ID: 1132618727

View in Genome Browser
Species Human (GRCh38)
Location 16:854589-854611
Sequence CAGGCTGAGCGGAGGGAAGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 336}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132618712_1132618727 24 Left 1132618712 16:854542-854564 CCGGGCAGAGGCCACCCACGGTC 0: 1
1: 0
2: 2
3: 17
4: 177
Right 1132618727 16:854589-854611 CAGGCTGAGCGGAGGGAAGTAGG 0: 1
1: 0
2: 4
3: 27
4: 336
1132618713_1132618727 13 Left 1132618713 16:854553-854575 CCACCCACGGTCCCTGAAGTAGG 0: 1
1: 0
2: 2
3: 5
4: 105
Right 1132618727 16:854589-854611 CAGGCTGAGCGGAGGGAAGTAGG 0: 1
1: 0
2: 4
3: 27
4: 336
1132618716_1132618727 10 Left 1132618716 16:854556-854578 CCCACGGTCCCTGAAGTAGGGCC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1132618727 16:854589-854611 CAGGCTGAGCGGAGGGAAGTAGG 0: 1
1: 0
2: 4
3: 27
4: 336
1132618711_1132618727 25 Left 1132618711 16:854541-854563 CCCGGGCAGAGGCCACCCACGGT 0: 1
1: 0
2: 0
3: 19
4: 213
Right 1132618727 16:854589-854611 CAGGCTGAGCGGAGGGAAGTAGG 0: 1
1: 0
2: 4
3: 27
4: 336
1132618719_1132618727 1 Left 1132618719 16:854565-854587 CCTGAAGTAGGGCCTCAGCTCCT 0: 1
1: 0
2: 0
3: 18
4: 168
Right 1132618727 16:854589-854611 CAGGCTGAGCGGAGGGAAGTAGG 0: 1
1: 0
2: 4
3: 27
4: 336
1132618718_1132618727 2 Left 1132618718 16:854564-854586 CCCTGAAGTAGGGCCTCAGCTCC 0: 1
1: 0
2: 1
3: 17
4: 185
Right 1132618727 16:854589-854611 CAGGCTGAGCGGAGGGAAGTAGG 0: 1
1: 0
2: 4
3: 27
4: 336
1132618717_1132618727 9 Left 1132618717 16:854557-854579 CCACGGTCCCTGAAGTAGGGCCT 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1132618727 16:854589-854611 CAGGCTGAGCGGAGGGAAGTAGG 0: 1
1: 0
2: 4
3: 27
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132618727 Original CRISPR CAGGCTGAGCGGAGGGAAGT AGG Exonic
900290115 1:1920196-1920218 CAGGCTGAGGGAAGGGCACTGGG - Intergenic
901012583 1:6209957-6209979 CAGGCTGTGCAGAGGTGAGTTGG + Exonic
901190095 1:7404629-7404651 CAGGGTGAGGGGACGGACGTGGG - Intronic
902525431 1:17054165-17054187 CCGGGTGGGCGGAGGGAAGGCGG + Exonic
903760307 1:25693276-25693298 CAGGCTGAGGAGGAGGAAGTGGG + Intronic
903931473 1:26864701-26864723 CGGGCTGAGGGGAGGTGAGTGGG + Intergenic
904565391 1:31425436-31425458 GGGGCTGTGGGGAGGGAAGTGGG + Intronic
904769279 1:32871855-32871877 CTGGCTGAGATGAGGGAAGGGGG - Intronic
905899761 1:41573781-41573803 CAGGCAGAACAGAGGTAAGTGGG + Intronic
906488308 1:46248093-46248115 CAGACTGGGCGGAGTGGAGTGGG - Exonic
906746238 1:48224095-48224117 CAGGGTGAGGGCAGGGCAGTGGG - Intronic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
911209105 1:95120929-95120951 CAGGCTGGGCGGAGGGGGATTGG + Intronic
912583758 1:110743123-110743145 TAGGCTGAGCAGAGGAAACTAGG + Intergenic
913214138 1:116606200-116606222 CAGGCTAAGCGCAGGGCGGTGGG + Intronic
915385254 1:155485421-155485443 AAGGCTGAGCGGGGGGAGGATGG - Intronic
915446786 1:155978618-155978640 TAGGCGGAGCGGAGGGAGGGCGG + Intronic
915524496 1:156467617-156467639 GAGGCTGAGAGGAGGGGAGTGGG + Exonic
915558440 1:156673109-156673131 AAGGGTGAGGGGAGGGAAGTTGG + Exonic
917565326 1:176207040-176207062 GAGGCTGAGGGGAGGGGAGGCGG - Exonic
918082938 1:181221503-181221525 CAGGCAGTGCCCAGGGAAGTGGG + Intergenic
918178000 1:182061871-182061893 AAGACTGAGAGGAGGGAAGGAGG - Intergenic
919976525 1:202616373-202616395 CAGCCTCAGCTGAGGGAAGGGGG - Intronic
920043387 1:203118079-203118101 GAGGCTGGGGGGAGGGAGGTGGG - Intronic
