ID: 1132617439

View in Genome Browser
Species Human (GRCh38)
Location 16:848742-848764
Sequence CTGGGCAGGGAGAAGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1161
Summary {0: 1, 1: 0, 2: 9, 3: 124, 4: 1027}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132617439_1132617448 3 Left 1132617439 16:848742-848764 CCGTCCACCTTCTCCCTGCCCAG 0: 1
1: 0
2: 9
3: 124
4: 1027
Right 1132617448 16:848768-848790 CTCTGTGGGTTTCCCTGTTCTGG 0: 1
1: 4
2: 64
3: 393
4: 1194
1132617439_1132617452 27 Left 1132617439 16:848742-848764 CCGTCCACCTTCTCCCTGCCCAG 0: 1
1: 0
2: 9
3: 124
4: 1027
Right 1132617452 16:848792-848814 CATTCCAGAGACGGCATCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 56
1132617439_1132617451 18 Left 1132617439 16:848742-848764 CCGTCCACCTTCTCCCTGCCCAG 0: 1
1: 0
2: 9
3: 124
4: 1027
Right 1132617451 16:848783-848805 TGTTCTGGACATTCCAGAGACGG 0: 1
1: 0
2: 1
3: 19
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132617439 Original CRISPR CTGGGCAGGGAGAAGGTGGA CGG (reversed) Intergenic
900305896 1:2007763-2007785 CTTTGCAGGGCCAAGGTGGATGG + Intergenic
900584053 1:3424053-3424075 CTGGGCTGGGCGACGGTGAAGGG - Intronic
900690442 1:3977498-3977520 GTGACAAGGGAGAAGGTGGAAGG + Intergenic
900940904 1:5798096-5798118 ATGGGGAGAGAGGAGGTGGAGGG + Intergenic
901061337 1:6473357-6473379 CTGGGCAGAGAGCAGCTGGAGGG + Exonic
901454437 1:9355019-9355041 GTGGGCAGGAAAAAGGTGGTTGG + Intronic
901750033 1:11400402-11400424 CTGGACAGGGAGAGGTGGGACGG + Intergenic
901762478 1:11479823-11479845 CTAGGTAGGGAGTGGGTGGAGGG - Intronic
902112962 1:14098596-14098618 CTGGGCAGAGGGATGCTGGAGGG - Intergenic
902414058 1:16228617-16228639 CTGGTCAGAGAGCAGGTGGAGGG - Intergenic
902546526 1:17193867-17193889 GTGGGCATGGAGAATGTGGAGGG + Intergenic
902548932 1:17208004-17208026 CTGGGCTGGCAGCAGGAGGAAGG + Intronic
902622116 1:17656649-17656671 CAGGCCAGCGAGCAGGTGGAAGG - Exonic
902696520 1:18144200-18144222 CTGGGGAAGGAGAAGATGGGAGG - Intronic
902727501 1:18346927-18346949 CTGGTCAGGGAGCTGGAGGAAGG + Intronic
902746262 1:18476566-18476588 CCAGGCAGGGAGATGGTGGGGGG - Intergenic
902982676 1:20137231-20137253 CTTGGTAGGGGGAGGGTGGAGGG + Intergenic
903135860 1:21308821-21308843 CTGGGCAGGCAGGAAGGGGAGGG - Intronic
903232021 1:21927700-21927722 CTGGACTGGGAGAAGGAGGGGGG - Intronic
903420372 1:23214734-23214756 CAGGGCATGGGGCAGGTGGAGGG - Intergenic
903548906 1:24143981-24144003 CAGGGCCTGGAGAAGGTAGAAGG + Intergenic
903773378 1:25778064-25778086 TTGGGCAGGGAGAAGGGGCGTGG - Intronic
903904312 1:26672985-26673007 CTTTGAAGGGAGAAGGTGGGAGG - Intergenic
904052425 1:27647768-27647790 CAGGGCCGGGAGAAGGAGGAGGG + Intergenic
904337970 1:29810331-29810353 GAGGGAAGGAAGAAGGTGGAGGG - Intergenic
904456548 1:30651525-30651547 GCAGGCAGGGAGAAGGTGGGCGG - Intergenic
904456574 1:30651611-30651633 GCAGGCAGGGAGAAGGTGGGCGG - Intergenic
904880011 1:33689212-33689234 CTGGGGTGGGAGAATGAGGAAGG + Intronic
904921152 1:34009348-34009370 CGGGGGTGGGGGAAGGTGGAAGG + Intronic
905240871 1:36580700-36580722 CTGGGGAGGGAGCCGGTGGGAGG + Intergenic
905322854 1:37130171-37130193 CTGGGGTGGGGGAAGGGGGATGG - Intergenic
905528369 1:38656495-38656517 CTGGTCAGGGAGCAGGAGGAGGG + Intergenic
905657258 1:39692633-39692655 CTGGGCGGGGCGATGGAGGATGG + Intronic
905787572 1:40770481-40770503 GTGGGCAGGGAAGAGGTGCAGGG - Intronic
905795145 1:40811752-40811774 CTGGGCAGGGAGAAAGAACATGG + Intronic
905865750 1:41375689-41375711 CTGGGCCTGGAGAAATTGGATGG + Intronic
906026797 1:42681333-42681355 GGAAGCAGGGAGAAGGTGGAGGG - Intergenic
906711032 1:47930124-47930146 TTTGGCAGGGAGAAGGGGAAGGG - Intronic
906875547 1:49534380-49534402 CTGGGCAGGGAGATATTGGTAGG - Intronic
907069287 1:51519282-51519304 CGGGGCGGGGAGGAGGCGGAGGG + Exonic
907236799 1:53056824-53056846 TTGGGGAGGCAGAAGGTGGGAGG - Intergenic
907718080 1:56946328-56946350 CATGGCAGGGAGCAGCTGGAGGG + Intronic
907814340 1:57903503-57903525 TTGGGGAGAAAGAAGGTGGAAGG - Intronic
907873733 1:58466147-58466169 CGGGGCAGGGATAATGAGGAAGG + Intronic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
908466711 1:64403099-64403121 CTGCGGAGGCAGAAGATGGAGGG + Intergenic
908512771 1:64862518-64862540 CTGTGGAGGGAGCAGGAGGAGGG - Intronic
910442343 1:87265710-87265732 ATGGGGACTGAGAAGGTGGAAGG + Intergenic
910590124 1:88921239-88921261 CTAGGCAGGAAGAAGGTAGAGGG + Intergenic
910840680 1:91558426-91558448 TTGGGGAGGGGGAAGGGGGATGG - Intergenic
911046905 1:93636223-93636245 CTGTGAAGGGAGAAGCTGCAGGG + Intronic
911115890 1:94246866-94246888 CATGGCTGGGAAAAGGTGGAAGG + Intronic
911245337 1:95510386-95510408 CTGGGCGGGGGGTAGGGGGATGG + Intergenic
911306374 1:96237530-96237552 CTAGGTAGGGATAGGGTGGAAGG - Intergenic
912091350 1:106080711-106080733 CCAGGAAGGGAGAAGGAGGACGG + Intergenic
912230620 1:107788340-107788362 GTGGGCAGAGTGAGGGTGGAAGG - Intronic
912449942 1:109762463-109762485 CTGGGCAGGGTGGGGTTGGATGG - Intronic
912505447 1:110152602-110152624 CTGGGCAGGGAGATGGGGAGAGG + Intronic
912945521 1:114081041-114081063 GTGTGCTGGGAGAGGGTGGAGGG + Intergenic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
914259647 1:145988199-145988221 CTGGGAAGGAAAAATGTGGAGGG - Intergenic
914351330 1:146842867-146842889 GTGGGTAGGGAGATGATGGATGG + Intergenic
914705859 1:150169305-150169327 CTTGGCTGGGTGAAGGGGGACGG - Intergenic
915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG + Intergenic
915148093 1:153807391-153807413 GAGGGAAGGGAGGAGGTGGAAGG + Exonic
915230006 1:154438599-154438621 CAGGGCTGGGAGAAAGTGGCAGG - Intronic
915298694 1:154939870-154939892 CTCAGCAGGCTGAAGGTGGAAGG - Intergenic
915300855 1:154950897-154950919 CTGGGCAGAGGGAAGATGGTTGG - Intronic
915301286 1:154953048-154953070 CTGAGGAGGGAGAAGGGGGTTGG - Intronic
915437158 1:155916091-155916113 AGGGGCTGGGGGAAGGTGGAAGG - Intronic
915938477 1:160103066-160103088 CTGGGAATGGAGAAGTGGGATGG - Intergenic
916604845 1:166330941-166330963 CTGGGCAGGTAGAAGCTGCTTGG - Intergenic
916717574 1:167458146-167458168 CTGAGCAGGGCACAGGTGGAAGG - Intronic
916983742 1:170167674-170167696 CTGGGCCAGGAGAAGCAGGATGG + Exonic
917162096 1:172068926-172068948 GTGGGCAGGGAGATTGTGGGAGG + Intronic
917243695 1:172976818-172976840 CAGGTCAAGGACAAGGTGGAGGG + Intergenic
917589739 1:176463773-176463795 CTGTGCAGGGAGACCATGGAGGG + Intronic
918421342 1:184366989-184367011 CTGGGCAGGGAGATAGTGGGGGG - Intergenic
918703829 1:187637389-187637411 TTGGGGATGGAGAAGGAGGAGGG - Intergenic
919739400 1:200973102-200973124 CTGGGCTGGGAGAAGCGGGGAGG + Intronic
919932304 1:202229296-202229318 TGGGGCAGGGAGAAGGAGAAGGG - Intronic
920051239 1:203166248-203166270 CTGGGCTGGGAGAAGGTGCTTGG + Exonic
920086213 1:203419308-203419330 CAAGGCAGGGAGAAGGGGGAGGG + Intergenic
920116884 1:203627770-203627792 GTGGGCTGGGAGAAGTTGGCAGG + Intronic
920212332 1:204337237-204337259 CTGGGAAGGGAGGAGCTGGCTGG - Intronic
920290894 1:204922362-204922384 CTGGTCAGGCAGGAGGTGGCAGG - Intronic
920400889 1:205675766-205675788 CTGGGCAGGGCTCAGGTGGAGGG - Intronic
920497325 1:206464572-206464594 GTGGGGAGGGAGAAGGTGGCTGG - Intergenic
920577499 1:207072325-207072347 CTGGGCACGGAGAGGGCTGAGGG - Exonic
920657581 1:207888012-207888034 CAGGGGTGGGAGAAGGGGGAGGG + Intronic
921290897 1:213656346-213656368 CTGGGCAGGAATAAAGTGGATGG + Intergenic
921555809 1:216597417-216597439 CTGTGCATGAAGAAGATGGAAGG + Intronic
922000349 1:221471263-221471285 ATGGGGAGGGTGATGGTGGAAGG - Intergenic
922507166 1:226133300-226133322 CCAGGAAGGGAGGAGGTGGAGGG - Intergenic
922856372 1:228778526-228778548 CAGGGCAGGGGGAGGGGGGAGGG - Intergenic
922994267 1:229943693-229943715 CCGGACAGAGAGAAGGTGGGAGG + Intergenic
923109495 1:230879704-230879726 CGGGGCAGGGTGATTGTGGAGGG - Intergenic
923122793 1:231009112-231009134 CTGGGAAGTTAGAAGGTGGTGGG + Intergenic
923307227 1:232699267-232699289 ATGGGCAGGGAAAAGGAGGAAGG + Intergenic
923394476 1:233547408-233547430 CAGTGCAGGGAGAAGGTGTCTGG - Intergenic
924453271 1:244198345-244198367 GTGGTCTGGGAGAAGGTGCAGGG + Intergenic
1063223427 10:3992491-3992513 AGGGGAGGGGAGAAGGTGGAGGG - Intergenic
1063578571 10:7284277-7284299 CTGGGCAAGGATGGGGTGGAGGG - Intronic
1063811279 10:9711252-9711274 ATGGACAGGGAAAAGGGGGATGG + Intergenic
1063937025 10:11088753-11088775 CAGGGCACAGAGATGGTGGATGG + Intronic
1064005798 10:11697988-11698010 CTTAGGAGGGAAAAGGTGGAAGG - Intergenic
1064075956 10:12269019-12269041 CTGGGCAGGGTGAAGGCACACGG - Intergenic
1064203377 10:13302421-13302443 CTGGGGCGGGTGCAGGTGGAGGG + Intergenic
1064280684 10:13948591-13948613 CTGAGCAGAGAGCAGGTGGTGGG + Intronic
1064331848 10:14401592-14401614 CTGAGCATGGAGAGGGAGGAGGG - Intronic
1064960472 10:20958318-20958340 GGGGGCAAGGAGAGGGTGGATGG + Intronic
1065328463 10:24570453-24570475 ATGGGCAGGGAGAAGAGGAAAGG + Intergenic
1065567699 10:27031518-27031540 CTAGGATTGGAGAAGGTGGAGGG + Intronic
1065687040 10:28296210-28296232 GTGGGCATGGAAAAGGTGGGTGG - Intronic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1065730819 10:28708056-28708078 GTGGTCAGGGCGAAGGTTGAGGG + Intergenic
1065818998 10:29507871-29507893 CCGGGCAGGGACATGGGGGAGGG + Intronic
1065908175 10:30278122-30278144 GTGGGTAGGGAGAAAGGGGAGGG + Intergenic
1065910190 10:30296510-30296532 CTTGGTAGGGAGAAGGTTGGGGG - Intergenic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1066061831 10:31730916-31730938 CTGGCCAGGGAGAGGTTGCAGGG - Intergenic
1066598498 10:37078147-37078169 AGGGGCAGGGAGAGGGAGGAAGG - Intergenic
1067141610 10:43662248-43662270 CTGGGATGGAAGAAGGTGGGAGG + Intergenic
1067554578 10:47259640-47259662 CTGGGCAGGGCTCAGGGGGACGG + Intergenic
1067835940 10:49641738-49641760 CTGGACTGTGAGAAGGGGGATGG + Intronic
1069821335 10:71230534-71230556 GAGGGCAGAGAGAAGGTGGCTGG - Intronic
1069824068 10:71244586-71244608 CTAGCCGGGGAGCAGGTGGAAGG + Intronic
1070487192 10:76942382-76942404 TTTGGCAGGGAGTAGGTGGAGGG + Intronic
1070697174 10:78572015-78572037 CTGGGCAGGGAGTGGGTGGTGGG + Intergenic
1070825149 10:79386457-79386479 CTCTGCAGAGAGAAGGAGGAAGG + Exonic
1071329577 10:84546419-84546441 CTGGGCAGGGAGATGGCCGATGG + Intergenic
1071923548 10:90378480-90378502 TTGGGGAGGGAGAAACTGGATGG - Intergenic
