ID: 1132614075

View in Genome Browser
Species Human (GRCh38)
Location 16:831755-831777
Sequence GGCCCGCTGGGAACAGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132614058_1132614075 27 Left 1132614058 16:831705-831727 CCCCGTGGCTGTGTTGAACGTCA No data
Right 1132614075 16:831755-831777 GGCCCGCTGGGAACAGGTGTGGG 0: 1
1: 0
2: 1
3: 17
4: 139
1132614070_1132614075 -5 Left 1132614070 16:831737-831759 CCGGGCACGTGGGGACGGGGCCC 0: 1
1: 0
2: 1
3: 17
4: 201
Right 1132614075 16:831755-831777 GGCCCGCTGGGAACAGGTGTGGG 0: 1
1: 0
2: 1
3: 17
4: 139
1132614059_1132614075 26 Left 1132614059 16:831706-831728 CCCGTGGCTGTGTTGAACGTCAC No data
Right 1132614075 16:831755-831777 GGCCCGCTGGGAACAGGTGTGGG 0: 1
1: 0
2: 1
3: 17
4: 139
1132614060_1132614075 25 Left 1132614060 16:831707-831729 CCGTGGCTGTGTTGAACGTCACA No data
Right 1132614075 16:831755-831777 GGCCCGCTGGGAACAGGTGTGGG 0: 1
1: 0
2: 1
3: 17
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132614075 Original CRISPR GGCCCGCTGGGAACAGGTGT GGG Intergenic
902714852 1:18265632-18265654 GGCCTGATGGGCACAGGAGTTGG - Intronic
904744508 1:32702756-32702778 GGCCGGCCGGGATCCGGTGTCGG - Exonic
905236720 1:36555104-36555126 GGCCCACTGGGAACGCGTTTGGG - Intergenic
907289452 1:53403420-53403442 GGCAAGCTGGGACCAGTTGTGGG + Intergenic
909346675 1:74596973-74596995 TGCCCTCTGGGAACAGGTGTAGG + Intronic
912382667 1:109255736-109255758 GGCAGGATGGGAACAGGGGTGGG - Intronic
916573905 1:166050592-166050614 GGCCAGCTGGGATTAGGTTTGGG + Intergenic
919805344 1:201378013-201378035 GGCCAGCTGGGAGCAGGGTTGGG + Intronic
920106272 1:203555813-203555835 GGCCTGCTGGGACCAGCTGCTGG - Intergenic
921168347 1:212523814-212523836 GGCCTCCTGGGTACAGCTGTAGG - Intergenic
922174053 1:223181270-223181292 GGCCCCATGTGCACAGGTGTGGG + Intergenic
922801477 1:228366611-228366633 GGCTGGCTGGGTACAGGTCTTGG + Intronic
923277837 1:232414280-232414302 GAGCCTCTGGGAACAGGAGTTGG - Intronic
924043760 1:240008594-240008616 GGACAGGTGGGAACAGATGTTGG + Intergenic
1064145429 10:12822967-12822989 GCCCTGCTGGGAAAAGGTGGTGG + Intronic
1065353946 10:24820924-24820946 GGCCTGCTGGGAGCAGGGGCTGG - Intergenic
1067068669 10:43117450-43117472 GGACCCCTTGGACCAGGTGTGGG - Intronic
1067456626 10:46423736-46423758 GGCCTGCTGGGAACACCTGTAGG - Intergenic
1067630576 10:47960903-47960925 GGCCTGCTGGGAACACCTGTAGG + Intergenic
1067687660 10:48476809-48476831 GGCCTGCTGGGTGCAGGTCTTGG + Intronic
1075541602 10:123318575-123318597 GGCCCCTAGGGAGCAGGTGTGGG + Intergenic
1076737396 10:132464976-132464998 GGCCCCCTGGGCACAGGCCTGGG + Intergenic
1077659784 11:4057344-4057366 GCCAGGCTGGGCACAGGTGTAGG + Intronic
1078396936 11:10989444-10989466 GGCCGGCGGGGAGCTGGTGTAGG + Intergenic
1083312656 11:61792710-61792732 GGCCTGCGGGGACCTGGTGTGGG + Exonic
1083933999 11:65860903-65860925 GGCCCGATGGGAAAAGCTGCTGG + Intronic
1087009460 11:93499598-93499620 TGCCTGCTGGGCACAGGAGTGGG - Intronic
1087145182 11:94803445-94803467 GGCCTGCAGGGAACATGTGTTGG + Intronic