921553500 1:216568504-216568526 CTGGCAGACTGGAGGGAAGTTGG - Intronic
921898426 1:220424770-220424792 CAGACTAAAAGGAGGGAAGTTGG - Intergenic
923546514 1:234927479-234927501 CAGGCTGGGTGGAGGGCAGTGGG - Intergenic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
1063159963 10:3412039-3412061 CAGGAGGAGAGGAGGGAGGTGGG + Intergenic
1066243119 10:33556852-33556874 CAGGGTGAGCGGAGGAGAGCTGG + Intergenic
1066477891 10:35765315-35765337 CAGGCTGCACGGTGGGAAGACGG - Intergenic
1067054446 10:43042810-43042832 CAGGCTGTGGGGAGGGCAGGAGG - Intergenic
1067357654 10:45545799-45545821 CTGGCTGAGTGAAGGGAAGAAGG - Intronic
1069667388 10:70172009-70172031 CAGGATGAGCGGAGGGTAGAGGG - Intergenic
1069720183 10:70544807-70544829 CAGGCTGTGCCCAGGGGAGTAGG - Intronic
1069833890 10:71296734-71296756 CTGGCAGAGGTGAGGGAAGTCGG + Exonic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1076108139 10:127840796-127840818 CAGGATGAGCGGGAGGAAGGTGG + Intergenic
1076583613 10:131531339-131531361 CATGCTGAGCTGAGGGAGGAGGG + Intergenic
1076731819 10:132442962-132442984 CAGGCAGAGCAGAGGCAAGAAGG - Intergenic
1077284525 11:1759779-1759801 CAGGCTGAGCAGGTGGGAGTGGG - Intronic
1077395000 11:2316342-2316364 CAGGCTGAGGGGCAGGAGGTGGG - Intronic
1077562435 11:3272282-3272304 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077568329 11:3318102-3318124 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1078602574 11:12746842-12746864 CAGGCTGGGCTGAGGGCTGTGGG + Intronic
1079968336 11:27005892-27005914 CAGGTTGAGGGTAGGGAGGTGGG + Intergenic
1080668443 11:34356206-34356228 TAAGATGGGCGGAGGGAAGTGGG - Intronic
1081805241 11:45886522-45886544 CCGGCTGCGGGAAGGGAAGTCGG + Intronic
1082811431 11:57481452-57481474 CTAGCAGAGGGGAGGGAAGTGGG + Intergenic
1083269623 11:61565236-61565258 CATGCTGAGCAGATGGAAATGGG + Intronic
1083679103 11:64343092-64343114 CAGGCTGAGGGGAAGGAGTTTGG + Intronic
1084045094 11:66563792-66563814 CAGGGTGAGCAGAGGGCACTGGG - Exonic
1084742628 11:71149598-71149620 CAGGTAGAGAGGAGGGTAGTAGG + Intronic
1084978313 11:72815136-72815158 CTGGCTGAGCCCAGCGAAGTCGG + Intronic
1085017992 11:73187978-73188000 AAGGCAGAGCAGAGGAAAGTGGG + Intergenic
1085698076 11:78722573-78722595 CCTGCTGAGCCCAGGGAAGTGGG - Intronic
1085798355 11:79564446-79564468 CTGGCTGAGCAGATGGCAGTAGG + Intergenic
1086299279 11:85407954-85407976 CAGGCTGATCTGAGGGATATGGG + Intronic
1089402914 11:118174887-118174909 CAGGCTGAAAGAAGGGGAGTTGG - Intronic
1089596854 11:119585926-119585948 CAGGCTGATGGGAAGGAAGGTGG - Intergenic
1089661887 11:119991285-119991307 CAGGCAGAGGGAAGGGAAGTTGG + Intergenic
1091600554 12:1915389-1915411 CAGACTGAGAGGAGAGAAGGAGG + Intronic
1092233192 12:6789259-6789281 CAGGCTGTGGGGAAAGAAGTGGG - Intronic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1096263704 12:50107989-50108011 CAGGATGAGTGGATGGAAATGGG - Intronic
1096575695 12:52551517-52551539 GAGGCTGAGCCGAGGGCAGCAGG + Intronic
1096625488 12:52892880-52892902 AAGGCAGGGTGGAGGGAAGTGGG + Intergenic
1096789717 12:54037195-54037217 CACCCTCAGCGTAGGGAAGTAGG - Intronic
1096815793 12:54200993-54201015 AAGGCTGAACAAAGGGAAGTTGG - Intergenic
1097250866 12:57631792-57631814 CGGGCTGTGTGGAGTGAAGTGGG - Intronic
1098044979 12:66391098-66391120 CAGGCTGAGAGAAGGAAACTAGG + Intronic
1098073993 12:66706873-66706895 GTGGCTGAGGGGAGGGAACTTGG + Intronic
1098167205 12:67710718-67710740 CAGAATGAGAGGAGGGAAGGAGG + Intergenic
