ID: 1132612552

View in Genome Browser
Species Human (GRCh38)
Location 16:824541-824563
Sequence ACCACATTTGTCCACAGACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132612552_1132612561 17 Left 1132612552 16:824541-824563 CCGAGTCTGTGGACAAATGTGGT No data
Right 1132612561 16:824581-824603 TGCCGAAGCCATGAAACTCAGGG No data
1132612552_1132612560 16 Left 1132612552 16:824541-824563 CCGAGTCTGTGGACAAATGTGGT No data
Right 1132612560 16:824580-824602 CTGCCGAAGCCATGAAACTCAGG No data
1132612552_1132612563 24 Left 1132612552 16:824541-824563 CCGAGTCTGTGGACAAATGTGGT No data
Right 1132612563 16:824588-824610 GCCATGAAACTCAGGGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132612552 Original CRISPR ACCACATTTGTCCACAGACT CGG (reversed) Intergenic
No off target data available for this crispr