ID: 1132611814

View in Genome Browser
Species Human (GRCh38)
Location 16:820698-820720
Sequence GACCAGCCTAGCGACCAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132611814_1132611820 28 Left 1132611814 16:820698-820720 CCGTGTTGGTCGCTAGGCTGGTC No data
Right 1132611820 16:820749-820771 TCCTCAGCCTCTCAAAGTGTTGG No data
1132611814_1132611822 29 Left 1132611814 16:820698-820720 CCGTGTTGGTCGCTAGGCTGGTC No data
Right 1132611822 16:820750-820772 CCTCAGCCTCTCAAAGTGTTGGG No data
1132611814_1132611815 -5 Left 1132611814 16:820698-820720 CCGTGTTGGTCGCTAGGCTGGTC No data
Right 1132611815 16:820716-820738 TGGTCTCAAACTCCAACCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132611814 Original CRISPR GACCAGCCTAGCGACCAACA CGG (reversed) Intergenic