ID: 1132618775

View in Genome Browser
Species Human (GRCh38)
Location 16:854779-854801
Sequence CTGAGCTGCAGCTGCTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 314}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132618769_1132618775 1 Left 1132618769 16:854755-854777 CCGACCCGGCTCCTCAGCCTGCT 0: 1
1: 0
2: 1
3: 30
4: 347
Right 1132618775 16:854779-854801 CTGAGCTGCAGCTGCTCACAGGG 0: 1
1: 0
2: 2
3: 31
4: 314
1132618765_1132618775 8 Left 1132618765 16:854748-854770 CCGGCCCCCGACCCGGCTCCTCA 0: 1
1: 1
2: 9
3: 48
4: 550
Right 1132618775 16:854779-854801 CTGAGCTGCAGCTGCTCACAGGG 0: 1
1: 0
2: 2
3: 31
4: 314
1132618762_1132618775 21 Left 1132618762 16:854735-854757 CCTGCTGGGACTCCCGGCCCCCG 0: 1
1: 0
2: 2
3: 43
4: 370
Right 1132618775 16:854779-854801 CTGAGCTGCAGCTGCTCACAGGG 0: 1
1: 0
2: 2
3: 31
4: 314
1132618760_1132618775 27 Left 1132618760 16:854729-854751 CCAGGGCCTGCTGGGACTCCCGG 0: 1
1: 1
2: 5
3: 52
4: 451
Right 1132618775 16:854779-854801 CTGAGCTGCAGCTGCTCACAGGG 0: 1
1: 0
2: 2
3: 31
4: 314
1132618768_1132618775 2 Left 1132618768 16:854754-854776 CCCGACCCGGCTCCTCAGCCTGC 0: 1
1: 0
2: 0
3: 38
4: 389
Right 1132618775 16:854779-854801 CTGAGCTGCAGCTGCTCACAGGG 0: 1
1: 0
2: 2
3: 31
4: 314
1132618771_1132618775 -4 Left 1132618771 16:854760-854782 CCGGCTCCTCAGCCTGCTGCTGA 0: 1
1: 0
2: 40
3: 131
4: 711
Right 1132618775 16:854779-854801 CTGAGCTGCAGCTGCTCACAGGG 0: 1
1: 0
2: 2
3: 31
4: 314
1132618764_1132618775 9 Left 1132618764 16:854747-854769 CCCGGCCCCCGACCCGGCTCCTC 0: 1
1: 0
2: 3
3: 70
4: 675
Right 1132618775 16:854779-854801 CTGAGCTGCAGCTGCTCACAGGG 0: 1
1: 0
2: 2
3: 31
4: 314
1132618759_1132618775 28 Left 1132618759 16:854728-854750 CCCAGGGCCTGCTGGGACTCCCG 0: 2
1: 0
2: 3
3: 27
4: 283
Right 1132618775 16:854779-854801 CTGAGCTGCAGCTGCTCACAGGG 0: 1
1: 0
2: 2
3: 31
4: 314
1132618770_1132618775 -3 Left 1132618770 16:854759-854781 CCCGGCTCCTCAGCCTGCTGCTG 0: 1
1: 0
2: 10
3: 310
4: 1431
Right 1132618775 16:854779-854801 CTGAGCTGCAGCTGCTCACAGGG 0: 1
1: 0
2: 2
3: 31
4: 314
1132618766_1132618775 4 Left 1132618766 16:854752-854774 CCCCCGACCCGGCTCCTCAGCCT 0: 1
1: 0
2: 0
3: 27
4: 288
Right 1132618775 16:854779-854801 CTGAGCTGCAGCTGCTCACAGGG 0: 1
1: 0
2: 2
3: 31
4: 314
1132618767_1132618775 3 Left 1132618767 16:854753-854775 CCCCGACCCGGCTCCTCAGCCTG 0: 1
1: 0
2: 0
3: 15
4: 252
Right 1132618775 16:854779-854801 CTGAGCTGCAGCTGCTCACAGGG 0: 1
1: 0
2: 2
3: 31
4: 314
1132618772_1132618775 -10 Left 1132618772 16:854766-854788 CCTCAGCCTGCTGCTGAGCTGCA 0: 1
1: 1
2: 7
3: 66
4: 1035
Right 1132618775 16:854779-854801 CTGAGCTGCAGCTGCTCACAGGG 0: 1