1071970127 10:90896674-90896696 CTGGTGAGGGAGAAGAAGGAAGG - Intronic
1072108022 10:92291830-92291852 TTGGGGAGGGGGAAGGGGGAGGG - Intronic
1072229068 10:93398227-93398249 CCAGGCAGGGAGAAGGGCGATGG - Intronic
1072897177 10:99376991-99377013 GTGGGGAGGAAGAAGGGGGAGGG - Intronic
1073047134 10:100646150-100646172 GTGGGCTGGGAGTTGGTGGAGGG + Intergenic
1073114430 10:101083324-101083346 CTGGGCAGGCTGTGGGTGGAGGG - Intergenic
1073561159 10:104498246-104498268 CTGGTCAGGGATGAGGTAGATGG + Intergenic
1074046826 10:109847081-109847103 CTGGGCTGGGAGTCGGGGGAGGG + Intergenic
1074765057 10:116694533-116694555 AAGGGGAGGGAGGAGGTGGAGGG - Intronic
1075155916 10:119975629-119975651 CCAGGCTGGGAGAAGATGGAGGG + Intergenic
1075219493 10:120572329-120572351 CAGGGCATGGAGAAGGGGAAGGG - Intronic
1075231735 10:120685703-120685725 GTGGGCAGGGAAGAGGTAGAGGG - Intergenic
1075585434 10:123653789-123653811 AGGGGAAGGGAGAAGGGGGAAGG + Intergenic
1075923334 10:126231550-126231572 CAGGGCAAGGAGAGGATGGAAGG - Intronic
1076082816 10:127598952-127598974 ATTGGCAGGGAGAAGCTGGCTGG + Intergenic
1076093771 10:127713666-127713688 CTGACCAGGGAGCAGGTGGGCGG - Intergenic
1076107339 10:127834257-127834279 CTGGGCAGGAGGAAGCTGGAGGG - Intergenic
1076180293 10:128401827-128401849 CTGGGCATGGAGCAGGAGGAGGG + Intergenic
1076336589 10:129710542-129710564 CTGGGCAGGGGCCAGGTGTATGG + Intronic
1076364787 10:129914799-129914821 GGGTGCAGGGAGAAGGTGGGGGG - Intronic
1076478607 10:130769407-130769429 CTGGGCAGGGTGCAGGTGGCTGG - Intergenic
1076685097 10:132194994-132195016 CTGGTCAAGGAGAAGGGTGAGGG + Exonic
1076717892 10:132375762-132375784 CTGGGCAGGGAGCAGGGGAAAGG - Exonic
1076803148 10:132841827-132841849 CTGGGCAGAGAGCCTGTGGAGGG + Intronic
1076921693 10:133457636-133457658 GAGGGCAGGGAGAAGGGGGGTGG + Intergenic
1077020242 11:414066-414088 GTGGGGAGGGAGAGGGTGCAGGG - Intronic
1077243288 11:1523199-1523221 CTGGGCTCAGAGACGGTGGATGG - Intergenic
1077299986 11:1842319-1842341 CTGGGCACGGGGAGCGTGGAGGG + Intergenic
1077412135 11:2408582-2408604 CTGGGCAGGGACACCCTGGAGGG + Intronic
1077430527 11:2513830-2513852 GTGGGCTGGGAGAGGGAGGAAGG + Intronic
1077888233 11:6401752-6401774 ATGGGCAGGGAGGACGTGGGTGG - Intronic
1078083250 11:8218756-8218778 GGTGGCAGGGAGAAGCTGGAGGG - Intergenic
1078102858 11:8339930-8339952 AGGGGCAGGGAGAAGGTAGGCGG - Intergenic
1078699825 11:13669213-13669235 CTGGGGAGGAAGAAAGTGGTGGG + Intronic
1078780951 11:14438960-14438982 TTGGTCTTGGAGAAGGTGGAAGG + Intergenic
1078982165 11:16548668-16548690 CTGGGCAGGGAGTAGGAGGATGG + Intronic
1079297317 11:19244799-19244821 CTGGGCAGGGTTAAAGAGGATGG + Intergenic
1079641908 11:22816183-22816205 GGGGGCAGGGAGATGGGGGAGGG - Intronic
1080008957 11:27438406-27438428 CTTGGCAGGCAGAAGCTGGGAGG + Intronic
1080425894 11:32154025-32154047 CAGGGCAGGAAGAAGGTCAATGG + Intergenic
1080552246 11:33382809-33382831 CAGGGCAGGGAGAGGGTGCCAGG - Intergenic
1080824281 11:35834865-35834887 GTGAGCAGGGGGAAGGTGGAGGG - Intergenic
1081674404 11:44960208-44960230 GTGGGAAGAGAAAAGGTGGAGGG + Intergenic
1082693542 11:56332429-56332451 CTGGGCACGACGAGGGTGGAGGG - Intergenic
1083262658 11:61531511-61531533 GTGGGCAGGGAGAAGGGGAGAGG + Intronic
1083622142 11:64054506-64054528 CTGAGCAGAGAGAAGATGCAAGG - Intronic
1083622296 11:64055210-64055232 CTGGGCCGGGAGCAGGGTGAGGG + Intronic
1083663001 11:64260477-64260499 CTGGGCAGGGAGGTGGGGCAGGG + Intronic
1083690311 11:64404396-64404418 TTGGGCAGGGAGAAGGTGTTGGG - Intergenic
1083746964 11:64742222-64742244 CTGGGCAAGCAGGAGGTGGGCGG - Intronic
1083853461 11:65380679-65380701 CTAGGCAGTGGGCAGGTGGAGGG - Intronic
1083970879 11:66074165-66074187 CTGGGAAGTGAGAAGAGGGATGG - Intronic
1083989851 11:66240300-66240322 GGGGGCAGAGAGAGGGTGGAGGG + Intronic
1084148064 11:67275477-67275499 TTGGGCAGGAAGAAGGGGAAGGG - Intronic
1084149689 11:67282373-67282395 GTGGGGAGGGAGAGGGTGGGGGG - Intronic
1084407001 11:68979932-68979954 CTTGGCAGGGACGAGGTGGGAGG + Intergenic
1084463241 11:69307838-69307860 CTGAGCTGGGAGAAGGAAGATGG - Intronic
1084659883 11:70540461-70540483 GCGGGCAGGGAGGAGGTGGTAGG - Intronic
1084801233 11:71545587-71545609 CTGGCCAGGGAGTAGGAGAAGGG - Intronic
1084981077 11:72829083-72829105 CTGGTCGGGTGGAAGGTGGAGGG - Intronic
1085250448 11:75140283-75140305 CTGTGGAGGGAGACAGTGGATGG - Intronic
1085449226 11:76622054-76622076 CTGGGCAGGGGGCAGGGGGAGGG + Intergenic
1085514731 11:77105540-77105562 CTGGGCAGGGGGTGGATGGAAGG + Intronic
1086685359 11:89727900-89727922 CTGGGAAGCGGGAAGGGGGATGG + Intergenic
1086768915 11:90736094-90736116 ATGTGCAGGGAGTAGGTGAAGGG - Intergenic
1086920943 11:92585952-92585974 ATGTGAAGGGAGAAGGTGGCTGG + Intronic
1087277137 11:96171849-96171871 CTGAGAATGGAGAAGGTGGCAGG - Intronic
1088311673 11:108467114-108467136 CCGGTCAGCGGGAAGGTGGACGG + Intronic
1088506764 11:110534824-110534846 CTAGGCAGGAAGAAGGAGAAAGG + Intergenic
1088750686 11:112839860-112839882 CCAGGCAGTGAGAAGGTGGGGGG + Intergenic
1088859802 11:113789312-113789334 CTGGTCAGTGAGAAGGTCGGAGG + Intergenic
1089129171 11:116198948-116198970 CTGGGTAGAAAGAAGTTGGAGGG + Intergenic
1089138887 11:116270791-116270813 CTGGGCAGGGCCCGGGTGGATGG + Intergenic
1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG + Intergenic
1089304549 11:117518212-117518234 CTGGACAGGAGGAAGGAGGAGGG + Intronic
1089748488 11:120633713-120633735 CTGAGCAGGGAGAGGCTGGGAGG + Intronic
1089786021 11:120907835-120907857 CTGGGCAAGCAAAAGGTAGAAGG + Intronic
1090095877 11:123741455-123741477 CAGGGCGGGGAGGAGGGGGAGGG - Intronic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090401749 11:126453681-126453703 CTGGGAAGGGAGGAGGCGGAGGG - Intronic
1090482112 11:127078020-127078042 CTGGGCTGGGGGCAGGAGGATGG - Intergenic
1090709481 11:129372951-129372973 CGGGGAAGGGAGAAGTGGGAGGG + Intergenic
1091058196 11:132438561-132438583 GTGGGCAGCAGGAAGGTGGAAGG + Intronic
1091090629 11:132768237-132768259 CTGGGCAGGGTGGAGCTGTAGGG - Intronic
1091321159 11:134652961-134652983 GTGGGAAGGGAGATGGAGGAGGG - Intergenic
1091449676 12:564733-564755 CTGGGCATGCTGAAGGTTGAGGG - Intronic
1091567884 12:1661849-1661871 CGGGGCAGGGAGGAGGCGGGAGG + Intergenic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1093456647 12:19371458-19371480 CTCAGAAGGGAGAGGGTGGAAGG - Intronic
1094084737 12:26577014-26577036 GGGGGAAGGCAGAAGGTGGAAGG - Intronic
1094174786 12:27530287-27530309 CTGGGAAGTGAGAGGGTGGAAGG + Intronic
1094492988 12:30972798-30972820 CTGCGCAGGGGGGAGGTGGGGGG + Intronic
1096216118 12:49798341-49798363 CTGGGCAGAGAGAGGTAGGAGGG - Exonic
1096473597 12:51894983-51895005 CTGAGCAGGTTGGAGGTGGAGGG - Intergenic
1096613090 12:52815931-52815953 CTGGCCAGGGAGAGAGTGAACGG + Intergenic
1096626224 12:52897674-52897696 ATGAGCAGGGAGAAGGGGCATGG - Intronic
1096782874 12:54000979-54001001 CTGGGCTGGGAGGAGGGGGCAGG - Intronic
1096843145 12:54391146-54391168 CGGTGCCGGGAGATGGTGGAGGG + Intronic
1097240962 12:57575003-57575025 ATGGGTAGGTAGAAGGTGGGAGG + Intronic
1099029822 12:77512250-77512272 ATGGGCAGGCACAAGGGGGAAGG + Intergenic
1099323155 12:81177208-81177230 CTGAACAGGGAAAAGCTGGATGG + Intronic
1100379705 12:94049994-94050016 CAGGGCAGGAAGTGGGTGGAGGG + Intergenic
1100670147 12:96802819-96802841 GTGGGTAGGGAGCAGGGGGAGGG - Intronic
1100874291 12:98945976-98945998 AAGGGGATGGAGAAGGTGGATGG - Intronic
1101594226 12:106149471-106149493 CAGGGCAGGGAGAAGGAAGGCGG + Intergenic
1101676085 12:106917846-106917868 CTGGGCAGTGCGGAGGAGGAGGG + Intergenic
1101843621 12:108344701-108344723 CAGGGCAGGGAGAAGGCAGTGGG + Intergenic
1102813190 12:115841705-115841727 GTGGGAAGAGAGAAGGGGGAAGG - Intergenic
1102884114 12:116508737-116508759 CAGGGCAGGGGGAACGGGGAAGG - Intergenic
1102959860 12:117085414-117085436 TCGGGAAGGCAGAAGGTGGAAGG + Intronic
1103361842 12:120359163-120359185 CTGTGCAGGGAGCAGGTTGAAGG - Intronic
1103992702 12:124809919-124809941 CTGGGCTGGGAGGAGGGGGCAGG - Intronic
1104179852 12:126368743-126368765 CTGAGCAGTGAGAAGGTGTGAGG + Intergenic
1104742503 12:131188754-131188776 CTGGGCAGGCAGAAAGGGGTGGG + Intergenic
1104748037 12:131221992-131222014 CAGGGCTGGGGGAAGGTGGAGGG + Intergenic
1104948780 12:132429425-132429447 CTGGGGAGGGAGACGGGCGAGGG - Intergenic
1105014195 12:132776259-132776281 CAGGGCAGGAAGGAGCTGGAGGG - Intronic
1105282907 13:18979499-18979521 CTAGGCAGAGAATAGGTGGAAGG - Intergenic
1105683315 13:22752118-22752140 GGGAGCAGGGAGAAGATGGAGGG - Intergenic
1105974612 13:25462640-25462662 CTGGGAAGGGGAAAGGGGGATGG - Intronic
1106694884 13:32162706-32162728 ATTGGCAGCCAGAAGGTGGAAGG - Intronic
1106781045 13:33059437-33059459 CTAAGGAGGGAGAATGTGGAAGG - Intronic
1107561185 13:41558948-41558970 CTGGCCAGGGATAAGGTGGGAGG - Intergenic
1107645484 13:42490580-42490602 GTGGGGAGGGAGAAGCAGGAAGG + Intergenic
1107713135 13:43170279-43170301 TTGGGCAGAAAGAAAGTGGAGGG + Intergenic
1108116647 13:47135997-47136019 CTGGGCAGGGACAAGGTTACTGG + Intergenic
1108128968 13:47276557-47276579 CAAGGCATGGAGAAGGAGGAAGG + Intergenic
1108171041 13:47742185-47742207 CTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1108266092 13:48710303-48710325 CTGGGCAGGGCAAAGTGGGATGG + Exonic
1108274018 13:48789764-48789786 GAGGGCAGGAAGAAGGAGGAAGG + Intergenic
1108346422 13:49551125-49551147 GGGGGGAGGGAGAAGGGGGAAGG + Intronic
1108474591 13:50801294-50801316 CTGCACTGGGAGCAGGTGGATGG - Intronic
1108606924 13:52048816-52048838 TGGGGTTGGGAGAAGGTGGAAGG + Intronic
1109158862 13:58947340-58947362 CTGGGCAGAGATAAGGAGGGTGG - Intergenic
1109473624 13:62846908-62846930 AGAGGCAGGGAGAAGGAGGATGG - Intergenic
1109716166 13:66225359-66225381 CAAGGCAGAGAGAGGGTGGAGGG - Intergenic
1110289065 13:73783318-73783340 CTGGGAAGGGAGTGGGTAGAGGG + Intronic
1110630218 13:77698280-77698302 CTAGGCAGGCAGAAGGTGCCCGG - Intronic
1110912076 13:80977584-80977606 CTGGGCAGTGAGCCTGTGGAGGG + Intergenic
1111394677 13:87649757-87649779 CTGGGCATAGATAAGGTGGATGG - Intergenic
1112018916 13:95354594-95354616 CAGAGCAGGTAGAATGTGGAAGG - Intergenic
1112524305 13:100129532-100129554 CTGGTCAGGGAGAAGGTGGGAGG - Intronic
1112742638 13:102492585-102492607 TTGGGCAGGGGGAGGGAGGAAGG + Intergenic
1112776979 13:102854976-102854998 CTGGGAAAGGAAGAGGTGGAGGG - Intronic
