ID: 1132617933

View in Genome Browser
Species Human (GRCh38)
Location 16:851627-851649
Sequence CGGGTTGTGACAGCCTCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132617933_1132617940 10 Left 1132617933 16:851627-851649 CCAGCCGAGGCTGTCACAACCCG No data
Right 1132617940 16:851660-851682 ACCTGTCCGCCCCAGGTGAGTGG No data
1132617933_1132617947 21 Left 1132617933 16:851627-851649 CCAGCCGAGGCTGTCACAACCCG No data
Right 1132617947 16:851671-851693 CCAGGTGAGTGGACGTCTCTGGG No data
1132617933_1132617948 28 Left 1132617933 16:851627-851649 CCAGCCGAGGCTGTCACAACCCG No data
Right 1132617948 16:851678-851700 AGTGGACGTCTCTGGGAACCTGG No data
1132617933_1132617939 3 Left 1132617933 16:851627-851649 CCAGCCGAGGCTGTCACAACCCG No data
Right 1132617939 16:851653-851675 TCAGGTCACCTGTCCGCCCCAGG No data
1132617933_1132617945 20 Left 1132617933 16:851627-851649 CCAGCCGAGGCTGTCACAACCCG No data
Right 1132617945 16:851670-851692 CCCAGGTGAGTGGACGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132617933 Original CRISPR CGGGTTGTGACAGCCTCGGC TGG (reversed) Intergenic
No off target data available for this crispr