1100107486 12:91193668-91193690 CAGGCTATGCAGAGGGAAGTGGG - Intergenic
1100316172 12:93446783-93446805 GAGGCTGAGTGGGGAGAAGTTGG - Intergenic
1102513242 12:113429480-113429502 CAGGGTGGGCAGAGGAAAGTTGG - Intronic
1103948225 12:124538701-124538723 CAGGCTGGGCGCAGCGAGGTGGG + Intronic
1104224104 12:126814223-126814245 CAGGCTGAGCGGCTGGCAGGTGG - Intergenic
1104391897 12:128397851-128397873 GAGGCTGAGCAGAGGGGAGGTGG - Intronic
1104746834 12:131215941-131215963 CAGGCTGAGAAGACTGAAGTTGG - Intergenic
1105217354 13:18296751-18296773 CAGGCTAAGCGCAGGGCGGTGGG + Intergenic
1106285607 13:28316144-28316166 CTGCCTGAGCGTAGGGAAGCGGG - Intronic
1106859756 13:33893066-33893088 CAGGCCGAGAGAAGGGAAGGAGG + Intronic
1107822368 13:44297280-44297302 GAGGCAGAGAGGAGGGAAATGGG + Intergenic
1108576933 13:51798976-51798998 CAAGCTTAGGGGAGGGAAGCGGG + Intronic
1111898903 13:94176489-94176511 CATGCTTAGCACAGGGAAGTTGG - Intronic
1112733753 13:102394970-102394992 CGGGCTGAGAGGCGGGGAGTTGG - Intronic
1112845885 13:103643189-103643211 AAGGGTGAGTGGAGGGAGGTTGG - Intergenic
1113462349 13:110491057-110491079 CAGGCTCAGAGGGAGGAAGTAGG + Intronic
1113565644 13:111318119-111318141 CAGGCTGAGAGCAGGGGATTCGG - Intronic
1114258961 14:21024306-21024328 CAGGCTGCGCGGAGGAGAGAAGG + Exonic
1114618228 14:24079802-24079824 CAGGCTAAGGGGAGGGCAGATGG - Intergenic
1116922184 14:50590442-50590464 CAGGCAGAAAGGAAGGAAGTAGG - Intronic
1117079101 14:52133083-52133105 GAGGCTGAGCTGAGGGAGGAGGG + Intergenic
1117794793 14:59381461-59381483 TAGTCTGAGGGGAGGGGAGTGGG - Intergenic
1119188428 14:72661614-72661636 CTGGCTGAGCTGGCGGAAGTGGG - Exonic
1119557789 14:75566908-75566930 GGGGCTGAGCAGAGGGAAGGAGG + Intergenic
1119651747 14:76388818-76388840 CAAGCTGAGAAGAGGGAAGTCGG - Intronic
1119702152 14:76762471-76762493 CTGGCAGAGCGGAGAAAAGTCGG - Exonic
1121330292 14:93045372-93045394 CAGACTGAGAGGCTGGAAGTAGG + Intronic
1121525153 14:94614356-94614378 CAGGCTGGGTGGAGGGCAGTGGG + Exonic
1121827957 14:97026258-97026280 CAGGCTTACCAAAGGGAAGTGGG + Intergenic
1122153776 14:99738411-99738433 CAGGCAGAGCAAAGGGCAGTGGG - Intronic
1122694217 14:103545042-103545064 CAGGCCCAGCGGTGGGGAGTAGG - Intergenic
1124359423 15:29024863-29024885 CAGGAGGAGCGGATGGAAGCAGG + Intronic
1124492171 15:30164723-30164745 CAGCCTCAGCCGAGGGAAGGGGG - Intergenic
1124751365 15:32373594-32373616 CAGCCTCAGCCGAGGGAAGGGGG + Intergenic
1125431069 15:39593898-39593920 CAGACAGAGAGGAGGGAAGGAGG - Intronic
1127761707 15:62146184-62146206 CAGGGTGAGGGTAGGGAAGGAGG - Intergenic
1127812132 15:62573582-62573604 CAGGGAGAGAGGAGGGAAGCTGG - Intronic
1129392763 15:75228816-75228838 CAGGCTGAGTGGATGGGAGGGGG + Intergenic
1129463910 15:75713152-75713174 AAGGCAGAAAGGAGGGAAGTAGG - Intergenic
1129677617 15:77640944-77640966 CAGGCTGAGGTGGGAGAAGTGGG + Intronic
1129743221 15:78000316-78000338 CAGGAGGAGCGGAGGTGAGTGGG - Intronic
1129836327 15:78709615-78709637 GAGGCTGGGTGGAGGGTAGTAGG - Intronic
1132618727 16:854589-854611 CAGGCTGAGCGGAGGGAAGTAGG + Exonic
1132860844 16:2071056-2071078 CAGGCTGAGCAGAGGTGACTGGG + Intronic
1133033685 16:3023295-3023317 CAGGCTGAGTTGAGAGAAGTGGG + Exonic
1133523138 16:6578304-6578326 CAGGCTGAGAACAGGGTAGTGGG + Intronic
1134058072 16:11182593-11182615 CAGGCTGGGCCGAGGGAAGCAGG + Intergenic
1135009920 16:18866612-18866634 CAGGCTGAAGGGAGGTAGGTTGG - Exonic
1135316803 16:21454078-21454100 CAGGCTGAAGGGAGGTAGGTTGG - Intergenic