1113432447 13:110262318-110262340 CTGGGAAGGCTGATGGTGGAGGG - Intronic
1113711203 13:112466664-112466686 CTGTGCATGGAGAAGCTGGGAGG - Intergenic
1113779747 13:112969226-112969248 CTGGGCAGGGAGGCGGCGGCTGG + Exonic
1114194137 14:20462014-20462036 CTGAGCGGGGAGAAAATGGACGG + Intergenic
1114505953 14:23213582-23213604 CTCGGCAGCAAGAAGGTGGTGGG + Intronic
1114531471 14:23399217-23399239 CTGGGCAGAAAGGAGGAGGAAGG - Intronic
1114612894 14:24053821-24053843 GTGGGGAGGGAGGAGGTGGCTGG + Intronic
1115011686 14:28555765-28555787 GTGGGCATGGGGGAGGTGGAAGG + Intergenic
1115176595 14:30569179-30569201 CTGGGGAGAGAGAAGGGGTAGGG - Intronic
1115774704 14:36702533-36702555 TGGGGCAGGGAGATGGTGTAGGG - Intronic
1115977129 14:39009044-39009066 ATGAGCAGCAAGAAGGTGGAAGG + Intergenic
1116078531 14:40143837-40143859 TGGGGCAGGGGGAAGGGGGAGGG + Intergenic
1116439876 14:44939198-44939220 ATGGGCAGTGAGCATGTGGAGGG + Intronic
1116947797 14:50852458-50852480 CTTGGCAGGATGAAGGTGTAGGG - Intergenic
1117062823 14:51980594-51980616 TTAGGCAGGGAGAAAGAGGAAGG + Intergenic
1117496668 14:56312492-56312514 CAGAGCAGGAGGAAGGTGGAGGG + Intergenic
1117580253 14:57144487-57144509 CTGGGAAGGGAGACAGTGGGTGG - Intergenic
1117794518 14:59378240-59378262 TTGGGAAGGGGAAAGGTGGAAGG + Intergenic
1118837147 14:69485280-69485302 CTGGGCCGGGAGAATGGAGATGG + Intronic
1118849760 14:69574323-69574345 CTGGGGATGGAGAAGGTGCCTGG + Intronic
1119326827 14:73764823-73764845 CTGGGGAGGGGGCAGGTGGGAGG - Intronic
1119478137 14:74942829-74942851 TTGGGCAGGGAGCATGGGGAGGG + Intronic
1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG + Intergenic
1119704715 14:76776446-76776468 CTGCGGAGGGAGGAGGTGGGTGG + Intronic
1119736467 14:76985833-76985855 CTGAGCAGGCAGAAGCTGGGAGG + Intergenic
1119758941 14:77138127-77138149 CAGGGTAGGGAGGAAGTGGAAGG + Intronic
1119894378 14:78207307-78207329 GTGCGCAGGAAGAAGGTGGGTGG - Intergenic
1120280463 14:82431747-82431769 ATGGGAAGGCAGAAGGGGGATGG + Intergenic
1120404511 14:84078373-84078395 GGGGTCAGGGAGAAAGTGGAAGG - Intergenic
1120586934 14:86323087-86323109 CTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1120854891 14:89203683-89203705 CTGGGGCTGGACAAGGTGGAGGG + Intronic
1120894070 14:89514155-89514177 GTGGTGAGGGAGAAGGAGGATGG + Intronic
1121021643 14:90583951-90583973 CTGGGCAGAGTGAAGCTGAAAGG - Intronic
1121144716 14:91574003-91574025 CTGGGCAGGGAGGAGGAGGTTGG + Intergenic
1121432867 14:93899860-93899882 CTAGGGAGGGAGAGGGAGGAGGG + Intergenic
1121456698 14:94043095-94043117 GTGAGGAGGGAGAAGGTGGTGGG - Intronic
1121467990 14:94128301-94128323 CTGGGTAGGGAGAAGAGGAAAGG - Intronic
1121527201 14:94627455-94627477 CTGGAAAGGGAACAGGTGGAGGG + Intergenic
1121688589 14:95858104-95858126 GAGAGCAGGGAGAAGGTGGGTGG + Intergenic
1121732379 14:96195448-96195470 CTTGGGAGGGGGAAGGTGCAGGG + Intergenic
1121940100 14:98062491-98062513 ATGGGCAAGGAGAACTTGGAAGG - Intergenic
1122100945 14:99409117-99409139 CTGGGCGAGGAGGAGGTGGAAGG - Intronic
1122148175 14:99706538-99706560 CTGTGCAGAGTGAAGGTGGGTGG - Intronic
1122151522 14:99728552-99728574 CTGGAAATGGAGAGGGTGGAGGG - Intergenic
1122154549 14:99742378-99742400 CTGGGGATGGAGAAGGTACATGG + Intronic
1122322242 14:100862073-100862095 AGGGGGAGGGAGAAGGAGGAAGG - Intergenic
1122366805 14:101199221-101199243 CTGGGCAGGGGGCAGGGGGCAGG + Intergenic
1122388108 14:101362610-101362632 CAGGTCGGGGAGAAGGTGGCCGG - Intergenic
1122476031 14:102009660-102009682 CTGGGCTGGGAGAATGTGGCTGG + Intronic
1122546011 14:102523285-102523307 AGGGGAAGGGAGAAGGAGGAAGG + Intergenic
1122848647 14:104514596-104514618 CTGGGCAGTGAGAAGGCAGGTGG + Intronic
1122888034 14:104719228-104719250 CTGGGCAGGGGTAAGCTGGCAGG + Exonic
1123008010 14:105333682-105333704 TTGGGGAGGGAGGAGGTGGGAGG + Intronic
1124158034 15:27245207-27245229 CTGGGCAGGTAGCAGGTGCCAGG + Intronic
1124387640 15:29223702-29223724 CTGGCCAGGGTGGGGGTGGAGGG + Intronic
1124431818 15:29614735-29614757 CTGGGAAGGTAGAAGGTGGCAGG + Intergenic
1124484763 15:30104155-30104177 CTTGGGTGGGAGAAGGCGGAGGG + Intergenic
1124518819 15:30393083-30393105 CTTGGGTGGGAGAAGGCGGAGGG - Intronic
1124539837 15:30573163-30573185 CTTGGGTGGGAGAAGGCGGAGGG + Intergenic
1124758814 15:32434419-32434441 CTTGGGTGGGAGAAGGCGGAGGG - Intergenic
1125154572 15:36571321-36571343 GTGGGCAGGGAGCACGGGGAGGG - Intergenic
1125202253 15:37110499-37110521 CTGGGCAGGGCCAAGGTGGGAGG - Intergenic
1125421413 15:39508508-39508530 CTGGGCAGGGAGAAAGAGTGAGG - Intergenic
1125728788 15:41881623-41881645 CTGGCCTGGGTGAAAGTGGAGGG + Intronic
1126103306 15:45132693-45132715 CTGGCAAGGGAGAAGTTGTAGGG - Intronic
1126280196 15:46938508-46938530 TTGAGTAGGGAGAAGGTGTAAGG - Intergenic
1126928740 15:53622622-53622644 CTGAGGAGGGAGCAGGGGGAGGG + Intronic
1128230745 15:66033356-66033378 CTGGGCATGGAGCCTGTGGAGGG - Intronic
1128325261 15:66719906-66719928 CTGGGGAGGGGGGTGGTGGAGGG + Intronic
1128674441 15:69598194-69598216 ATGAGAAGGGAGAAAGTGGATGG + Intergenic
1129272848 15:74428582-74428604 CTGGGCAGAAAGGAGGAGGAGGG + Intronic
1129283626 15:74506030-74506052 CAGGGCAGGGAGCAGTGGGACGG - Intergenic
1129384925 15:75191163-75191185 CTGGGCCTGGATAAGGTGGCTGG + Intergenic
1129669078 15:77597171-77597193 CTGAGCAGGGACAGGGTGGGGGG + Intergenic
1129739521 15:77983511-77983533 CTGGGCAGGAAGAAGGAGAGGGG + Intergenic
1129792356 15:78349835-78349857 CTGGGCTGGGGGAGGGGGGAAGG - Intergenic
1129834269 15:78692166-78692188 CTGGACTGGGAGCAGGGGGATGG - Intronic
1130063571 15:80586983-80587005 CTGGGGAGGAAGAGGGTGCATGG - Intronic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130430447 15:83842050-83842072 ATGGGAAGGCAGAAGGGGGATGG - Intronic
1130542724 15:84833484-84833506 CTGGAGAGGTGGAAGGTGGATGG + Intronic
1131133307 15:89913529-89913551 CTGTGCAGGAAGAAGGAGGGAGG - Intergenic
1131296662 15:91155235-91155257 CAGGGGAGGAAGAAGGTGTAAGG + Intronic
1131313252 15:91309792-91309814 TTGGGCAGAGAGAAGTTGGGTGG - Intergenic
1131772757 15:95758047-95758069 GTGGGTAGGGAGAAAGGGGAGGG + Intergenic
1131830742 15:96353087-96353109 CTGGACAGGGAGATGGTGGTTGG + Intergenic
1132097237 15:98996727-98996749 CTGGGCAAGCAGAAGGTAAAGGG - Intronic
1132200679 15:99952632-99952654 ATGGGCTGGGGGCAGGTGGAGGG + Intergenic
1132203108 15:99968675-99968697 CTGGGGCCGGAGAAGATGGATGG - Intergenic
1132482858 16:175251-175273 CAGGGCAGGGAGCAGGCTGAAGG + Intergenic
1132582854 16:693521-693543 TTGGGCAGGGAGAGGGCGGAAGG - Exonic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1132709487 16:1260060-1260082 CAGGGCAGAGAAGAGGTGGAAGG - Intergenic
1132969656 16:2680222-2680244 GTGGGCAGGGAGATGGGGGGAGG - Intergenic
1133043965 16:3075948-3075970 GTGGACAGGGAGATGGGGGAGGG + Intronic
1133061099 16:3175103-3175125 GGGGGCCGGGAGAAGGTGGGAGG - Intergenic
1133103747 16:3494134-3494156 CAGGGGAGGGAGGAGGTTGAGGG + Intronic
1133152759 16:3849278-3849300 CTGGACTTGGAGAAGGGGGAAGG - Intronic
1133301195 16:4783870-4783892 CGGGGCAGGGAGGAGGAGAAGGG - Intronic
1133715414 16:8442703-8442725 CTCGGCAGGTGGAAGGTGGAAGG + Intergenic
1133751518 16:8729716-8729738 CTTGGCAGGGCTAAGGTGGGAGG + Intronic
1133931593 16:10237152-10237174 CTGAGCAGGGAGAATCTGGGAGG - Intergenic
1134031008 16:10992281-10992303 CTGGGCAGGGAGGGGATGCAGGG - Intronic
1134093473 16:11403867-11403889 CCGGGCAGGGAGAAGGGGCCAGG - Intronic
1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG + Intronic
1134414240 16:14029989-14030011 CTGGGCATGGGGAGGGGGGAGGG + Intergenic
1135193255 16:20372591-20372613 CTGGGCAGGAAGAATGGAGAAGG + Intronic
1135524732 16:23205754-23205776 CTGGGGATGGAACAGGTGGATGG - Intronic
1135793647 16:25421485-25421507 CTGGGCAGGGAGAAGGAAGAGGG + Intergenic
1135920023 16:26641541-26641563 CAGGGGAGGGAGATGGAGGATGG - Intergenic
1136112208 16:28070779-28070801 CTGAGGAGGGAGAACGAGGAAGG + Intergenic
1136178517 16:28535111-28535133 CTGGGAAGTGAGATGGGGGAGGG - Intronic
1136294713 16:29295043-29295065 CTGGGCTGTGAGAAAGGGGAGGG - Intergenic
1136402019 16:30024374-30024396 CTGGGAAGGGAGGAGGTGGGGGG - Exonic
1136609201 16:31356029-31356051 CTGAGCAGGGAGAGGATGGATGG - Intronic
1136751268 16:32637941-32637963 CTGGGCAGTGGGTAGGTGAAGGG + Intergenic
1136769728 16:32825715-32825737 GTGGGGTGGGAGAGGGTGGAGGG + Intergenic
1136779176 16:32886228-32886250 GAGGGCAGGGACAAGGTGGGCGG - Intergenic
1136798370 16:33045438-33045460 GTGGGGTGGGAGAGGGTGGAGGG - Intergenic
1136891441 16:33975290-33975312 GAGGGCAGGGACAAGGTGGGCGG + Intergenic
1137387607 16:48055908-48055930 CTGGGAAGTGAGATCGTGGAGGG - Intergenic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1137463475 16:48686894-48686916 CTGGGCAGGGAAGAGGTAGGTGG + Intergenic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1137988625 16:53131006-53131028 CGGGGCAGGGAGGGAGTGGAGGG - Intronic
1138008861 16:53359945-53359967 CTGAGGAGGGAGGAGGTGCAGGG + Intergenic
1138227700 16:55311975-55311997 GTGGGTAGGGAAAAGGGGGAAGG - Intergenic
1138267735 16:55671915-55671937 CTGGGCAGGGACAGGGGGTAAGG - Intronic
1138470752 16:57233889-57233911 CTGGGGAGGAACAAGGTAGAGGG - Intronic
1138678907 16:58671230-58671252 GTGGGCAGGGCGGTGGTGGAAGG - Exonic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139982708 16:70872683-70872705 GTGGGTAGGGAGATGATGGATGG - Intronic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140479221 16:75253475-75253497 CGGTGCAGAGAGGAGGTGGATGG + Intronic
1140748141 16:77999146-77999168 ATGGGCAGCCAGAAGGGGGATGG + Intergenic
1140797688 16:78455261-78455283 CTGGGCTGGGACAAGGACGATGG + Intronic
1141173234 16:81704215-81704237 GGGGGCAGGGAGGAGGGGGAGGG - Intronic
1141173317 16:81704420-81704442 GGGGGCAGGGAGGAGGGGGAGGG - Intronic
1141173361 16:81704518-81704540 GTGGGCAGGGAGGAGGGTGAGGG - Intronic
1141647796 16:85376760-85376782 CTGGGCAGAGAGCAGGGGGCTGG + Intergenic
1141877947 16:86839025-86839047 CCGGGCAGGAGGAAGGAGGAAGG + Intergenic
1142100616 16:88269087-88269109 CTGGGCTGTGAGAAAGGGGAGGG - Intergenic
1142342680 16:89534156-89534178 CTGGGGATGGAGAATGGGGAGGG - Intronic
1203053402 16_KI270728v1_random:897196-897218 CTGGGCAGTGGGTAGGTGAAGGG + Intergenic
1203072145 16_KI270728v1_random:1087820-1087842 GTGGGGTGGGAGAGGGTGGAGGG + Intergenic
