ID: 1132612324

View in Genome Browser
Species Human (GRCh38)
Location 16:823483-823505
Sequence CCCTGTGTATCACGGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132612314_1132612324 22 Left 1132612314 16:823438-823460 CCGAGAATCATACGGGCCCCACT No data
Right 1132612324 16:823483-823505 CCCTGTGTATCACGGGCAGAAGG No data
1132612316_1132612324 6 Left 1132612316 16:823454-823476 CCCCACTTCCGTGGAAAACAATC No data
Right 1132612324 16:823483-823505 CCCTGTGTATCACGGGCAGAAGG No data
1132612318_1132612324 4 Left 1132612318 16:823456-823478 CCACTTCCGTGGAAAACAATCCG No data
Right 1132612324 16:823483-823505 CCCTGTGTATCACGGGCAGAAGG No data
1132612317_1132612324 5 Left 1132612317 16:823455-823477 CCCACTTCCGTGGAAAACAATCC No data
Right 1132612324 16:823483-823505 CCCTGTGTATCACGGGCAGAAGG No data
1132612319_1132612324 -2 Left 1132612319 16:823462-823484 CCGTGGAAAACAATCCGAATTCC No data
Right 1132612324 16:823483-823505 CCCTGTGTATCACGGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132612324 Original CRISPR CCCTGTGTATCACGGGCAGA AGG Intergenic
No off target data available for this crispr