ID: 1132616757

View in Genome Browser
Species Human (GRCh38)
Location 16:844867-844889
Sequence ACCAGGACGTGGAGGCTCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132616757_1132616763 -4 Left 1132616757 16:844867-844889 CCCCGGAGCCTCCACGTCCTGGT No data
Right 1132616763 16:844886-844908 TGGTACAGAGCCTGCCTCTCCGG No data
1132616757_1132616766 3 Left 1132616757 16:844867-844889 CCCCGGAGCCTCCACGTCCTGGT No data
Right 1132616766 16:844893-844915 GAGCCTGCCTCTCCGGGACTGGG No data
1132616757_1132616764 -3 Left 1132616757 16:844867-844889 CCCCGGAGCCTCCACGTCCTGGT No data
Right 1132616764 16:844887-844909 GGTACAGAGCCTGCCTCTCCGGG No data
1132616757_1132616765 2 Left 1132616757 16:844867-844889 CCCCGGAGCCTCCACGTCCTGGT No data
Right 1132616765 16:844892-844914 AGAGCCTGCCTCTCCGGGACTGG No data
1132616757_1132616768 9 Left 1132616757 16:844867-844889 CCCCGGAGCCTCCACGTCCTGGT No data
Right 1132616768 16:844899-844921 GCCTCTCCGGGACTGGGCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132616757 Original CRISPR ACCAGGACGTGGAGGCTCCG GGG (reversed) Intergenic
No off target data available for this crispr