1142559307 17:800618-800640 CTGGGCAGAGTGAGCGTGGAGGG - Exonic
1142954297 17:3510773-3510795 CTGGGCAGGGCCCAGGTAGATGG - Intronic
1142995810 17:3759646-3759668 CTGCCCAGGGATAAGGTAGAAGG - Intronic
1143085496 17:4413079-4413101 CAGGGCAGGAGGAAGGAGGACGG - Intergenic
1143174251 17:4947549-4947571 GTGGACAGGGAGATGGTGGTGGG + Intronic
1143360925 17:6370538-6370560 TTGGGCAGAAAGAAGCTGGAAGG + Intergenic
1143544406 17:7588018-7588040 CTGGGGTGGGGGAAGGGGGACGG + Exonic
1143562932 17:7705801-7705823 GTGGGCAGGGAGGAGGCGGGAGG + Intronic
1143755479 17:9064229-9064251 CTGGCCAGGAAGTGGGTGGATGG - Intronic
1143863985 17:9910832-9910854 CTAGGCAGCCAGAGGGTGGAAGG + Intronic
1143941243 17:10544259-10544281 TTGGGGAGGGAGAAAGTGGTAGG - Intronic
1144212225 17:13025429-13025451 CTGTCCAGGGAGAAGGGTGAGGG + Intergenic
1144449479 17:15364297-15364319 AGGGGCAGGGAGAAGGTAGGTGG + Intergenic
1144459386 17:15445948-15445970 GAGGGCAGGGAGGAGATGGAAGG - Intronic
1144816871 17:18040614-18040636 CTGGGGGTGGAGAAGCTGGAAGG - Intronic
1144863080 17:18317953-18317975 CTGAGCAGGGAGTAGATGGCTGG - Exonic
1146169818 17:30624450-30624472 CTGGTCAGTGAGAAGGTCGGAGG + Intergenic
1146266663 17:31457552-31457574 GTGGGGCGGGACAAGGTGGAGGG + Intronic
1146343270 17:32040480-32040502 CTGGTCAGTGAGAAGGTCGGAGG + Intronic
1146533589 17:33631056-33631078 CTGGGTAAGGAGCAAGTGGAAGG + Intronic
1146561107 17:33871425-33871447 ATGAGCAGGGAGAAGGAGGTGGG - Intronic
1146587091 17:34091582-34091604 CAGGGAAGGGAGATGATGGATGG + Intronic
1146654682 17:34628327-34628349 CTTGGCAGGGATACGGTAGAAGG + Intronic
1146908599 17:36633490-36633512 TTGGGCAGGGGGATGGAGGAAGG + Intergenic
1147161027 17:38569481-38569503 CCTGGCAGGGAGGAGTTGGAAGG + Intronic
1147258435 17:39195561-39195583 CTGGGGAGGGAGTAGGGGCATGG + Intronic
1147318385 17:39631917-39631939 CTGGGTAGGGAGAGGCTGGGTGG + Intronic
1147542199 17:41369725-41369747 CTGGGCAGGCAGAAGTTGTAGGG + Exonic
1147545412 17:41397514-41397536 CTGGGCAGGCAGAAGTTGTAGGG + Exonic
1147645976 17:42034165-42034187 CTGGGCAGGGAGAGGGCTGGAGG - Intronic
1147882403 17:43662681-43662703 GGGGGCAGGGAGCAGGTGGGAGG - Intergenic
1148095737 17:45051680-45051702 CGGGGCCGGGAGAGGTTGGACGG + Exonic
1148337676 17:46852150-46852172 CTCCGCAGGGCGAAGGCGGAGGG - Intronic
1148437234 17:47694135-47694157 TTGGGGAGGGAGCAGGCGGAGGG + Intronic
1148445190 17:47733357-47733379 ATGGGCAGGGAGCAGGGGGCGGG - Exonic
1148675282 17:49441359-49441381 CTGGGCTGGGAGAGAGTGGAAGG - Intronic
1148689703 17:49520185-49520207 CAGGGCAGGAAGACTGTGGAGGG - Intergenic
1149217096 17:54370216-54370238 CTGGGGAGTTAGAAGGGGGATGG + Intergenic
1149990148 17:61378611-61378633 CTGGGCAGGGAGAAGGCTGGTGG - Intronic
1150002710 17:61451771-61451793 CTGGGCCGGGACAAGGAGGGCGG + Intergenic
1150216727 17:63475560-63475582 CTGGGCAGGGAGGAGTTGTGAGG + Intergenic
1150380065 17:64713273-64713295 AAGGGGAGGGAGAAGGTCGAGGG + Intergenic
1150458243 17:65325620-65325642 TTGGCCAGGGATAGGGTGGAGGG + Intergenic
1150782681 17:68135537-68135559 CTGGTCAGTGAGAAGGTCGGAGG - Intergenic
1150985846 17:70196225-70196247 ATGGGAAGAGAGAAGGTGGCTGG + Intergenic
1151000350 17:70368907-70368929 CAGGGCAGAGTGAAGGTGGGGGG + Intergenic
1151365352 17:73613224-73613246 CTGGGCAGGGGGCAGGAAGATGG + Intronic
1151382298 17:73734316-73734338 CTGGGCTGGGGGAAGGAGGGGGG - Intergenic
1151436846 17:74102957-74102979 GTGGGCAGGAAGGAGGTGGTAGG - Intergenic
1151446715 17:74170969-74170991 CTGGGAAGGAGGAATGTGGATGG + Intergenic
1151489996 17:74427191-74427213 CTGGGCAGGGAGGGGGATGAGGG + Intronic
1151512517 17:74570012-74570034 CGGGGCAGGGAGAGGCTGCAGGG + Intergenic
1151577338 17:74959347-74959369 GTGGGCAGGGACAAGGTTGAGGG - Intronic
1151678887 17:75613831-75613853 CTGGGCTTGGAGAAGGAGGAGGG - Intergenic
1151723920 17:75874016-75874038 CTGGCCTGGGAGAAGGGGGCTGG - Intergenic
1151975849 17:77483202-77483224 CTGGGCAGGAAGGACGTGCACGG - Intronic
1152002328 17:77654558-77654580 TTGGGCTGGGAGATGGTGGTGGG - Intergenic
1152016912 17:77756852-77756874 ATGGGGAGGGAGGAGGTGGGAGG - Intergenic
1152113403 17:78369914-78369936 CTGGGCAGGGAGAAGCTGCGGGG + Intergenic
1152241868 17:79165154-79165176 CTGTGCAGGAAGATGCTGGAGGG - Intronic
1152318136 17:79592875-79592897 CTGGGCAGGGAGAAGGGGCAGGG - Intergenic
1152386404 17:79977414-79977436 CTGGGAAGGGGCCAGGTGGAGGG - Intronic
1152853102 17:82648836-82648858 CGGGGCGGGGAGGAGGGGGAGGG + Intergenic
1153059637 18:982008-982030 GTGGGGAGAGAGAAAGTGGAAGG - Intergenic
1154978394 18:21481224-21481246 CTGGGCAGGGGGATGGGGGCAGG + Intronic
1155112476 18:22729673-22729695 CTAGGCAGAAAGAAGGAGGAAGG - Intergenic
1155267075 18:24104498-24104520 CTGGGCAGGGATGAGGTGGGTGG - Intronic
1155582971 18:27332569-27332591 ATGGGTGGGGAGAAGGCGGATGG - Intergenic
1156121875 18:33854246-33854268 CTGTGGAGGTAGAGGGTGGAGGG - Intronic
1156194742 18:34761465-34761487 ATGGGTAGGGAAAAGGTGGAAGG + Intronic
1156519614 18:37711119-37711141 CTGGGGTGGGAGATGGGGGATGG + Intergenic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1157293704 18:46427144-46427166 CTGGGGATGGAGATGGTGGAGGG + Intronic
1157327911 18:46682116-46682138 CTGGGGAGGGTGCAGGGGGAGGG + Intronic
1157484395 18:48076643-48076665 ATGGGCAGGGAGCAGGGTGAGGG + Intronic
1157530774 18:48418812-48418834 CTGGGGTGGAAGGAGGTGGATGG - Intergenic
1157597906 18:48875033-48875055 CTGGGCCAGGAGGAGATGGAGGG + Intergenic
1157709892 18:49842990-49843012 CTCAGCAGGGAGGAGCTGGAGGG + Intronic
1157724455 18:49953137-49953159 CTGGGCAGGGAGGAGGCCAACGG - Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158364229 18:56713090-56713112 ATGGGCAGGGAAAATATGGATGG + Intronic
1158641832 18:59210371-59210393 CAAGGCAGGAAGAAGGTAGAAGG + Intergenic
1159258413 18:65978318-65978340 TTTGTCATGGAGAAGGTGGAGGG - Intergenic
1160216780 18:76939514-76939536 GTGGGCAGGGGGAGGCTGGATGG + Intronic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1160322053 18:77905505-77905527 ATGGACAGGTGGAAGGTGGAAGG + Intergenic
1160535524 18:79589551-79589573 CGGGGGAGGGAGAAGGGAGATGG + Intergenic
1160742232 19:692001-692023 CTCTGCAGGGAGGAGGTGGTGGG + Exonic
1161001232 19:1912289-1912311 CTGGGCGGGGAGCGGGTGCAGGG - Exonic
1161085478 19:2333081-2333103 CTGGGAGGGGAGCAGGAGGAGGG + Intronic
1161085516 19:2333202-2333224 CTGGGAGGGGAGCAGGAGGAGGG + Intronic
1161155484 19:2730345-2730367 CTGTGATGGGCGAAGGTGGATGG + Intronic
1161330985 19:3687770-3687792 CCCGGCAGGGAGAAGGGAGAAGG - Intronic
1161335048 19:3708516-3708538 CTGGGCAGGCAGCAGGTGCCAGG - Intronic
1161342441 19:3750708-3750730 CCAGGGAGGGAGAAGGAGGACGG - Exonic
1161370957 19:3910734-3910756 CTGGGGAGGGAGGAGCTGGGTGG - Intronic
1161421641 19:4179131-4179153 CTGGTCAGCCAGAACGTGGACGG - Exonic
1161455323 19:4366972-4366994 CTGGTCAGTGAGAAGGTCGGAGG - Exonic
1162015468 19:7844521-7844543 CTGGGCAGGGAGGGGCTGGGAGG - Intronic
1162042842 19:7980783-7980805 CTGGGCAGGCTGGGGGTGGATGG + Intronic
1162061989 19:8101661-8101683 CTGGGCTGGGATAGGGTGGGAGG - Intronic
1162078533 19:8205209-8205231 CTGGGCAGGGGACAGGTGGCAGG + Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162127640 19:8507933-8507955 GGGGGCAAGGAGAAGGTGGGAGG + Intergenic
1162737522 19:12754816-12754838 CCGGGCAAGGACCAGGTGGAGGG + Intronic
1162767774 19:12930391-12930413 CTGGTCAGGGGGCAGGTGGACGG - Intronic
1162794254 19:13078462-13078484 CTGGGCAAGGAGCAGCAGGAGGG + Intronic
1162933411 19:13968516-13968538 CGGGGCAGGGAGGCGGTGGTTGG + Intronic
1162973199 19:14193477-14193499 CTGGGAAGGCTGAAGGGGGAGGG + Intronic
1163007708 19:14406846-14406868 CTGGGCAGGGAGCAGATTGTGGG - Intronic
1163479157 19:17544463-17544485 CAGTGGAGGGAGGAGGTGGATGG + Intronic
1163493796 19:17632909-17632931 CTGGCCAGGGACAAAGAGGATGG + Intronic
1163611063 19:18301826-18301848 CTGAGCTGGGAGAAGGTCAATGG + Intergenic
1164431824 19:28195542-28195564 GTGGGGAGGGAGAAGGCAGAAGG + Intergenic
1164742273 19:30584580-30584602 ATTGGCAGAGAGAAGCTGGAGGG - Intronic
1165152950 19:33771699-33771721 CTGGCCTGGGAGAGGGTGGCGGG - Intronic
1165407511 19:35639790-35639812 CTGTGCAGTGGGAAGGGGGACGG + Intergenic
1165798930 19:38536043-38536065 CTGGGCATGGTGAATGAGGATGG + Exonic
1165902183 19:39174127-39174149 CTGGGGAGGGAGAAGAGTGAGGG - Intronic
1165904213 19:39183740-39183762 CTGGGGAGGGAGAGGGGTGAGGG + Intergenic
1166046652 19:40234199-40234221 TGGGGCAGAGAGAAGGTGGGAGG - Intronic
1166069945 19:40381173-40381195 CGGGGCATGGAGAAGGGGGCAGG + Intronic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1166690957 19:44821017-44821039 CTGGGCAGGGAGAGGGAAGAGGG - Exonic
1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG + Intronic
1166881112 19:45930690-45930712 CTGGGAAGGGGGAAGGAGGGAGG - Intergenic
1166980907 19:46631568-46631590 CTGGGCAGGAAGGAGCTAGAAGG - Intergenic
1167294149 19:48639668-48639690 CTGGGGGAGGAGAAGGTTGAGGG - Intronic
1167492035 19:49798623-49798645 CTGGGCTGGGAAGAGGTTGAGGG + Intronic
1167668823 19:50838413-50838435 CTGTGCTGGGGGAAGCTGGAGGG + Intergenic
1167715833 19:51142400-51142422 TGGGGGAGGGAGAGGGTGGAAGG + Exonic
1167721037 19:51180653-51180675 GTGGGCAGGGAGCAGGTGAGAGG - Intergenic
1168098916 19:54130653-54130675 CAGGGAGGGGAGGAGGTGGAAGG + Intronic
1168149611 19:54438048-54438070 CTGGGTAGGGAAAATGGGGAGGG + Intergenic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
1168308552 19:55449855-55449877 CTGGGCAGGGGGCTGGTGGGGGG - Intergenic
1168405475 19:56108237-56108259 CTGGGCAGGGGCGAGGTGGAGGG - Intronic
1168405487 19:56108272-56108294 CTGGGCAGGGGCGGGGTGGAGGG - Intronic
1168405514 19:56108341-56108363 CTGGGCAGGGGCGGGGTGGAGGG - Intronic
1168405528 19:56108376-56108398 CTGGGCAGGGGTTGGGTGGAGGG - Intronic
1168405541 19:56108411-56108433 CTGGGCAGGGGCAGGGTGGAGGG - Intronic
925038319 2:709287-709309 CCGGGGAAGAAGAAGGTGGAAGG - Intergenic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925867847 2:8244663-8244685 CTGGGAAGGGAGAGGTTGGTGGG - Intergenic
925886044 2:8394432-8394454 CTGGGCAGGGGGAAGGTGAAGGG - Intergenic
926109729 2:10174111-10174133 CGTGGCAGAGAGAAGGTGGCAGG - Intronic
926228402 2:10984437-10984459 CTGGGCACTGAGAAGGAGGCAGG - Intergenic
926650605 2:15339981-15340003 GGGGGCAGGGAAGAGGTGGAAGG + Intronic