1088541346 11:110917126-110917148 GGCACTCTGGGAAGAGGTGGAGG - Intergenic
1089661670 11:119990177-119990199 GGGCCGCTGGGAAGGGGTGTGGG - Intergenic
1091896561 12:4109841-4109863 GGCCAGCTGGGCAAAGGTGAGGG + Intergenic
1094208117 12:27861988-27862010 GGCCAGCTGTGGACAGCTGTTGG + Intergenic
1095954577 12:47798817-47798839 GGCCTGCTAGGAAGAGGTGGTGG + Exonic
1097224807 12:57471028-57471050 GGCCTGCTGGGGACAGGGGTTGG - Exonic
1102159801 12:110759382-110759404 GGCTGGCTGGGAATAGGTGCTGG + Intergenic
1104188773 12:126457984-126458006 GGCCTGCAGGGAACAGGTGGAGG + Intergenic
1104935418 12:132361624-132361646 GGCCAGGTGGGAACAGGTCCGGG + Intergenic
1104992164 12:132631848-132631870 GGGGCGCTGGGACCAGGTGCAGG - Intronic
1112571860 13:100600694-100600716 GTCCAGATGGGAACAGATGTAGG - Intergenic
1115012002 14:28559677-28559699 GGCACGCCTGGAACAGCTGTGGG + Intergenic
1122738912 14:103859573-103859595 GGCCGGGTGGGGACAGATGTGGG + Intergenic
1123091565 14:105744388-105744410 GGTCCGCTGGGACCAGCCGTGGG + Intergenic
1202872427 14_GL000225v1_random:177234-177256 GGCTCCCTGGGAACGAGTGTGGG - Intergenic
1124818036 15:33016649-33016671 GGCCCGCTGACAAAAGGTGTTGG - Intronic
1125416661 15:39460994-39461016 GGCTCTCTGGGTACAGATGTAGG - Intergenic
1128113095 15:65088647-65088669 GGCCTGCTGGGCCCAGGAGTGGG - Intergenic
1128215779 15:65933175-65933197 GGCCTGCTGGGGACTGGTGGGGG - Intronic
1130231569 15:82101240-82101262 GACCCGCTGCGAGCAGTTGTGGG - Intergenic
1132292639 15:100714088-100714110 GGCCCCCTGGGAGCACGTGCAGG + Intergenic
1132614075 16:831755-831777 GGCCCGCTGGGAACAGGTGTGGG + Intergenic
1132865011 16:2088993-2089015 GGCCTGCTGGCATCAGGTCTGGG - Exonic
1133113420 16:3563083-3563105 GGCCTCCTGGGCACAGGCGTCGG + Exonic
1134045456 16:11097923-11097945 GGCCCACGGGCGACAGGTGTAGG + Intronic
1134429286 16:14186622-14186644 GGCTGGCTGGGAAAAGGGGTGGG + Intronic
1139955135 16:70689583-70689605 GGCGGGAAGGGAACAGGTGTGGG - Intronic
1141832878 16:86519527-86519549 GGGTCGCTGGGACCAGGTGCAGG + Intergenic
1141850423 16:86641515-86641537 GGCCCGCTGGGAACACATCCCGG + Intergenic
1142247006 16:88974837-88974859 GGCCCCCAGGGGACAGATGTGGG - Intronic
1143108717 17:4541970-4541992 GGCCCGCTGGGCACTGCTGTGGG + Intronic
1143316771 17:6038827-6038849 GCTCCGCTTGGACCAGGTGTGGG + Intronic
1146247765 17:31305250-31305272 GGCTTGCTGGGAGGAGGTGTTGG + Exonic
1146290660 17:31604646-31604668 GGGCCTCTGGGCCCAGGTGTTGG + Intergenic
1148205768 17:45778957-45778979 GGTCGGCTGGGAACAGGAGATGG - Intergenic
1151344619 17:73494069-73494091 GGGCCCCTGGGAACAGGAGAGGG - Intronic
1152423846 17:80208417-80208439 GGCCCTCTTGGCACAGCTGTGGG + Exonic
1152430586 17:80246406-80246428 AGCCCACTGGGGACAGGGGTGGG - Intronic
1152897766 17:82923051-82923073 GGCGCACTGGGAACAGGAGTTGG - Intronic
1152926052 17:83088275-83088297 GGTCTGCTGGGCACAGGTCTGGG - Intronic
1158517167 18:58140137-58140159 GGCCCTCTGGGACTAGGTATAGG - Intronic
1159878258 18:73833812-73833834 GGGACACTGGGAACAGGTCTGGG - Intergenic
1160231804 18:77054443-77054465 GGCCCCTGGGGAACAGGTGGAGG + Intronic