1135369726 16:21886321-21886343 CAGGCTGAAGGGAGGTAGGTTGG - Intergenic
1135442088 16:22484803-22484825 CAGGCTGAAGGGAGGTAGGTTGG + Intronic
1136313629 16:29434253-29434275 CAGGCTGAAGGGAGGTAGGTTGG - Intergenic
1136327071 16:29536019-29536041 CAGGCTGAAGGGAGGTAGGTTGG - Intergenic
1136409330 16:30067048-30067070 CAGGCCTAGCAAAGGGAAGTTGG + Intronic
1136441762 16:30276004-30276026 CAGGCTGAAGGGAGGTAGGTTGG - Intergenic
1138529641 16:57628147-57628169 CCGGCAGAGCGGAAGGCAGTCGG - Intronic
1139888557 16:70229729-70229751 CAGGCTGAAGGGAGGTAGGTTGG - Intergenic
1140232288 16:73127284-73127306 CAGGCAGAGAAGAGGGAAGAAGG + Exonic
1140723285 16:77789549-77789571 CAGGCTACGGGGAAGGAAGTGGG - Intronic
1142191823 16:88721619-88721641 CAGGATGCGGGGCGGGAAGTAGG + Exonic
1142348807 16:89570643-89570665 CAGCCTGGGAGGAGGCAAGTGGG + Intergenic
1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG + Intronic
1142601723 17:1056308-1056330 CAGGCTGAGTGGAGGAGAGAAGG - Intronic
1143024187 17:3931372-3931394 GAGGCTGAACGGAGGGTATTGGG + Intronic
1143485760 17:7252643-7252665 CTGGCTGAGGGGACGGAAGTGGG + Intronic
1144790262 17:17854293-17854315 CAGGCTGATGGGAGGGAAGTGGG + Intronic
1145415327 17:22709926-22709948 CAGGATGAGGGGATGGAAGATGG + Intergenic
1145971679 17:28959959-28959981 AAGGCTCTGGGGAGGGAAGTAGG - Intronic
1146187184 17:30731719-30731741 CAGGAGGAGAGGAGGGAAGGAGG - Intergenic
1147235861 17:39057045-39057067 CAGGCTCAGCGAAGGGAGGCTGG + Intergenic
1148086257 17:44995498-44995520 GAGGCTGAGAGGTGGGAAGGGGG + Intergenic
1150205269 17:63400037-63400059 CAGGCTGAGGGGAAGGAACTGGG + Intronic
1151322442 17:73360005-73360027 CAGGCTGAGAGGTGGGGAGGTGG - Intronic
1152044727 17:77928440-77928462 CAGGGTGTGGGGAGGGTAGTGGG + Intergenic
1154010000 18:10565956-10565978 CTGGCTGAACAAAGGGAAGTAGG + Intergenic
1156526881 18:37776159-37776181 CAGGCAGAGAGGTGGGAAGGAGG + Intergenic
1157272797 18:46289593-46289615 TAGGCTGTGGGGAGGGGAGTAGG - Intergenic
1157402008 18:47396475-47396497 CACTATGAGGGGAGGGAAGTAGG + Intergenic
1157698037 18:49739240-49739262 CAGGCAGACCAGAGTGAAGTTGG + Intergenic
1158507293 18:58057965-58057987 ATGGCTGAGTGAAGGGAAGTGGG - Intronic
1159648599 18:70950427-70950449 CAGGCAGATGGGAGGGAAGGGGG - Intergenic
1159946341 18:74447092-74447114 CAGGCTGAGGGGCGGGAAGCTGG + Exonic
1160099524 18:75906990-75907012 CAGGCTGAGCTGGAGGAAGAAGG + Intergenic
1160155250 18:76429027-76429049 CAGGCTGACCCCGGGGAAGTTGG + Intronic
1160538632 18:79608714-79608736 CAGGCTGAGCTGCGGGAGGATGG + Intergenic
1160662356 19:307037-307059 CAGGCTGAGCAGAGGAGGGTGGG - Intronic
1161339905 19:3735703-3735725 CAGGCAGAGCTGGGGGAGGTTGG + Intronic
1161406415 19:4093896-4093918 CAGGCTGGGCTGAGGGCAGGAGG + Intronic
1161977591 19:7615104-7615126 CAGGCTGGGTGGAGGGAAGATGG + Intronic
1162013414 19:7830984-7831006 CAGGCTGAGCTGAGGGCTGTGGG - Intronic
1162153969 19:8664364-8664386 CAGGCTGATGGGCAGGAAGTGGG - Intergenic
1162909283 19:13840699-13840721 GATGTTGAGCGGAGGGCAGTGGG - Intergenic
1163193444 19:15696804-15696826 CAGGCTGAGCTGGGTGCAGTTGG + Intronic
1166313843 19:41977843-41977865 CAGGCAGTGCAGAGGGAGGTTGG + Intronic
1166772807 19:45294471-45294493 CAGGGTGAGGGGTGGGAAGTAGG + Intronic
1167077418 19:47257892-47257914 CAGGATGAGCACAGGGAGGTGGG + Intronic
1167278489 19:48552869-48552891 CACGCTGAGCTCATGGAAGTGGG - Intronic
1167439548 19:49500403-49500425 CAGGCTGCTGGGAAGGAAGTGGG + Intergenic