927154320 2:20212875-20212897 CAGGGCAGGGCCAGGGTGGAGGG + Intronic
927177672 2:20421963-20421985 CTGGGCCTGGGGATGGTGGAGGG - Intergenic
927179293 2:20433174-20433196 CTGGGCAAGGAGAATGTTCAGGG - Intergenic
927333744 2:21896343-21896365 CTGGGGAGGGGGAAGGTTGGGGG + Intergenic
927576876 2:24207818-24207840 CTGCAAAGGGAGAGGGTGGATGG + Intronic
927638221 2:24831345-24831367 CTGGGTAGAGAGGAAGTGGAGGG - Intronic
927710810 2:25324740-25324762 CTGGGGATGGATAAGGAGGAGGG + Intronic
927812322 2:26187050-26187072 CTGGGCTGGGGGATGCTGGAAGG + Intronic
927937584 2:27084316-27084338 ATGAACAGGGAGAAGATGGATGG - Intronic
927996934 2:27493479-27493501 CTGAGAAGGGAGAAGGCAGAAGG + Intronic
928123685 2:28602004-28602026 ATGGTGAGGGTGAAGGTGGATGG + Intronic
928158083 2:28894750-28894772 CTGTGCGGGGAGAAGGCGCAAGG - Exonic
928280074 2:29938154-29938176 GAGGGCAGGGGGAAGGGGGAGGG + Intergenic
928361339 2:30664515-30664537 CTGCTAAGGGAGGAGGTGGAAGG + Intergenic
928443383 2:31312063-31312085 CTAGGAAGGGAGGAGATGGAGGG - Intergenic
929055706 2:37874523-37874545 CTGGGCAGTGACAAGCTGGGGGG + Intergenic
929318763 2:40514289-40514311 CTGGGAAGGAAAAAGGTGGAAGG - Intronic
931097470 2:58957453-58957475 CCAGGCAGGAAGAAGGAGGAGGG - Intergenic
931340771 2:61398579-61398601 CGGGGGAGGGAGAAAGGGGAGGG + Intronic
931416467 2:62086055-62086077 CTGGGGAGGGAAAAGGTGTGTGG + Intronic
931427298 2:62182875-62182897 CTGGGAAGGGAAAAGGAGCAGGG - Intergenic
931765595 2:65453269-65453291 CTGGGAAGGAAGAAGGTAGAAGG + Intergenic
931926052 2:67073734-67073756 TTGGGCAGGTGGAAGGAGGAAGG - Intergenic
932366072 2:71154364-71154386 CTGAGGAGGGAGGAGGTGCAGGG - Intergenic
932437467 2:71711087-71711109 CAGGGCAGGGAGAGGGCAGAAGG + Intergenic
932449994 2:71803426-71803448 CTGGGAAGGAAGAAGAGGGAGGG - Intergenic
932592654 2:73076384-73076406 ATGGGGAGGGAGCAGGTGGTGGG - Intronic
932890489 2:75592109-75592131 CTGGTCAAGGAGAAGTTGCAAGG + Intergenic
933422140 2:82062223-82062245 CAGGTGAGGGAGAAGGCGGAAGG - Intergenic
933769469 2:85733978-85734000 CTGGGGTGGGAGATGGTGGCAGG - Intergenic
934503779 2:94877066-94877088 GTGGGGAGGGAGGAGCTGGATGG - Intergenic
934925922 2:98381725-98381747 CTGGGCTGGGGGAAGGAGGCTGG + Intronic
935191465 2:100781920-100781942 CTGGGGAGGGAGAAGGAGAGAGG - Intergenic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935277057 2:101484181-101484203 CTAGGGAAGGAGAAGGGGGAAGG - Intergenic
935292458 2:101621791-101621813 CTGGGCAGGGAGAGGGGTGTGGG + Intergenic
935544531 2:104386880-104386902 CTGGGCAGTGAGGAGGTGGCTGG - Intergenic
935598918 2:104902156-104902178 TTGGGCAAGGAGAAGGTTGCAGG - Intergenic
935745640 2:106188235-106188257 GTGGACAGGGAGAAGGGGAAGGG + Intronic
936516615 2:113185277-113185299 CCAGGCAGGGAGAAGGGGAAAGG - Intronic
936674582 2:114700252-114700274 CAGGGGCAGGAGAAGGTGGAGGG - Intronic
937064228 2:119005229-119005251 CGGGGGAGTGAGCAGGTGGAGGG + Intergenic
937263618 2:120601997-120602019 CTGGGCAGGGGCATGGTGGGTGG - Intergenic
937279444 2:120707325-120707347 CTGGGAGGGGGAAAGGTGGAGGG + Intergenic
937993994 2:127679608-127679630 TAGGGAAGGGAGAAGGTGGGGGG - Intronic
938097968 2:128475614-128475636 CTTGGCAGGGAGCAGGAGGAGGG + Intergenic
938100180 2:128493124-128493146 CTGGGCAGGAGCAGGGTGGACGG - Intergenic
938173137 2:129100816-129100838 CTGGGCAGGGACAAGGGTCATGG - Intergenic
938336844 2:130508682-130508704 CTGGGCTGGGAGGAGGTGGGAGG - Intronic
938352979 2:130611953-130611975 CTGGGCTGGGAGGAGGTGGGAGG + Intronic
938380015 2:130831427-130831449 CCAGGCTGGGAGAAGGTGGAAGG - Intergenic
938969559 2:136419837-136419859 CCAGGCAGGGAGAAGGGAGACGG - Intergenic
938969924 2:136422741-136422763 AGGGGCCTGGAGAAGGTGGAAGG + Intergenic
940008129 2:149028372-149028394 CTGGGCATGGGGAAGGGTGAAGG - Intergenic
940277376 2:151953391-151953413 CAGGGAAGGGAGGAGTTGGAGGG - Intronic
940670157 2:156657699-156657721 CTGTACAGGGAGAAGGAGAAGGG + Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941827605 2:169917312-169917334 CTGGACAGGGTGAAGAAGGAGGG - Intronic
942145155 2:173019430-173019452 CAGGCCAGGGAGGAGGTAGACGG + Intronic
943377925 2:187103709-187103731 CTGGGCAGGTAGGAGTTGGGGGG + Intergenic
943604528 2:189961275-189961297 GAGGGCCAGGAGAAGGTGGAGGG + Intronic
944614611 2:201447789-201447811 CTGGGCAGAGAAAAGGGGAAGGG - Intronic
944635192 2:201669168-201669190 TTGGGCATGGAGAAGGGGAAAGG + Intronic
944897258 2:204177812-204177834 CTGGTGAGGGTGAGGGTGGAGGG + Intergenic
945924255 2:215787753-215787775 CTGGCCACGGAGAAGATGGACGG + Intergenic
946008601 2:216546676-216546698 CTGGGCAGGGTGAGAGTGGGAGG - Intronic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
946258689 2:218467182-218467204 CTGGGCAGGGGGAGGGGGAAGGG - Intronic
946332873 2:219020151-219020173 CTGGGGAGGGTGAATGGGGAGGG - Intronic
946386506 2:219387410-219387432 CTGGGCAGGGACATGGGGGCGGG - Intronic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947407154 2:229790521-229790543 GGGGGCAGGGAGCAGGGGGAGGG + Intronic
947418397 2:229921465-229921487 CTGGGAAGAGAGAAAGTGGGGGG - Intronic
947526197 2:230878162-230878184 CTAAGCAGGGGGAAGGAGGAGGG - Exonic
947592827 2:231395248-231395270 CTGGTCAGGGGAAAGGTGCAGGG + Intergenic
947839290 2:233197471-233197493 CAGGGCAGAGAGATGGTGGGGGG - Intronic
947909705 2:233792953-233792975 CTGGGTAAGGAGCAGATGGAGGG + Intronic
948059102 2:235030627-235030649 CTGAGCTGGGAGGAGGAGGAGGG + Intronic
948073884 2:235149964-235149986 CTTTGCAGGAAGAAGCTGGATGG + Intergenic
948076092 2:235166332-235166354 CTGTCCAGGGAGAGGGTGCAGGG - Intergenic
948214926 2:236221571-236221593 CTGGGGAGGTGGAAGGTGAAAGG - Intronic
948618406 2:239216676-239216698 CAGGGCAGAGTGAAGGCGGAGGG - Intronic
948645026 2:239399398-239399420 CTGGGGAGAGGGAGGGTGGAAGG - Intronic
948800202 2:240430022-240430044 CTGGGGAGGGGGATGGGGGAAGG - Intergenic
948948285 2:241232974-241232996 CTGGGGAGGAAGAAGGGGAAGGG + Intronic
948981133 2:241495420-241495442 CTGGGCCAGGAGAGGGAGGAGGG + Exonic
1168806887 20:676767-676789 CTGGGAAGGGAGAGGGGGGAAGG + Intergenic
1168864934 20:1078287-1078309 GATGGCAGGGAGAAAGTGGAGGG - Intergenic
1168901494 20:1368893-1368915 TTGGGCAGGGTGAAGGAGGGTGG - Intronic
1169009258 20:2236691-2236713 CTGCGCAGGGAGATGGGGGCCGG + Intergenic
1169077460 20:2770037-2770059 CTGGGTAGGGGGTAGGTGGGAGG - Intergenic
1169154238 20:3315890-3315912 CTGGACATGGACATGGTGGAAGG - Intronic
1169214103 20:3783910-3783932 CTGGGAAAGGAGCAGCTGGACGG + Exonic
1169815797 20:9654801-9654823 CAGGGGAGGGAGAAGTTAGAGGG - Intronic
1169912016 20:10654755-10654777 CTGGGCAGGGAGAGGGAGGTGGG + Intronic
1170304566 20:14923807-14923829 CGGGGCGGGGAGGGGGTGGAGGG + Intronic
1170783637 20:19449069-19449091 GTGGGCAGGGAGAGGGAGGCAGG + Intronic
1171190107 20:23152716-23152738 CTGTGCTTGGAGAAGGTGGCTGG - Intergenic
1171284491 20:23925944-23925966 GTGGGGAGGGAGAAGGAGGGAGG - Intergenic
1171326734 20:24300910-24300932 CTGAGCTGGAAGAAGGAGGAGGG + Intergenic
1171388012 20:24783159-24783181 CTGGGCAGGGGGAAGGAGGGAGG - Intergenic
1171953374 20:31440949-31440971 CTGGGCAGGAAGAGGAGGGATGG - Intronic
1172231820 20:33341811-33341833 CCTGGCAGGGAGAAAGTGCAGGG + Intergenic
1172974027 20:38893561-38893583 CTGGGAAGGGAGGAAGTGGGAGG + Intronic
1173479014 20:43384488-43384510 CTGGGCAGGGAAGCGGGGGAAGG - Intergenic
1173665159 20:44757861-44757883 CTGGGCTGGGAGCAGGGGAAGGG - Intronic
1173750286 20:45470574-45470596 CTGGGCTGGGAGGAGGTGGGAGG + Intronic
1173896475 20:46554874-46554896 CAGGGCAGGGAGGAGGAGCATGG - Intergenic
1174315428 20:49696619-49696641 CTGGGCTGGGAGAAAAAGGATGG - Intronic
1174361164 20:50029736-50029758 CAGGGCAGGGGCAAGGTGGGGGG - Intergenic
1174591441 20:51648393-51648415 ATGTGCAGAGAGAAGGTGGAAGG + Intronic
1174863833 20:54116463-54116485 CTGGGGAGGGAGAGGTTGTAGGG + Intergenic
1175011179 20:55738326-55738348 CTCGGAAGGGGGAAGATGGAGGG + Intergenic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1175125832 20:56750829-56750851 CAGGTCAGGGAACAGGTGGAGGG - Intergenic
1175402541 20:58708720-58708742 CTGGGCAGAGGCAAGGAGGAGGG - Intronic
1175423030 20:58847656-58847678 CTTTGCAGGGAGGAGGTGGGTGG - Intronic
1175491571 20:59384007-59384029 GTGAGCGGGGAGGAGGTGGAGGG + Intergenic
1175549178 20:59805628-59805650 GTGGGCAGGGAGAAAGTGCAGGG + Intronic
1175553022 20:59829099-59829121 CTGGGCACGGAGCAGGTGTGAGG + Intronic
1175563522 20:59953859-59953881 CATGGCAGGCAGAAGCTGGAAGG - Intergenic
1175681814 20:60994790-60994812 CTGGGCAGTGGGATGGGGGAGGG - Intergenic
1175903118 20:62367629-62367651 CTGGGCTGGGAGGAGCTGGTGGG - Intergenic
1175998074 20:62820211-62820233 CATGGCAGGGAGAAGGGGGATGG + Intronic
1175998635 20:62822224-62822246 CTGGGGAGGGGGAATGGGGAGGG - Intronic
1176118137 20:63442097-63442119 CGGGACACGGAGCAGGTGGAGGG + Intronic
1176141854 20:63548376-63548398 CTGTCCAGGGAGAGGGTGGGAGG - Intronic
1176200028 20:63855910-63855932 CGGGGAGGGGAGAAGGTGCAGGG + Intergenic
1176239716 20:64070196-64070218 CGGGGCAGGTGGTAGGTGGAGGG + Intronic
1176389183 21:6154907-6154929 CTGGGGAGGGGGAAGGGGGCAGG - Intergenic
1178350784 21:31872287-31872309 CTTGTGAGGGAGAAGGAGGAGGG - Intergenic
1178350865 21:31872747-31872769 CGGGGCGGGGGGAAGGGGGAAGG - Intergenic
1178417088 21:32412723-32412745 CTGGGCAGGGAGGCGGCGGGGGG + Exonic
1179554332 21:42162823-42162845 CTGTGCAGGGATAAGTTGGGGGG + Intergenic
1179734289 21:43383341-43383363 CTGGGGAGGGGGAAGGGGGCAGG + Intergenic
1179884984 21:44309996-44310018 CTGGTTGGGGAGAAGGCGGAGGG + Intronic
1180035318 21:45245404-45245426 CTGGGGATGGAGATGGTGTACGG - Intergenic
1180074033 21:45453691-45453713 GTGGGCAGGGGAAGGGTGGAGGG + Intronic
1180086148 21:45508841-45508863 GTGGACAGGGTGCAGGTGGATGG + Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1181084019 22:20430977-20430999 CCAGGGAGGGAGGAGGTGGAAGG - Intronic
1181392429 22:22593464-22593486 CAGGGCAGGGAGGGGCTGGAAGG + Intergenic
1181429603 22:22870907-22870929 CAGGGCAGGGAGGAGCTGTAAGG + Intronic
1181466628 22:23113935-23113957 CTGGGCAGGGTGTGGCTGGAGGG - Intronic
1181539413 22:23565512-23565534 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1181847057 22:25719305-25719327 CTGGACAGTTAGGAGGTGGAAGG + Intronic
1181855647 22:25779890-25779912 TTGGGCAGGGAGTGGGTGGCAGG + Intronic