1161522043 19:4730107-4730129 AGCCCGCTGGGGAGGGGTGTGGG - Intergenic
1162454866 19:10777280-10777302 GGCAGGCAGGGAACAGGTGCTGG - Intronic
1162547461 19:11339309-11339331 GCCCAGCTGGGGACAGGCGTTGG - Intronic
1163311412 19:16517125-16517147 AGCCTGCTGGGGACAGGTGCTGG + Intronic
1164896429 19:31881327-31881349 GGCCCTACAGGAACAGGTGTGGG + Intergenic
1165778476 19:38418456-38418478 GTCCCGCTGGGTGCAGGTGATGG - Exonic
1166568836 19:43780765-43780787 GGCCGGCTGGGCACTGGTGCTGG - Exonic
1166677274 19:44747851-44747873 GGCCCGCGGGGCACCGGGGTGGG - Intronic
926312211 2:11682973-11682995 GGACCTTTGGGAACAGGTTTGGG - Intronic
927152427 2:20203724-20203746 TGCCCGCAGGGCACAGGTGTAGG + Intronic
927694441 2:25230622-25230644 GGGCCTCTGGGGACAGGTATTGG - Exonic
928087029 2:28352419-28352441 GGCAGGCTGGGAACAGCCGTAGG - Intergenic
932357521 2:71078492-71078514 AGCCCCCTAGGAAAAGGTGTAGG - Exonic
932369978 2:71178757-71178779 AGCCCCCTAGGAAAAGGTGTAGG - Intergenic
934545026 2:95207452-95207474 GGTCCTCTGGGAAGCGGTGTTGG + Intergenic
934992175 2:98929598-98929620 GGCATTCTGGGACCAGGTGTGGG - Intronic
936547612 2:113406261-113406283 GGCCCACTGGGCACAGCTGCAGG - Intergenic
938086342 2:128404611-128404633 GACCCATTGGGAACAGGAGTCGG + Intergenic
938766226 2:134462113-134462135 GGCCCCCTGGGAACAGGCTCGGG + Intronic
939717184 2:145599137-145599159 GGCCTCCTGGGAACAGCTATGGG + Intergenic
946439178 2:219680539-219680561 GGCCTGCTGGGTACAGGGGCTGG - Intergenic
1171371518 20:24665383-24665405 GGCCCGCCGGGAGCTGGTGCTGG - Exonic
1173593640 20:44244876-44244898 GTCCAGCTGGCAGCAGGTGTGGG + Intergenic
1174001592 20:47378826-47378848 GCCCTGCAGGGACCAGGTGTTGG + Intergenic
1179781212 21:43702208-43702230 TGCCCGCTGAGCCCAGGTGTGGG - Intergenic
1181508798 22:23379660-23379682 GGCCCGGTGGGAGCAGCTGGAGG - Intergenic
1184842252 22:47058863-47058885 GGCCCGCTGGACCCAGGTGAAGG + Intronic
950316428 3:12005049-12005071 GTCCCGCTGGGAGGAGGTGCGGG + Intronic
950668956 3:14513804-14513826 GGCCCCCTGGGTTCAGGTGTGGG - Exonic
952395844 3:32919843-32919865 GGGCTGCTGGGAACAGAAGTAGG + Intergenic
956026050 3:64984183-64984205 GTCCTCCTGGGAACAGGAGTGGG - Intergenic
960879803 3:122332826-122332848 GGCCAGCTGGGAACGGTGGTGGG - Intronic
961318716 3:126057728-126057750 GGCACGAGGGGAACAGGTGCTGG - Intronic
961605788 3:128094497-128094519 GGTCCACTGGGAAGCGGTGTGGG + Intronic
964968378 3:162527194-162527216 GGCCTGTTGGGAACAGTTTTGGG - Intergenic
966396102 3:179504885-179504907 GGAGCTCTGGGAACAGTTGTGGG + Intergenic
968911457 4:3478762-3478784 GGCCTGCTGGGGACAGGGATGGG - Intronic
969447243 4:7252316-7252338 GGCATGCTGGGGCCAGGTGTGGG + Intronic
977676615 4:99755308-99755330 AGCCCGCTGCAAACAGGTGATGG - Intergenic
985016318 4:185638995-185639017 GGTTCCCTTGGAACAGGTGTCGG + Intronic
985661175 5:1157353-1157375 GAGCAGATGGGAACAGGTGTGGG - Intergenic
985661219 5:1157622-1157644 GAGCAGATGGGAACAGGTGTGGG - Intergenic
989768569 5:45115672-45115694 GGCAGGCTGCGAACAGGTGAAGG - Intergenic
992940002 5:81751711-81751733 GGCCCTCTGGGAACAGGGCGGGG - Intronic