1168483039 19:56737357-56737379 CAGGGTGGGCTGTGGGAAGTGGG - Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926044982 2:9703726-9703748 CAGGGTGAGCAGAGCCAAGTGGG - Intergenic
926163105 2:10501873-10501895 CAGGCCCAGTGGAGGGAAGGAGG - Intergenic
926216539 2:10909128-10909150 CAGGCTGAGAGGATGGCAGGCGG - Intergenic
928029689 2:27767917-27767939 CAGGCAGAGTGGAAGGAACTGGG - Intergenic
928402006 2:30985814-30985836 AAGGCTGAGGGGAGGGGAGGGGG - Intronic
929994057 2:46814153-46814175 AAGGCTGAGCGGGGGGAGGGAGG - Intergenic
934296967 2:91749932-91749954 CAGGCTAAGCGCAGGGCGGTGGG - Intergenic
934760995 2:96857151-96857173 TAGGAGGGGCGGAGGGAAGTAGG + Intronic
935878032 2:107533810-107533832 CAAGATGAGAGGAGGCAAGTCGG - Intergenic
936407095 2:112214545-112214567 CAAGGGGAGCAGAGGGAAGTAGG + Exonic
937329906 2:121019946-121019968 CAGGCTGAGCCGAGCTCAGTGGG + Intergenic
937358124 2:121211240-121211262 CAGGAGGAAGGGAGGGAAGTTGG + Intergenic
939371707 2:141309720-141309742 GAGGGTGAGGGGAGGGAACTTGG + Intronic
939630630 2:144523434-144523456 CAAGCTGAGCGGGGGGAGGGGGG - Intronic
941156709 2:161988002-161988024 AAGGCTGGGCGGAGAGAAGGTGG - Intergenic
942243581 2:173986601-173986623 TAGGCTGAGAGGAAGGAAGCAGG - Intergenic
942617488 2:177809097-177809119 CAGGCTGAAGAGAGGGGAGTGGG + Intronic
943927424 2:193803071-193803093 CAGGGTGAGCGCAGGCAAGATGG + Intergenic
944659065 2:201905317-201905339 CAGGCAGAGAGGATGGAAGAGGG - Intergenic
946337698 2:219049533-219049555 CAGGCTGAGGTGTGGGAGGTGGG + Intergenic
946355999 2:219185326-219185348 CAGGCTGAGGGGAGAAGAGTTGG + Exonic
947524399 2:230869557-230869579 CAGGCTGAGAACAGGGAAGATGG - Intronic
947761087 2:232604461-232604483 CTTGCTGAGCTGTGGGAAGTGGG - Intergenic
947811875 2:233009874-233009896 CAGGTGGAGTGGAGGGAAGGTGG - Intronic
948080660 2:235202784-235202806 CATGCTGAGCACAGGGAAGCAGG - Intergenic
948627032 2:239275719-239275741 CAGCCTGAGGGGTGGGGAGTGGG - Intronic
1168941707 20:1718350-1718372 CAGGCTCAGCAAAGGGAACTGGG + Intergenic
1171024537 20:21616950-21616972 CATGCTGCCTGGAGGGAAGTCGG - Intergenic
1171346410 20:24469504-24469526 CAGCCCGAGCGGCGGGGAGTCGG - Exonic
1171487212 20:25493796-25493818 CAGGCTCAGGGCAGGGAACTCGG + Intronic
1172107436 20:32525060-32525082 CAGGCTGGGCAGCGGGAAGTGGG + Intronic
1172301746 20:33855312-33855334 CAGGCTGAGCGGGTGGAAGCTGG - Intergenic
1173042530 20:39477870-39477892 CAGACTGAGGGGAGGCAAGTGGG - Intergenic
1173741668 20:45406429-45406451 CCGGCTGGGCGGAGGGAGGAAGG + Intronic
1174575660 20:51535343-51535365 CAGGCTGTGCGAGGGGATGTGGG - Intronic
1177196896 21:17912706-17912728 CAGGATGAGAGGAGTGAAGCAGG - Intronic
1178880260 21:36444264-36444286 GAGGGTGAGGGGAGGGAATTAGG - Intergenic
1179488401 21:41725687-41725709 GAGGCTGAGCTGAGGGGGGTGGG - Intergenic
1179640617 21:42745247-42745269 AAGGCCGAGCGGAAGGAAGCAGG + Intronic
1179708493 21:43195885-43195907 GAGACTGAGCGGTGGGAGGTGGG + Intergenic
1180184316 21:46131912-46131934 CGGGCTGGGCGGAGGGGAGGTGG - Intronic
1180929179 22:19577305-19577327 CAGAGAGAGAGGAGGGAAGTAGG - Intergenic
1181792890 22:25282126-25282148 CAGGCTAAGCAGAGCAAAGTGGG - Intergenic
1181813529 22:25420464-25420486 CAGGCTAAGCAGAGCAAAGTGGG - Intergenic
1182129620 22:27841330-27841352 CAGGCTGGGCAGTGGGAACTGGG - Intergenic
1182257379 22:29048960-29048982 CAGGCAGAGCAGTGGGGAGTTGG + Intronic
1182815604 22:33160836-33160858 CAGGCTGAGTGAAGGGAAGTTGG + Intergenic
1183208405 22:36434778-36434800 CCGGCTGTGTGGAGGGAAGGGGG + Intergenic