1182008485 22:26981045-26981067 CTGGGCAGATAATAGGTGGAAGG + Intergenic
1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG + Intergenic
1182428250 22:30286099-30286121 CTGGGGAGGGAGATGGGTGATGG + Intronic
1182501832 22:30753556-30753578 CTGGCCAGGAAGGTGGTGGATGG + Intronic
1182572587 22:31249825-31249847 CTGGACAGGGGGAAGGGGGAAGG + Intronic
1182662257 22:31933389-31933411 CTGGGCAGAGTGATGGTGGGAGG - Intergenic
1182671127 22:31996896-31996918 CTGGCCAGGGAAGAGGAGGAAGG + Intergenic
1183024286 22:35052426-35052448 CTGGGGATGGGGATGGTGGATGG - Intergenic
1183100936 22:35583614-35583636 CTGGCCTGGGACAAGGAGGAGGG + Intergenic
1183153116 22:36053602-36053624 ATGGGAAGGGAGAAGGGAGAAGG - Intergenic
1183281105 22:36933166-36933188 CTGGGCAGGGAGGGGTTGAAAGG + Intronic
1183350275 22:37331038-37331060 CAGGCCAGGGAGGAGGGGGAAGG - Intergenic
1183350677 22:37333057-37333079 GTGTGCAGGGAGAAGGTCGGGGG - Intergenic
1183369909 22:37426735-37426757 CTGGCCAGGGACAAGGAGGGAGG - Intronic
1183382100 22:37495484-37495506 CTGGGCAGGTAGTGGGTGGGGGG - Intronic
1183408144 22:37640330-37640352 CTGGGCTGGGGGGAGGGGGAGGG - Intronic
1183579494 22:38715424-38715446 CTGGGCCTGCAGAAGGAGGAAGG - Intronic
1183582502 22:38734301-38734323 CTGGGAAGGGACAAGGAGGTAGG - Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183701303 22:39452729-39452751 CTGGGAGGGTAGAGGGTGGAGGG + Intergenic
1183734128 22:39634542-39634564 CTGGGAGGGGAAAAGGTGGAGGG - Intronic
1183948761 22:41341065-41341087 CTGGGCAGGGAGAAGACACAGGG - Intronic
1183971996 22:41484398-41484420 CAGGCCAGGGAGCTGGTGGATGG + Intronic
1183986904 22:41575093-41575115 CTGGCCAGGAGGTAGGTGGAGGG + Exonic
1184198441 22:42947851-42947873 TTGGCCAGGGAGAAGGTGACTGG + Intronic
1184219409 22:43089575-43089597 CTGGGCCCCGAGAGGGTGGACGG - Intergenic
1184234811 22:43177487-43177509 ATGAGCAGGAAAAAGGTGGAAGG + Intronic
1184652596 22:45925962-45925984 CAGGGGAGGGAGGAGGGGGAGGG - Intronic
1184769581 22:46589479-46589501 CTGCCCAGGGAGAAGGTGAGTGG + Intronic
1185100576 22:48838829-48838851 CTGAGCTGGGAGAAGGAGGTGGG + Intronic
1185105968 22:48870055-48870077 CAGGGCAGAGAGAAGGGGAATGG - Intergenic
1185190443 22:49433040-49433062 CCGGGCAGGGAGAGGGCGGATGG - Intronic
1185190470 22:49433130-49433152 CCAGACAGGGAGAGGGTGGATGG - Intronic
1185190491 22:49433211-49433233 CCCGGCAGGGAGAGGGCGGATGG - Intronic
1185190502 22:49433253-49433275 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190518 22:49433334-49433356 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190538 22:49433414-49433436 CCCGGCAGGGAGAGGGCGGATGG - Intronic
1185190549 22:49433456-49433478 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190571 22:49433537-49433559 CCCGGCAGGGAGAGGGCGGATGG - Intronic
949837880 3:8288979-8289001 CTGGGAAGGGAGTAGGTTTAAGG - Intergenic
950105962 3:10388646-10388668 CAGGGCAGGTAGTAGGTGGTGGG - Intronic
950518608 3:13483087-13483109 AAGGGCGGGGGGAAGGTGGAGGG + Intronic
950569591 3:13791897-13791919 CAGGGCACGGAGAAGGGTGAAGG - Intergenic
950796214 3:15512417-15512439 CTGGGCTGGGAGATGGAAGAGGG + Intronic
951080352 3:18444908-18444930 CGGGGGGGGGAGAAGGGGGAGGG + Intronic
951348446 3:21575264-21575286 CTGTGCAGGGTGGAGGTGGGAGG + Intronic
951823446 3:26840505-26840527 CTGGGGAGGAAAAAAGTGGAGGG - Intergenic
952531649 3:34268552-34268574 CAGGGCGGGGGGAATGTGGATGG - Intergenic
953022866 3:39127081-39127103 TTGAGAAGGGAGAAGGTGAAAGG - Intronic
953686982 3:45085714-45085736 TTGGGATGGGAGAAGGTGTACGG + Exonic
954330447 3:49887201-49887223 AAGGGCAGGAACAAGGTGGAGGG + Exonic
954331897 3:49895632-49895654 CTGGGCAGAGAGAGGATGTAGGG + Intronic
954628783 3:52037121-52037143 CTGGGCTGGGGGAAGGTGGGAGG + Intergenic
954691484 3:52397863-52397885 CAGGGCCGGGAGGAGGTGGGTGG + Exonic
954812113 3:53255049-53255071 CTGGGGCGGGAGGAGGCGGAGGG - Intronic
955058304 3:55474862-55474884 GTGGGGAGGTAGAAGGTGGGGGG + Intronic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
957790629 3:84936598-84936620 CTGGGCAGTGAGACTCTGGAAGG - Intergenic
958455478 3:94325913-94325935 CAAGGCAGGAAGAAGGAGGAAGG + Intergenic
958838960 3:99180037-99180059 CTGAGCAGGGAGAAAGGGAAGGG + Intergenic
959061177 3:101617908-101617930 CAGTGAAGGGAGAAGGTGCATGG - Intergenic
959134541 3:102400511-102400533 CTGAGCATGGAGAAGGCAGAGGG - Intronic
960734546 3:120764170-120764192 CAGGGAAGGAAGAAGGTGAAGGG - Intronic
960823355 3:121757718-121757740 CTGGGCAGGAAGCAGTAGGAGGG + Intergenic
960902144 3:122564167-122564189 GTGGGCGGGGAGAAGGGGGACGG - Intronic
960968301 3:123120853-123120875 GTGGGCAGGGAGAGGATGAAGGG - Intronic
961002198 3:123381504-123381526 TTGGTCTGGGAGAAGCTGGATGG + Intronic
961096427 3:124160412-124160434 CTGTGCAGAGAGAAGGGTGATGG + Intronic
961426008 3:126848650-126848672 CTGGGGGTGGAGAAGGTAGAGGG + Intronic
961654158 3:128432488-128432510 CTGGGCAGCGGGAGTGTGGAGGG + Intergenic
961660274 3:128464942-128464964 GAGGGAAGGGAGAAGGGGGAAGG - Intronic
961714195 3:128847568-128847590 CTGGGCAGGGAGGAAGGGGAAGG + Intergenic
962290825 3:134134978-134135000 CTGGGCATGGAGCTGGGGGAGGG - Intronic
962371436 3:134823948-134823970 CTGGGCAGGGGGAGGGCTGATGG - Intronic
962417525 3:135196720-135196742 GTGGGAAAGGAGAAGTTGGAGGG - Intronic
962914830 3:139891539-139891561 CTGGGCAGGTAGAAGGAAGGAGG + Intergenic
963498210 3:146095897-146095919 CTGTGGAGGGAGAGGGGGGAGGG - Intronic
963507613 3:146206720-146206742 CTGGGTAGCCAGTAGGTGGAGGG + Exonic
964150020 3:153512645-153512667 CTGGGAAGGGAAAGAGTGGAAGG - Intergenic
964208088 3:154196778-154196800 CTGGGGAGGGAAACGGGGGAAGG + Intronic
965620562 3:170638699-170638721 CTGGGGTGGGAGATGGAGGATGG - Intronic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
966246404 3:177812814-177812836 CTGGGCAGGGAGGAGGAGCCAGG + Intergenic
966473606 3:180319813-180319835 CTGGGCAAGGAGGAGTGGGAAGG + Intergenic
966509777 3:180748897-180748919 CTGGGCAGGGAGAGGGAAGGAGG + Intronic
966916613 3:184587770-184587792 CTTGGCAGAGAGAAGGAGAAAGG + Intronic
967218496 3:187229741-187229763 CTAGGTAGGGAGAAGGTGGAAGG - Intronic
967293812 3:187946738-187946760 CTGGGCAGAGGGTAGGTTGAAGG + Intergenic
967526190 3:190495948-190495970 CGGGGCAGGGTGGGGGTGGATGG - Intergenic
967808184 3:193733343-193733365 CTGGGTAGGGAGCAGGTGCAGGG + Intergenic
967892315 3:194372127-194372149 CGGGGCTGGGAGAAGATGGAAGG + Intergenic
967963388 3:194942443-194942465 CTGGGCAGTGAGCTGGTGGAGGG - Intergenic
968075884 3:195815992-195816014 CTGCGTAGGGAGAAGGAGGCCGG - Intergenic
968276218 3:197442306-197442328 GTGGGGAGGGAGAAGGCAGATGG + Intergenic
968331320 3:197872958-197872980 CTGGGCAGTGAGAGGGAAGATGG + Intronic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
968614233 4:1570167-1570189 CTGGGTAGGAAGAGGGTGCAAGG + Intergenic
968641994 4:1719684-1719706 CTGGGGAGGGTGCAGCTGGAAGG + Intronic
968881670 4:3303326-3303348 CTAGGCAGGGAGGATGTGGGAGG + Intronic
968969827 4:3788004-3788026 CTGGGCTGGGGTAAGGTGGGTGG + Intergenic
969016631 4:4107784-4107806 TGGGGCAGGGAGGAGGTGCAGGG - Intergenic
969081769 4:4624640-4624662 CTGGGAAGGCAGAAGGTGAAAGG + Intergenic
969568816 4:7996026-7996048 CTGGGCATGAAGGAGGAGGAAGG - Intronic
969593128 4:8133177-8133199 TTGGGAAGGGAGAAGAGGGAAGG - Intronic
969626610 4:8308935-8308957 AGGGGCAGGGAGAAGGAGGGTGG - Intergenic
970007031 4:11421345-11421367 CTGGGTAGGAAGGAGGGGGAGGG - Intronic
970501014 4:16677182-16677204 CTGGGGAGGAAGAAGATGAATGG + Intronic
971219922 4:24695717-24695739 CTGAGCTGGGAGAAGAAGGAGGG + Intergenic
971611288 4:28730359-28730381 CTAGGGAGGGTGTAGGTGGAAGG - Intergenic
971930429 4:33074781-33074803 CTGGGCATTGAGCAGGTTGAGGG - Intergenic
972632704 4:40856209-40856231 CTTGGGTGGGAGAAGGCGGAAGG - Intronic
972805009 4:42520538-42520560 ATGGAGAGCGAGAAGGTGGAGGG + Intronic
973297340 4:48539517-48539539 CGGGGCAGGGGGAGGGTGGGGGG - Intronic
973304697 4:48632856-48632878 CAGGGCAGGAAGAAAGTTGAAGG - Intronic
973652652 4:53012059-53012081 TGGGGCAGGGAGTAGGGGGATGG - Intronic
973731003 4:53822238-53822260 CCAGGCAGGGAGAAGGTTGCAGG + Intronic
973755221 4:54067455-54067477 GTTGGCAGGGCGGAGGTGGAGGG - Intronic
975010110 4:69340272-69340294 CAGAGTAGGGGGAAGGTGGAGGG + Intronic
975021909 4:69501241-69501263 CTGGGCCGGGGGCGGGTGGAAGG + Intronic
975661124 4:76689720-76689742 CTGGGCACGGAGAGGGAGGCGGG + Intronic
976151689 4:82099014-82099036 CAGGGAAGGGTGAAGGTGGTAGG - Intergenic
976465273 4:85360806-85360828 CTGAGCAGGGTGGTGGTGGAAGG + Intergenic
977357215 4:95962054-95962076 GAGGGCAGGAAGAAGGTAGAAGG + Intergenic
977786599 4:101042338-101042360 CAGGGCAGAGGGAAGGTGGGAGG - Intronic
978091844 4:104726741-104726763 TTGAGCAGAGAGAGGGTGGATGG + Intergenic
978417375 4:108490773-108490795 CTGGGGAGGGTGGAGGTGGGTGG + Intergenic
978772758 4:112474735-112474757 CTGGGGTGGGAGGAGGTGGGAGG - Intergenic
979063390 4:116097079-116097101 CTGGGCAGTGTGAAGATGGAGGG - Intergenic
979704238 4:123702098-123702120 CTAGGAAGGGAGAAGATAGAAGG + Intergenic
980103425 4:128564473-128564495 CTTTGCAGGGAGAATGGGGAGGG + Intergenic
980277498 4:130673667-130673689 CTAGGGAGGGAGGAAGTGGAGGG - Intergenic
982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG + Intronic
982370442 4:154627424-154627446 CAGGGGAGGGAGACGGAGGAAGG - Intronic
982644659 4:158008726-158008748 CTCAGGAGGGAGAAGCTGGAAGG - Intergenic
982826663 4:160010981-160011003 CTGGGGATGGAGCAGGTGGTTGG + Intergenic
983192879 4:164773192-164773214 CTTGGTAGGGAGAAGGAGGCTGG + Intergenic
983566898 4:169162939-169162961 CTGGGTAAGGAGAGGATGGAGGG - Intronic
984488828 4:180406439-180406461 ATGGTCAGAGAGAAGGAGGAAGG + Intergenic
984884312 4:184436652-184436674 CTAGGCAGGGAGAAGGTGGCAGG + Intronic
985280313 4:188280018-188280040 CTGGGCAGGAGGAAGCGGGAAGG + Intergenic
985511854 5:317954-317976 CAGGGTTGGGAGTAGGTGGAGGG - Intronic
985913450 5:2900533-2900555 CTGGGGAGGGAGAAAGTGGAGGG - Intergenic
985913510 5:2900766-2900788 CTGGAGAGGATGAAGGTGGAGGG - Intergenic
986639713 5:9860369-9860391 CTGGGGAGGGAGATGAGGGAAGG - Intergenic
986806535 5:11313228-11313250 CTGCTCAGGGAGGAGGAGGAGGG - Intronic
987062812 5:14258660-14258682 CTGGGGAGGTAGAAGGTGAGAGG - Intronic
987252922 5:16118854-16118876 CAGGGCAGTGAAGAGGTGGAAGG + Intronic