995180941 5:109229662-109229684 GGCAAGCGAGGAACAGGTGTGGG + Intergenic
996157806 5:120124227-120124249 GGAAGGATGGGAACAGGTGTGGG + Intergenic
997397979 5:133579956-133579978 GGCCGGCTGGGAGCAGGACTGGG + Intronic
999108350 5:149093607-149093629 GGCCCACTGGTAGCATGTGTGGG - Intergenic
999767804 5:154754811-154754833 GGCCCGCCGGGCACAGGGGAGGG + Intronic
1001995624 5:176155155-176155177 GTTCCGCTGGGAACAGGTCCCGG + Intergenic
1005980235 6:30830916-30830938 AGCCCGCTGGGAACAAGTAAGGG + Intergenic
1006408950 6:33860974-33860996 AGCCCGGTGGGAACAGCTGCAGG - Intergenic
1006439327 6:34043403-34043425 GGCCTGCGGGGAGCAAGTGTGGG - Intronic
1006478579 6:34273740-34273762 GGTCCCCTGGGACCTGGTGTGGG - Intergenic
1007412671 6:41673972-41673994 GGCCCCCAGGGAACAGGAGCAGG + Intergenic
1013906719 6:115228601-115228623 GGTCCGTTGGGAACTAGTGTAGG - Intergenic
1017135087 6:151140944-151140966 GACCAGCTGGGAACAGCTTTAGG - Intergenic
1017182185 6:151564381-151564403 GCCCCGATGGGAACAGCAGTGGG + Intronic
1019363175 7:616384-616406 GGCCTGGTGGGCACAGGTGGTGG - Intronic
1022173280 7:27849776-27849798 GGGCGGCCGGGAAGAGGTGTAGG - Intronic
1023826594 7:44014225-44014247 GCCCTGCCAGGAACAGGTGTGGG + Intergenic
1026929443 7:74215747-74215769 GGCCCACAGGGCAGAGGTGTTGG + Intronic
1028254627 7:88578684-88578706 GGCTGGCTGGGGACAGGAGTAGG - Intergenic
1029446441 7:100615446-100615468 GGTCCCCTGGGAACAGGGGTGGG - Intergenic
1029737751 7:102473980-102474002 GCCCTGCCAGGAACAGGTGTGGG + Intronic
1029754883 7:102567629-102567651 GCCCTGCTAGGAACAGGTGTGGG + Intronic
1029772833 7:102666709-102666731 GCCCTGCTAGGAACAGGTGTGGG + Intronic
1034555032 7:151845078-151845100 GGGCAGCTGGGAACAGGGGCAGG - Intronic
1034972574 7:155428299-155428321 GGCCAGATGGGAAAAGGTGTGGG - Intergenic
1035557779 8:579387-579409 GCCCAGCTGGGCACAGGTGATGG + Intergenic
1035570771 8:671032-671054 GGACCGGTGGGCTCAGGTGTTGG - Intronic
1036522088 8:9501249-9501271 GGCCGGCTGGGATCAGGGGCAGG + Intergenic
1036631301 8:10517861-10517883 GGCCCGCTAGGAGCAGAGGTTGG - Intergenic
1039044168 8:33434889-33434911 GGCTGGCTGGGCACAGGTGCAGG + Intronic
1039706625 8:40014049-40014071 GGCCAGCTGGAAACAGGTCTGGG + Intronic
1041463382 8:58135827-58135849 GGCTCGCTGAGATGAGGTGTGGG + Intronic
1042485443 8:69341603-69341625 GGCCCGCGGGGAACTGGAGCGGG + Intergenic
1049000676 8:139823869-139823891 GGCCTGGAGGGAGCAGGTGTGGG - Intronic
1057873295 9:98733952-98733974 GGCAGGCTGGGGACACGTGTGGG + Exonic
1061398948 9:130358016-130358038 AGCCAGCTGGGCACAGGTGGAGG + Intronic
1062080542 9:134621183-134621205 GGGCAGCAGGGTACAGGTGTAGG + Intergenic
1203732025 Un_GL000216v2:99308-99330 GGCTCCCTGGGAACGAGTGTGGG + Intergenic
1192169129 X:68843538-68843560 GGCCCCCTGGGAGCAGCTGTGGG + Intergenic
1193942932 X:87698567-87698589 GGCAGTCTGGGAACAAGTGTTGG + Intergenic
1196393536 X:115234173-115234195 GGCGGGCTGGGAGGAGGTGTTGG + Intergenic
1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG + Intronic
1201428927 Y:13885679-13885701 GGCCCGCTGGGGATGGGGGTGGG + Intergenic