1183346060 22:37309026-37309048 CAGGCTGAATGGAGGGAACCAGG + Intronic
1183498076 22:38161797-38161819 CAGGCTGAGGGGAGGGAAGGAGG + Intronic
1183583304 22:38738269-38738291 CAAAGAGAGCGGAGGGAAGTGGG + Intronic
1183588416 22:38766413-38766435 CAGGCTGGGCCCAGGGAAGGGGG + Intronic
1184691323 22:46118620-46118642 GAGGCTGAGCGGGAGGAAGGAGG - Intergenic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
1185262965 22:49880442-49880464 CAGGCTGCGGGGCGGGGAGTCGG - Intronic
1185388126 22:50545837-50545859 CAGGCTGAGAGGAGGGACTGTGG + Intergenic
952262549 3:31754389-31754411 CAAGATGAGCGGAAGGAAGAGGG + Intronic
952957168 3:38564635-38564657 AAGGCTGAGCAGAAGGAAGTGGG - Intronic
953787266 3:45920641-45920663 TGGGCTGAGCAGTGGGAAGTGGG + Exonic
954071239 3:48144272-48144294 TAGGCTGACTGGTGGGAAGTTGG - Intergenic
954109339 3:48425427-48425449 CAGGCTGGGCGGTGGGGAGGGGG - Intronic
954132044 3:48565848-48565870 AAGGCAGAGGAGAGGGAAGTTGG + Intronic
955666636 3:61355991-61356013 CAAGCAGAGCAGGGGGAAGTGGG + Intergenic
955668119 3:61371741-61371763 TAGCCTGAGCAGATGGAAGTGGG - Intergenic
956580598 3:70807995-70808017 CAGGCAGAGTGAAGGGAAATGGG - Intergenic
956734405 3:72226791-72226813 CAGGCTGAGAGAAGGAAAGGAGG + Intergenic
957700685 3:83707255-83707277 GGGGCTGAGGGGAGGGAACTTGG - Intergenic
959565014 3:107825325-107825347 CAGGTTAAGCAGAGGCAAGTGGG - Intergenic
960916062 3:122696276-122696298 AAGGCTGAGCAGAAGGAATTAGG + Intronic
961200994 3:125045289-125045311 GAGGCCGAGGGGAAGGAAGTAGG - Intronic
961446964 3:126985436-126985458 CTGGCTGTGCAGAGGGCAGTAGG - Intergenic
961501156 3:127337034-127337056 CAGGCACAGCGGGGGGTAGTCGG + Intergenic
962917298 3:139916275-139916297 CAGGCTGATTGGGGGGAAGATGG - Intergenic
963745053 3:149117423-149117445 CAGGCTGAGCAAAGGAAGGTAGG - Intergenic
964723147 3:159787864-159787886 CAGGCTCAGATGAGGGAAGTTGG - Intronic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
965616392 3:170597231-170597253 CAGGTTGAGCTAAGGGGAGTTGG - Intronic
968010638 3:195271639-195271661 GAGGCCGAGCGGAGGGAGGCTGG + Intergenic
968487637 4:871579-871601 CAGGCTGAGCTGTGGGGAGCAGG + Intronic
968619673 4:1598174-1598196 CCGGCTGTGGGGAGGTAAGTGGG + Intergenic
969301569 4:6300309-6300331 GACCCTGAGGGGAGGGAAGTGGG + Intronic
970499306 4:16661098-16661120 CAGGGTGAGTGTAGGGAGGTGGG - Intronic
972739767 4:41878627-41878649 GAGGCAGAGCGGAGGGCAGTGGG - Intergenic
972762363 4:42119438-42119460 CAGGCAGAGGGGTGGGAAGGAGG - Intronic
973646572 4:52956428-52956450 CAGGCTGAGGGAAGGGCAGGTGG + Intronic
978224340 4:106316204-106316226 CAGGCTGAGGGGAGGGTAGAGGG - Intronic
978402901 4:108349717-108349739 GAGGCTGAGGTGAGGGAGGTGGG + Intergenic
978453540 4:108863368-108863390 CAGGGTGAACGGGGGGAAGCAGG - Exonic
984419029 4:179496281-179496303 CAGGCATAGTGGAGAGAAGTGGG - Intergenic
984646544 4:182226184-182226206 CAGGCTGAGAGAAAGGAAATTGG + Intronic
984812563 4:183807691-183807713 GAGGCTGAGCTGGGGGAGGTGGG + Intergenic
985249115 4:188005452-188005474 CAGGCAGAGTGAAGGGATGTGGG - Intergenic
985661869 5:1161427-1161449 CAGGCTGCGGGGAGGGAGCTGGG - Intergenic
987302178 5:16606732-16606754 GAGGCTGAGCCAAGGTAAGTGGG - Intronic
988494375 5:31732498-31732520 AAGGCTGAGCAGAAGGAGGTGGG + Intronic
989083288 5:37649151-37649173 CAGGCAGAGAGGAGAGAAGAAGG + Intronic
989171838 5:38479077-38479099 CGGGAAGAGGGGAGGGAAGTTGG - Exonic
991633564 5:68680771-68680793 CAGGCTGGGAGGAGTGGAGTGGG + Intergenic
