAAGTGTTGGG | No data | ||||
| 1132611814_1132611815 | -5 | Left | 1132611814 | 16:820698-820720 | CCGTGTTGGTCGCTAGGCTGGTC | No data | ||
| Right | 1132611815 | 16:820716-820738 | TGGTCTCAAACTCCAACCTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1132611814 | Original CRISPR | GACCAGCCTAGCGACCAACA CGG (reversed) | Intergenic | ||