987281149 5:16414798-16414820 ATTGGCAGGGAGAAGGTCTAAGG + Intergenic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
988955108 5:36308117-36308139 CTGGGCTTGGAGAAACTGGAAGG + Intergenic
990504126 5:56427794-56427816 CTGGGGTGGGAGAAGGCAGAGGG - Intergenic
991646809 5:68808396-68808418 TTGGGGAGGGAGAAGTTGGGAGG + Intergenic
992071724 5:73154786-73154808 CTGGGAATGGAGAAGGAGGGAGG - Intergenic
992109786 5:73482080-73482102 CTGGGCAATGACAAGGTGGCTGG + Intergenic
992402983 5:76428297-76428319 CTGGGAAGGGAGAAGGAGTAGGG + Intronic
992846787 5:80758003-80758025 ATGGGCAGGGAGAGAGTGAAAGG - Intronic
994713084 5:103289840-103289862 CTGAGAAGGGAGAAGATGGAAGG - Intergenic
995906489 5:117130371-117130393 CTTGGCAGGTGGAAGGTGGGAGG - Intergenic
996449765 5:123607583-123607605 CAGGGCAGGGAAGAGGAGGATGG + Intronic
997376867 5:133403655-133403677 GTGGGCAGGAAGGAAGTGGAAGG + Intronic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
998138546 5:139687315-139687337 CTGTGCAGGAAGAAGGAAGAAGG + Intergenic
998228486 5:140344758-140344780 AAGGGGAGGGAGAAGGTGCAGGG + Intronic
998397016 5:141825242-141825264 CTGAGCAGAGAGAAGTTGCAGGG - Intergenic
998402595 5:141855776-141855798 CTGGGCAGGGAGCTGGGGCAAGG - Intronic
998404501 5:141866472-141866494 CTGGGCAGGGAGAAACATGAGGG + Intronic
999442110 5:151610082-151610104 CTGAGGAGGAGGAAGGTGGAAGG + Intergenic
999459812 5:151748285-151748307 ATGGGCAGGGAGTCGGTGGGAGG + Intronic
999698021 5:154203396-154203418 TTTGGCAGGGATAAGGTTGAGGG - Intronic
1000014872 5:157267269-157267291 ATGGGCAGGGAGACGGAGGCAGG + Intronic
1000348528 5:160334179-160334201 CGAGGCAGTGAAAAGGTGGAGGG - Intronic
1000736947 5:164915413-164915435 TTGGGCAGAGAGTAGGAGGAAGG + Intergenic
1001085114 5:168694932-168694954 CTGTGCTGGGAGAAAGTGCATGG - Intronic
1001680748 5:173555309-173555331 CTGGGCAGGGAGACAGAGGGAGG - Intergenic
1002098285 5:176844850-176844872 CTGGGCAGGGAGTCTGTGGCTGG - Intronic
1002290059 5:178194292-178194314 CTGTGCAGGGAGAAGGGAGGTGG + Intergenic
1002293066 5:178212754-178212776 CTGGGCTGTCAGGAGGTGGAAGG - Intronic
1002568447 5:180127287-180127309 CTGGGCAGGGAGGAGGGTGGAGG - Intronic
1002958234 6:1889460-1889482 CTGTCCAGGGAGAATGTGGAGGG - Intronic
1003075020 6:2975999-2976021 CTGGGCAGGGAGACCTAGGAAGG + Intergenic
1003321611 6:5057327-5057349 GTGGGCAGGGAGGAGAGGGAAGG - Intergenic
1003409339 6:5849538-5849560 CTCAGCAGGCAGGAGGTGGAAGG + Intergenic
1003426246 6:6000038-6000060 CTGGGGAGGGAGAAACAGGAGGG - Intronic
1003665931 6:8111421-8111443 GTGGGCAGGGCAAGGGTGGATGG - Intergenic
1003922448 6:10846086-10846108 CAGGGCAGGTAGATGCTGGACGG - Intronic
1004253795 6:14044336-14044358 CTGTCCAGGGAGAAGCTGGGAGG - Intergenic
1004885749 6:20050182-20050204 CTGGACTGGGAGAAGGTTGGAGG - Intergenic
1005492971 6:26363719-26363741 TTGGGGAGGGGGAAGGGGGAGGG + Intergenic
1005582534 6:27248323-27248345 CTGGACAGGGACAAGGGGGTAGG - Intronic
1005805573 6:29471424-29471446 ATGGGCAGGAAGAGGGAGGAGGG + Intergenic
1006058788 6:31404406-31404428 ATGGGCAGGGAGGAGGTGAGAGG - Intronic
1006071276 6:31499291-31499313 ATGGGCAGGGAGGAGGTGAGAGG - Intronic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006283838 6:33078168-33078190 CTGGGCAGTGAAAGGGAGGACGG + Intronic
1006288181 6:33113910-33113932 GTGGGCAGTGAACAGGTGGACGG + Intergenic
1006303329 6:33205377-33205399 CTGGGGAGGGAGTTGGAGGAGGG + Intronic
1006613516 6:35310054-35310076 CCGGGCAGGGATTCGGTGGAAGG - Intronic
1006642060 6:35494666-35494688 CTGGGCGGGGAGGAGGAGGAGGG + Intronic
1006984063 6:38166241-38166263 GTGCGCAGGGGGGAGGTGGAGGG - Intergenic
1006984156 6:38166548-38166570 GTGCGGAGGGGGAAGGTGGAGGG - Intergenic
1007248942 6:40482714-40482736 ATGGGCAGGGCGAGGGCGGAGGG - Intronic
1007290655 6:40783638-40783660 CAGGGCAGGGTGGAGGAGGATGG + Intergenic
1007315340 6:40983780-40983802 CTGGGATGGGGGCAGGTGGAAGG - Intergenic
1007339891 6:41184570-41184592 TGGGGTAGGGAGAAGGGGGAGGG + Intergenic
1007407849 6:41645081-41645103 TTGGGGAGGGGGCAGGTGGAAGG + Intronic
1007756354 6:44102160-44102182 GTGGGCAGGAAGAAGCTGGGTGG - Intergenic
1007772516 6:44202810-44202832 TTGGGCAGGGAGGTGGGGGAGGG - Intergenic
1008415699 6:51237453-51237475 CAGGGAAGGGAGAAGGTGGGAGG + Intergenic
1009001562 6:57723092-57723114 CTGGGGAGGAAGAAGATAGATGG + Intergenic
1009918762 6:70030177-70030199 ATGGGCAGGGAGGAGGGGAAGGG - Intronic
1009999045 6:70929198-70929220 CAGGGTAGGGAGAGGGGGGAGGG + Intronic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1012644009 6:101657202-101657224 CTGGGCAGAGACCTGGTGGAAGG + Intronic
1013062608 6:106651070-106651092 CAGGGCTGGGAGAGGGTTGAAGG - Intronic
1013117175 6:107112470-107112492 CTGGGCATGGAGAAGGTAGGCGG + Intronic
1013150279 6:107439123-107439145 CTGTACAGGAAGAAAGTGGAGGG - Intronic
1013273161 6:108560789-108560811 CGGGGCGGGGAGAAGGGGGAGGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013589172 6:111605842-111605864 CTGGGCCCGGAGAAGGTGGAGGG - Exonic
1013851697 6:114523710-114523732 ATGGAATGGGAGAAGGTGGAAGG + Intergenic
1014214504 6:118739309-118739331 CAGGGCAGAGAGACAGTGGAGGG + Intergenic
1014715558 6:124861048-124861070 CTGAGAAGGGACAAGGAGGAAGG - Intergenic
1014737986 6:125117336-125117358 CTGTGCAGTGAGATGGTTGATGG - Intergenic
1016097935 6:140061042-140061064 CAGGTCAGGGAAGAGGTGGATGG - Intergenic
1017165750 6:151407043-151407065 CTTGGCAGGGATGAGGTGGGAGG + Intronic
1017250494 6:152275003-152275025 CTGGGATGGGAGAAGCTGGGAGG - Intronic
1017506684 6:155074929-155074951 CTGGGGAGTCAGAGGGTGGAGGG + Intronic
1017515798 6:155154736-155154758 CTGGGGAGGGAGGAGGTGGTTGG + Intronic
1017658275 6:156650240-156650262 CAGGACACGGAGAAGCTGGAGGG - Intergenic
1017701763 6:157080759-157080781 ATGGGCAGAGAGACAGTGGAAGG + Intronic
1017873354 6:158504008-158504030 CGGGCCAGTGAGAAGGAGGACGG + Exonic
1017931518 6:158959464-158959486 CTGGGGAGGGAGTCTGTGGAAGG + Intergenic
1018676197 6:166224168-166224190 CCGGGCGGGGAGGAGGTGCAGGG + Intergenic
1018856399 6:167678406-167678428 CTGGGCTGGGAGACGCTGCAAGG + Intergenic
1018939890 6:168302038-168302060 CTGGGCAGTGAGGAGCTGGATGG - Intronic
1019057826 6:169235878-169235900 TGGGGGAGGGAGAATGTGGATGG - Intronic
1019153801 6:170025753-170025775 ATGGGGAGGGAGCATGTGGACGG + Intergenic
1019174652 6:170154003-170154025 CTGGGCTGGGAGGAGGGAGAGGG - Intergenic
1019192287 6:170259342-170259364 CAGGGCAGGGAGGAGGTGCCAGG - Intergenic
1019354217 7:570513-570535 CTGGGCAGGCAGTGGGGGGACGG - Intronic
1019540134 7:1547618-1547640 CTGGGCAGGGAGACGGGCAAAGG - Intronic
1019557722 7:1641005-1641027 CTGGGAAGAGAGGAGGTGGAGGG - Intergenic
1019738084 7:2660253-2660275 CTGGGCAGGGGGAGCCTGGAAGG - Intronic
1020208539 7:6139699-6139721 CAGGGCAGGGAGAATGCAGAGGG - Intronic
1021758770 7:23882629-23882651 CAGAGCAGGAGGAAGGTGGAGGG + Intergenic
1021763261 7:23921862-23921884 GTGGATAGGGAGAAAGTGGAGGG + Intergenic
1022490378 7:30813058-30813080 CTGGGGAGGGAGACGATGGTGGG + Intronic
1022846073 7:34211165-34211187 CTGACCAGGGAAAAGGAGGAAGG - Intergenic
1022923511 7:35038004-35038026 CGGGGCAGGGAGAAGGCGCCCGG + Exonic
1023151841 7:37208824-37208846 CTGGCCTGGGAGAAGTTGCAGGG + Intronic
1023275865 7:38518000-38518022 CTGGGCAGTGAGCCTGTGGAGGG - Intronic
1023365357 7:39458189-39458211 CTGAGCAGGGAGCAGGTTGGAGG + Intronic
1023416039 7:39933572-39933594 CTGGGCAGGGTGGTGGTGGTGGG + Intergenic
1023624404 7:42101827-42101849 GTGGGGTGGGAGAGGGTGGAGGG - Intronic
1023829359 7:44029815-44029837 ACGGGGAGGGAGAAGGTGGAAGG - Intergenic
1023991244 7:45130084-45130106 CTGGCCAGGCAGAGGGTGGCTGG - Intergenic
1024178472 7:46864085-46864107 CAGGGCACAGTGAAGGTGGAGGG - Intergenic
1026006062 7:66601246-66601268 CTGAACAGGGAGATGGTTGAGGG - Intergenic
1026070992 7:67119476-67119498 CTCAGAAGGGAGAAGGTGGTGGG - Intronic
1026185786 7:68081864-68081886 CTGTGAAGAGAGAAGGTGGTGGG + Intergenic
1026255478 7:68707596-68707618 CTGGACAGGCAGGTGGTGGAGGG - Intergenic
1026311775 7:69192054-69192076 CTGGGGAGGGAGGAGCTGCAGGG + Intergenic
1026479339 7:70764825-70764847 TTGGGCAGGGAGAGGGGGAACGG - Exonic
1026523336 7:71134392-71134414 AGGGGCAGGGAGAAGGAGGATGG + Intronic
1026734702 7:72942256-72942278 GTGGGGAGGGAGGAGCTGGAGGG - Exonic
1026785036 7:73297168-73297190 GTGGGGAGGGAGGAGCTGGAGGG - Intergenic
1026968545 7:74454592-74454614 CCAGACCGGGAGAAGGTGGAGGG - Intronic
1027109043 7:75422762-75422784 GTGGGGAGGGAGGAGCTGGAGGG + Exonic
1027397147 7:77767780-77767802 AGGGGGAGGGAGAAGGGGGAGGG - Intronic
1027994944 7:85413931-85413953 CAGGGCAGGCAGAATCTGGAGGG - Intergenic
1029148484 7:98463569-98463591 TTGGGGAGGGGGCAGGTGGAGGG + Intergenic
1029252474 7:99246781-99246803 GTGGGCATGGAGCAAGTGGAGGG + Intergenic
1029412850 7:100426865-100426887 CAGGGAAGGGAGGAGGGGGAGGG - Intronic
1029651024 7:101891692-101891714 CTGGCCAGGGAGAATAGGGAAGG + Intronic
1029662636 7:101973104-101973126 CTGGGCAAGGATACCGTGGATGG - Intronic
1029694671 7:102204927-102204949 CCGGGCCGGGAGCAGGTGAAAGG - Intronic
1029739665 7:102484073-102484095 ACGGGGAGGGAGAAGGTGGAAGG - Intronic
1029750093 7:102538370-102538392 TGGGCCAGGGAGGAGGTGGAGGG + Intronic
1029757666 7:102583252-102583274 ACGGGGAGGGAGAAGGTGGAAGG - Intronic
1029768044 7:102637478-102637500 TGGGCCAGGGAGGAGGTGGAGGG + Exonic
1029775602 7:102682313-102682335 ACGGGGAGGGAGAAGGTGGAAGG - Intergenic
1030338166 7:108347873-108347895 CAGGGCAGGGCTAAGGTGGAGGG - Intronic
1030679162 7:112416018-112416040 TTGTGCAGAGAGAAGGTGTATGG + Intergenic
1030865652 7:114699057-114699079 TGGTGAAGGGAGAAGGTGGAAGG - Intergenic
1031374241 7:121004603-121004625 CTGGGCAGGATGGAGGTGGGAGG + Intronic
1031719168 7:125148478-125148500 TTGGGCAGGGAGGAGGATGATGG + Intergenic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1032240097 7:130153601-130153623 CCAGGCAGGGAGAGGGAGGAAGG - Intergenic
1032529329 7:132607314-132607336 CAGGAGGGGGAGAAGGTGGAAGG - Intronic
1033116788 7:138632574-138632596 TGGGGGATGGAGAAGGTGGAGGG + Intronic
1033131679 7:138750674-138750696 CTGGCCGGGGAGCAGGTGAAGGG - Intronic
1033356269 7:140602528-140602550 TTGTGCAGGGTCAAGGTGGAAGG - Exonic
1034437133 7:151068067-151068089 CTGGCCAGGCGGGAGGTGGAGGG - Intronic
1034471806 7:151258744-151258766 CAGGGCAGAGAGAAGGTGGCGGG - Intronic
1034537315 7:151733650-151733672 CTGAGCAGGGAGAGGAGGGATGG - Intronic