991666651 5:69006144-69006166 CAGGCTGGGATGAGGGAAGGAGG + Intergenic
992150180 5:73895005-73895027 CAGGCTGAGGGAAGGGAGGGTGG + Intronic
994178997 5:96743474-96743496 CAGCCTGAGCTGATGGAGGTGGG - Intronic
994983571 5:106906382-106906404 GAGGATGAGAGGATGGAAGTGGG - Intergenic
997864533 5:137449342-137449364 TAGGCTGAGAGGAGAGAGGTGGG - Intronic
999287265 5:150401697-150401719 TTGGCTGAGCAGAGGGAACTAGG + Intronic
999377314 5:151095774-151095796 CTAGCTGAGAGGAGGGCAGTGGG + Intergenic
999692758 5:154162935-154162957 AAGGCTCAGGGGAGGGAAGCGGG - Intronic
1000082524 5:157861428-157861450 CAGGCCCAGGGGAGGGAAGGTGG - Intergenic
1000553809 5:162698404-162698426 CAGGCTCTGAGGAGGAAAGTGGG + Intergenic
1001949716 5:175807803-175807825 AAGGAAGAGGGGAGGGAAGTGGG + Intronic
1001986138 5:176075595-176075617 CAGGCTGAGAGGAGCAATGTGGG - Intronic
1002086096 5:176776533-176776555 CAGGCTGACCGGAAAGAAGATGG - Intergenic
1002230731 5:177762529-177762551 CAGGCTGAGAGGAGCAATGTGGG + Intronic
1002264605 5:178021219-178021241 CAGGCTGAGAGGAGCAATGTGGG - Intronic
1002662049 5:180797834-180797856 CAGGCTGAGCCTAAGGAGGTGGG - Intronic
1002820128 6:717126-717148 AAGGCTGACCGGAGGGCAGGGGG + Intergenic
1003175473 6:3750515-3750537 CAGGCTGAGGGGGTGGAAGCCGG - Intronic
1003899323 6:10639347-10639369 CATACTGAGCGGAGGCAAGGTGG - Intergenic
1004453096 6:15765748-15765770 CAGGCTAAGAGGAAGGAATTGGG + Intergenic
1004814093 6:19293886-19293908 CAGGGTGACCTGAGGAAAGTGGG - Intergenic
1006679703 6:35788098-35788120 CACCATGAGTGGAGGGAAGTGGG + Exonic
1007313054 6:40961950-40961972 CATCCAGAGCGGAGGGAAGCTGG - Intergenic
1007934516 6:45721211-45721233 CAGGCTGAGGTCAGAGAAGTTGG + Intergenic
1007983625 6:46185305-46185327 CAGGCAGAGCTGAGGGAGGAAGG - Intergenic
1008597252 6:53054818-53054840 GACGCTGAGGGGAGGGAATTGGG - Intronic
1009922862 6:70084574-70084596 CGGGCTGAGCAGAGGAAAATAGG - Intronic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1013744871 6:113333754-113333776 GAGGCTGCGGTGAGGGAAGTGGG + Intergenic
1015091570 6:129364911-129364933 CAGGCAGAGCAGGAGGAAGTGGG + Intronic
1015261526 6:131243094-131243116 CAGGCTGAGCGTGGGGCACTAGG + Intronic
1015591515 6:134827240-134827262 CAGGCTGACCGCAGGGAGGTGGG + Intergenic
1015837124 6:137432506-137432528 CAAGCTCAGCAGAGGGGAGTTGG + Intergenic
1017878917 6:158546246-158546268 CAGCCTGAGGGGAGGGTATTTGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018728892 6:166634329-166634351 CGGGCTGAGGGGAAGGAAATGGG + Intronic
1018825239 6:167403942-167403964 CAGGCAGAGTGGAGGGAGGGAGG + Intergenic
1019476975 7:1249000-1249022 GAGGCTTAGGGGAGGGAAGCAGG - Intergenic
1020363505 7:7355012-7355034 CAGGCTGAGCGGAATAAAGAAGG + Intergenic
1023111272 7:36813383-36813405 CAGGGTGAGAGGAGGGTAGTAGG - Intergenic
1024113386 7:46169839-46169861 TAGGATCAGCGGAGGGAAGGAGG + Intergenic
1025248902 7:57338621-57338643 CAGGCTGAGTGCAGGGATGTAGG + Intergenic
1025710199 7:63901149-63901171 CCAGCTGAGCAGCGGGAAGTGGG - Intergenic
1025790300 7:64681929-64681951 GAGGTTGAGAGGAGGGATGTAGG - Intronic
1026962431 7:74417368-74417390 CAGGCAGAGCAAAGAGAAGTGGG - Intergenic
1027194470 7:76020205-76020227 CAGGATGAGCTTAGGGAAGAAGG + Intronic
1032086433 7:128886379-128886401 CTGGCTGAGGGGAGGGAGGTGGG + Intronic
1032092904 7:128920579-128920601 CAGGCAGAGCAGAAGGAGGTCGG - Intergenic
1035236129 7:157498699-157498721 GAGGCTGAGCGCTGGGAAGAAGG - Intergenic
1042137370 8:65645005-65645027 CCGGAGGAGCTGAGGGAAGTCGG + Intronic
