ID: 1132617009

View in Genome Browser
Species Human (GRCh38)
Location 16:846544-846566
Sequence ACGTGGGTTTACAGGAAACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132617009_1132617015 4 Left 1132617009 16:846544-846566 CCCGGTTTCCTGTAAACCCACGT No data
Right 1132617015 16:846571-846593 CCCGTGTCTGTAATGCGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132617009 Original CRISPR ACGTGGGTTTACAGGAAACC GGG (reversed) Intergenic
No off target data available for this crispr