1034895780 7:154875579-154875601 CCCCGCAGGGAGAAGGTGGGAGG + Intronic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1035238066 7:157512914-157512936 GTGGGGTGGGAGAAGGAGGAGGG + Intergenic
1035373522 7:158393857-158393879 CTGGGGAGGGAGGTGATGGAAGG - Intronic
1035389716 7:158496675-158496697 CAGGGAAGGGGGAAGGGGGAAGG - Intronic
1035581208 8:739867-739889 CTGGGCGGGGAGGCCGTGGAGGG + Intergenic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1036008943 8:4698710-4698732 GAAGGAAGGGAGAAGGTGGAAGG - Intronic
1036101859 8:5795690-5795712 ATGGGGAGAGAGAAGGGGGATGG - Intergenic
1036181360 8:6588194-6588216 CTGGACTAGGAGAAGGTGGAGGG - Intronic
1036259427 8:7228362-7228384 CGGGGCGGGGAGGAGGTGCAGGG - Intergenic
1036310420 8:7680814-7680836 CGGGGCGGGGAGGAGGTGCAGGG - Intergenic
1036311469 8:7686932-7686954 CGGGGCGGGGAGGAGGTGCAGGG - Intergenic
1036463493 8:8974735-8974757 TTGGGGAGGGTGAAGGGGGAGGG - Intergenic
1036621229 8:10425433-10425455 CTGCGAAGGGAGGAGGAGGAGGG + Intronic
1037712391 8:21365307-21365329 CTTGGAAGGGTGGAGGTGGATGG - Intergenic
1038115785 8:24553733-24553755 ATGTGCAGGCTGAAGGTGGAAGG - Intergenic
1038486519 8:27939237-27939259 ATGAGCAGGGAGAAGGGGCATGG - Intronic
1038680331 8:29661203-29661225 CTAGGCAGGGAGGCGGTGGGTGG + Intergenic
1039566889 8:38558249-38558271 CGGGTCAGGGAGGGGGTGGAGGG + Intergenic
1041016599 8:53597779-53597801 CTAGGAAGTGAGAAGGAGGAGGG - Intergenic
1041374022 8:57193747-57193769 TTGGGCAGGGGGAAGGGCGAGGG + Intergenic
1041384167 8:57280499-57280521 CTGGGCTGGGGGAAGGGCGAGGG + Intergenic
1042224375 8:66504125-66504147 GTGGGGAGGGAGAATGGGGAGGG - Intronic
1042810992 8:72824779-72824801 CTGGGAAGAGAGAGAGTGGATGG + Intronic
1042816904 8:72887826-72887848 CTGGGCAGAGAGAAAGTGTAGGG - Intronic
1042840259 8:73116616-73116638 ATGGGCAGGAAGGAGGTGGGAGG + Intronic
1043854194 8:85245772-85245794 CTGAGCAGCGAGAAAGAGGAGGG - Exonic
1044700570 8:94962152-94962174 CTGGGCAGGAAGAAGTAGAAAGG - Intronic
1045010160 8:97951815-97951837 CGGGGAAGGGAAAAGGAGGAAGG - Intronic
1045036175 8:98178221-98178243 ATGGGCAGGGGAAGGGTGGAAGG - Intergenic
1045039868 8:98213201-98213223 CTGGGGAGGTTGAAGGAGGAGGG - Intronic
1045342240 8:101265407-101265429 CTGGGTAGGGGGAAGCTAGATGG + Intergenic
1045402785 8:101835342-101835364 CTGGTTTGGCAGAAGGTGGAGGG - Intronic
1045920407 8:107522270-107522292 CTGTTCAGGGAGAGGGTGGAAGG + Intergenic
1046174683 8:110560050-110560072 ATGGGGAGCCAGAAGGTGGAGGG + Intergenic
1046823283 8:118659125-118659147 CAGGGCATGAAGTAGGTGGATGG - Intergenic
1047181553 8:122593584-122593606 CTGTGCTGGGAGAAGGTTTATGG - Intergenic
1047497883 8:125421453-125421475 CTTAGCAGGGAGAAGAAGGAAGG - Intergenic
1047966927 8:130051829-130051851 CAGGGCAAGAAGAGGGTGGAGGG - Intergenic
1048041111 8:130729570-130729592 CTGGGGAGGGTAATGGTGGAGGG + Intergenic
1048045647 8:130770304-130770326 CTGGGGAGGGAGAAGGCAGGAGG + Intergenic
1048288058 8:133157864-133157886 GTGTTCTGGGAGAAGGTGGATGG - Intergenic
1048288285 8:133159722-133159744 CAGGGGAGGGACCAGGTGGATGG + Intergenic
1048496511 8:134940277-134940299 CAGGGCAGGGGGCAGGTGGGGGG + Intergenic
1048750529 8:137668616-137668638 CTGGGAACTGAGAAGGTTGAAGG + Intergenic
1048927603 8:139284624-139284646 GTGGGCAGGGGGAAGGTTGACGG - Intergenic
1048986553 8:139738027-139738049 CTGGCTTGGGAGAAGCTGGAAGG - Intronic
1049083131 8:140457910-140457932 ATGGGGAGGGAGGAGGAGGAGGG + Intronic
1049254708 8:141607655-141607677 CTGCCCAGTGAGAAGGAGGAAGG - Intergenic
1049365240 8:142233897-142233919 CTGTGCAGGGGGAAGCTGGGAGG - Intronic
1049377030 8:142294153-142294175 GTGGCCAGAGGGAAGGTGGAGGG + Intronic
1049418983 8:142508541-142508563 CTGCTCAGGGAGAGGGTGGAAGG + Intronic
1049526547 8:143129752-143129774 CAGGGCTGGGGGAAGGAGGAGGG + Intergenic
1049770256 8:144376817-144376839 CTGGGTAGGCAGCAGGTGGATGG + Intronic
1050236562 9:3587271-3587293 CAGGGGAGGGAGCTGGTGGAAGG + Intergenic
1050684363 9:8150580-8150602 ATGGGGGGGGACAAGGTGGAAGG + Intergenic
1051299769 9:15636196-15636218 CTGGGTATGGAGTAGGTAGATGG + Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051602507 9:18889475-18889497 CAGGGCAGGGAGAAGGTGACAGG - Intronic
1052812148 9:33070866-33070888 CTGGGAAGGGTGGAGGTGGCGGG + Intronic
1053141503 9:35685398-35685420 CTGGGCAGCGAGCAGGCAGAGGG + Intronic
1053451934 9:38200985-38201007 CTGAGCAGGGAGAACCTTGAAGG - Intergenic
1055131940 9:72785709-72785731 CTGGGCAGGGTGAAGTGGGAAGG + Intronic
1055185291 9:73444556-73444578 CTGGGGATTGAGAAGGTGTATGG + Intergenic
1055791660 9:79929067-79929089 CTGGGCATGAAGAAGGAGGTGGG - Intergenic
1056019851 9:82430381-82430403 TTGGTGTGGGAGAAGGTGGAGGG + Intergenic
1057204660 9:93164087-93164109 GTGTCCAGGGAGAAGCTGGATGG - Intergenic
1057210660 9:93199338-93199360 CTGGGCAGGGCTAAGGTAGGAGG - Intronic
1057761772 9:97880523-97880545 CTTGGCAGGCAGAAGTGGGAAGG - Intergenic
1058164848 9:101607550-101607572 GTGAGCAGGGAGAAGGAGGAGGG + Intronic
1058201500 9:102047651-102047673 CAGGGGAGGGACAAGGTGGGAGG + Intergenic
1058723643 9:107781950-107781972 ATGGGCAGGGAGGTGGTGGAAGG - Intergenic
1059322938 9:113483364-113483386 GTGGGCAGTGAGTATGTGGATGG + Intronic
1059448692 9:114356494-114356516 AAGGGAAGGGAGAAGGCGGAGGG - Intronic
1060036640 9:120261534-120261556 CTGGAGAGGGAGAAGGCAGAGGG + Intergenic
1060258531 9:122053622-122053644 CTAGGCTGGGAGAAAGGGGAGGG + Intronic
1060389443 9:123267010-123267032 TTGGGGAGGAGGAAGGTGGAGGG - Intronic
1060405080 9:123368966-123368988 CTGGGCAGGGGGAGGTTGGTGGG + Intronic
1060407766 9:123381340-123381362 CTGGGCAGAGAGAGAGTGGCGGG + Exonic
1060795765 9:126511667-126511689 TTGGGCAGGGAGAAGTTGTTTGG + Intergenic
1060821244 9:126662658-126662680 CTGGGCTGGGAGCCGGTGGGCGG + Intronic
1060839410 9:126782020-126782042 CTGAGCAGGGAGAGAGAGGAGGG + Intergenic
1061275555 9:129568018-129568040 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1061539212 9:131268494-131268516 GTTGGCAGGGAGAAGGTGTCTGG - Intronic
1061656233 9:132092563-132092585 TTGAGCTGGGAGATGGTGGATGG + Intergenic
1061656790 9:132098047-132098069 GAGGAAAGGGAGAAGGTGGATGG + Intergenic
1061657488 9:132104238-132104260 CTGGGGAGGGTGAGGGTAGAGGG - Intergenic
1061908682 9:133711711-133711733 CTGGGGAGGCAGTAGGTGGGTGG - Intronic
1061912974 9:133734703-133734725 CCGGGCAGGGAGGATGGGGAGGG + Intronic
1062030103 9:134358366-134358388 CTGGGTAGGGTGGAGCTGGAGGG + Intronic
1062215299 9:135385890-135385912 GTGGGCACGGGGAGGGTGGAGGG - Intergenic
1062239128 9:135526470-135526492 CAGGGCAGGGGGAAGGCGGGGGG - Exonic
1062469637 9:136696878-136696900 GAGGGCAGGGAGGAGGGGGAGGG - Intergenic
1062686613 9:137816967-137816989 CAGGGCTGGGGGAAGGTGGTTGG - Intronic
1186096823 X:6111317-6111339 GTTGGAAGGGACAAGGTGGAAGG - Intronic
1186349197 X:8726459-8726481 ATGCCCAGGGAGAAAGTGGATGG - Intronic
1186355430 X:8784429-8784451 GTCGGCAGGGAGGAGGCGGAGGG + Intergenic
1186506589 X:10098306-10098328 CTGGGGAGGGGGGAGGGGGAAGG - Intronic
1186844580 X:13517962-13517984 CTGGGTATGGAGAAAGTGGAAGG - Intergenic
1187380613 X:18798560-18798582 GTGGACAGGGAGCAGGAGGAAGG + Intronic
1187715388 X:22097455-22097477 CAGAGCAGGAAGAAGGTGAAAGG + Intronic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1187950585 X:24466209-24466231 CCGGACAGGGAGAATGTGGGTGG - Intronic
1188450718 X:30306259-30306281 TTGGGTGGGGAGAAGGTGGAGGG - Intronic
1188483274 X:30655387-30655409 CCAGGCAGGTAGAAGGGGGAAGG + Intronic
1188878917 X:35468288-35468310 CTGTGGAGGAAGAAGGTGCAAGG + Intergenic
1189113564 X:38320291-38320313 AGGGGCAGGGGGAAGGTGGTAGG + Intronic
1189466820 X:41283911-41283933 CTGGTCAGGGAGAGTGTGCATGG - Intergenic
1189752234 X:44234072-44234094 CTGGTGAGGGAAAATGTGGAAGG - Intronic
1190123188 X:47680426-47680448 TGGGGCAGAGAGAAAGTGGAAGG + Intergenic
1190123410 X:47682737-47682759 AGGAGAAGGGAGAAGGTGGATGG - Intergenic
1190246069 X:48691213-48691235 GTGGGCACAGAGCAGGTGGAGGG - Exonic
1190550241 X:51572242-51572264 CGGGGCAGGGAGTTGGGGGAGGG + Intergenic
1190631293 X:52389432-52389454 ATGGGGAGCTAGAAGGTGGAGGG + Intergenic
1190885760 X:54530034-54530056 CGGAGGAGGGAGAAGGAGGACGG - Intergenic
1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG + Intergenic
1192214822 X:69150783-69150805 CTTGGCAGGGAGCAGGCGGCAGG + Intergenic
1192677665 X:73215238-73215260 CTGGGGAGGGGAGAGGTGGATGG + Intergenic
1193855091 X:86590955-86590977 CGGGGAAGGGGGAAGGGGGAGGG - Intronic
1194391013 X:93318068-93318090 CTAGGAAAGGAGAAAGTGGAAGG + Intergenic
1194847157 X:98824558-98824580 CTGGGCAGTTAAAGGGTGGAGGG + Intergenic
1195244177 X:102980815-102980837 CTGGGCAGGGAGAAGGCAACTGG - Intergenic
1195275327 X:103275796-103275818 GTGGGGAGGGAGGAGGTGGCAGG - Intronic
1195421968 X:104685619-104685641 CTGGGGTGGGGGAAGGGGGAAGG + Intronic
1195867598 X:109450033-109450055 GTGGGCAGAGAGAGGGAGGAAGG + Intronic
1195923093 X:110002356-110002378 CAGGCCAGGGAGGAGGCGGAAGG + Intergenic
1195966378 X:110433475-110433497 AAGGGCAGGGAGATGGGGGAAGG + Intronic
1196029958 X:111086110-111086132 CTGGGCAGGGGGGCGGTGGGGGG + Intronic
1196481327 X:116153240-116153262 CTTGGCAGGGTAATGGTGGATGG + Intergenic
1197239992 X:124113894-124113916 CTGGACAGGCTGAATGTGGAAGG - Intronic
1198250984 X:134879020-134879042 CTTGGCAGGGATATTGTGGAGGG - Intergenic
1198676995 X:139141637-139141659 CTGGGATGGAAGAATGTGGAGGG - Intronic
1199482087 X:148308937-148308959 CCGGGCAGGGAGAAGGTTGTGGG + Intergenic
1199651346 X:149947923-149947945 CTGGGAAGGGAGAAGGAAGGAGG - Intergenic
1199712269 X:150477734-150477756 GTGGGCAGAGAGGAGGGGGAAGG + Intronic
1199718465 X:150524766-150524788 CTGGGCAGGGAGAAGCAACAAGG - Intergenic
1199794238 X:151179468-151179490 AGGGGGAGGGAGAAGGAGGAGGG - Intronic
1199982199 X:152927367-152927389 CTGGCCAGGGTGGAAGTGGAGGG + Intronic
1200100584 X:153687772-153687794 GAGGGCAGGGAGGAGGTGGGCGG + Intronic
1200102370 X:153694465-153694487 CTGGGCTGGGGGATGGTGGCGGG + Intronic
1200135816 X:153874056-153874078 CTGGGGAGGGAGATGGTGACAGG + Intronic
1200162290 X:154015788-154015810 CTGGGCTGGGGGCAGGGGGAAGG - Intronic
1201274747 Y:12286858-12286880 CTGGGCCGGGAGAAGTCGGCAGG + Intergenic
1201413996 Y:13729629-13729651 ATGGGCAGGGGGAAGGTGCGGGG - Intergenic