1043890061 8:85644356-85644378 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043891602 8:85656270-85656292 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043892674 8:85663107-85663129 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043892883 8:85714228-85714250 CAGGCTGATGAGAGGGCAGTGGG - Intergenic
1043895570 8:85735682-85735704 CAGGCTGATGAGAGGGCAGTGGG - Intergenic
1043897109 8:85746126-85746148 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043899435 8:85764494-85764516 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043901043 8:85776687-85776709 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043903007 8:85791962-85791984 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043904617 8:85804155-85804177 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043906229 8:85816346-85816368 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043907837 8:85828536-85828558 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1044895255 8:96885003-96885025 TAGGCAGAGGGGAGGAAAGTGGG + Intronic
1046360544 8:113148280-113148302 AAGGCTGTGAGGAGGGAGGTAGG - Intronic
1046724060 8:117655506-117655528 AAGGCTGAGTGGAGGGCAGGGGG - Intergenic
1046790761 8:118319333-118319355 CAGGGTGAAGGGAGAGAAGTGGG - Intronic
1047636371 8:126767600-126767622 CAGCCTGAGCAGGAGGAAGTTGG - Intergenic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1049682681 8:143926629-143926651 CAGGCTGAGCTGGGGGCAGGGGG + Intronic
1049854897 8:144855255-144855277 CAGGGGGAGAGGAGGGCAGTAGG + Intergenic
1050162654 9:2734358-2734380 CAGCCTGGGAGGAGGGAACTGGG - Intronic
1051680554 9:19603490-19603512 CAGGGTGAGGGGAGGGAGGGGGG + Intronic
1052821109 9:33138465-33138487 CATGCTGAGGGCAGGGAAGGTGG - Intronic
1052844397 9:33322338-33322360 CAAGCTGAGCTGAGGGGAGGAGG - Intronic
1053462584 9:38282021-38282043 GAGGCTGAGCAGAGGGCAGAGGG + Intergenic
1055627377 9:78188000-78188022 AAGGCAGAAGGGAGGGAAGTTGG - Intergenic
1056190013 9:84175854-84175876 CAAGCTGGGGGGAGGGAAGGTGG - Intergenic
1058058803 9:100474092-100474114 AAGGCTGAGGGGAGGGAGGGCGG + Intronic
1058866713 9:109167409-109167431 CTGCCTGCGTGGAGGGAAGTCGG - Intergenic
1058976935 9:110133651-110133673 CGGGGTGGGCGGAGGGTAGTGGG - Intronic
1059354288 9:113687278-113687300 TAGGCAGAGAGGAGGGAAGAGGG + Intergenic
1060551745 9:124488885-124488907 CAGGCTGAGTTGAGGGGAGAAGG - Intronic
1060813888 9:126624879-126624901 CAGGCTCCGGGGAGGGAGGTGGG + Intronic
1061464092 9:130764069-130764091 CAGGCTGAGGGGAGGTTTGTAGG + Intronic
1062701717 9:137909352-137909374 AAGGCTGAAGGAAGGGAAGTGGG - Intronic
1185484128 X:469327-469349 CAGGCTGTGGGGAGGGAATGAGG + Intergenic
1186452883 X:9687920-9687942 CAGGAGAAGCGCAGGGAAGTGGG - Intronic
1186863202 X:13693464-13693486 TAGGCAGAGGGGAGGGAGGTCGG + Intronic
1189447448 X:41094094-41094116 CATGCTGAGCTGAGGCAAGAGGG + Intronic
1190188778 X:48258143-48258165 CAAGCTGAGAGGAGGAAGGTAGG - Intronic
1192150408 X:68708843-68708865 CAGGCTGAGGTGAGTGAGGTAGG - Intronic
1197027271 X:121768577-121768599 GAGGCTGAAGGGAGGGAAGAGGG + Intergenic
1197482499 X:127004724-127004746 CAGGTTGAGCCTAGGGAAATGGG - Intergenic
1197590009 X:128397061-128397083 CAAGAGGAGGGGAGGGAAGTGGG - Intergenic
1198186594 X:134259420-134259442 CAGCCTGTGCTGAGTGAAGTTGG - Intergenic
1199983447 X:152933827-152933849 CTGGGTGTGCTGAGGGAAGTAGG - Intronic
1200073829 X:153541650-153541672 CAGGCTGTGCGGAGGACAGAAGG - Exonic