1: 0
2: 2
3: 31
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132618775 Original CRISPR CTGAGCTGCAGCTGCTCACA GGG Intronic
900393659 1:2444390-2444412 CTGGGCTGCAGGTGCTCATCTGG + Intronic
900494442 1:2970125-2970147 CACAGCAGCTGCTGCTCACAGGG - Intergenic
900563559 1:3320810-3320832 CTGAGCTACACCTGCTCAGCTGG + Intronic
901474391 1:9479570-9479592 CTTGCCTGCAGCGGCTCACAGGG + Intergenic
903696156 1:25208643-25208665 TGGAGATGCAGCTTCTCACATGG - Intergenic
905631195 1:39519474-39519496 GTGAGCTGCAGATGCTAACATGG - Intronic
905666562 1:39766697-39766719 GTGAGCTGCAGATGCTAACATGG + Intronic
906199900 1:43953248-43953270 CTCCTCTGCTGCTGCTCACACGG - Intronic
906359872 1:45145875-45145897 CTGAGATGGAGCTGCTAACAAGG + Intronic
907159994 1:52362645-52362667 CTGAGCTGCTGGCTCTCACAGGG - Exonic
907421512 1:54350714-54350736 CTGGGCTGCTGCTGCCCCCAGGG - Intronic
912204593 1:107495853-107495875 CTGGGCTGAAGAAGCTCACAGGG - Intergenic
912542207 1:110425621-110425643 CCGAGCTCCAGCTGATCACCAGG - Intergenic
912971301 1:114286151-114286173 CTAAGCAGCACCTGTTCACAAGG + Intergenic
915638605 1:157203941-157203963 CTGAGCTCCTCCTGCTCACTTGG - Intergenic
917433952 1:175000135-175000157 CCGAGCTGCAGCCGCGCAGAAGG - Exonic
918315913 1:183322605-183322627 CTGAGCAGCGGCAGCTCTCAGGG + Intronic
919083325 1:192891767-192891789 CGCAGCTACAGCTGCCCACATGG - Intergenic
919958110 1:202438951-202438973 CTGACCTGGAGATGCTCACAGGG + Intronic
920133279 1:203749421-203749443 TTGAGCTGCTGCTGCTGACCGGG + Intergenic
920263963 1:204708154-204708176 CTCAGCCCCACCTGCTCACAGGG + Intergenic
921853836 1:219959385-219959407 CTGAGCTGTTTCTGCACACACGG - Intergenic
921872023 1:220151705-220151727 CTCAGCTGCTGGTGCTCACGGGG - Exonic
924726917 1:246679598-246679620 CTGTGCTGCAGCTGGTCTCCAGG - Intergenic
1063101099 10:2950865-2950887 CAGAGCTGCTGCTGCTGCCATGG - Intergenic
1063546458 10:6986595-6986617 CTGTGCTGCAGCCTCACACAAGG + Intergenic
1064472656 10:15652918-15652940 CTGAGCTGGTACTGCTCACCTGG + Intronic
1064985310 10:21204137-21204159 CTGAAGTTCAGGTGCTCACAGGG - Intergenic
1065732348 10:28721138-28721160 CTGAGCAAAAGCTACTCACATGG - Intergenic
1070641546 10:78173949-78173971 CTGGGCTGCAGAATCTCACATGG - Intergenic
1070645449 10:78199047-78199069 ATGAGCTGGGGCTTCTCACAGGG - Intergenic
1070707682 10:78653054-78653076 CAGAGATGCAGGTGCTCACCAGG + Intergenic
1071026962 10:81126416-81126438 CTGAGCTGGAGCTGCCAGCATGG + Intergenic
1071711155 10:88050847-88050869 CTGCCCTGCAGCTGGTCTCAAGG - Intergenic
1071773687 10:88760076-88760098 ATGAGCTTCACCTGCTCACAAGG - Intergenic
1072549222 10:96464502-96464524 CTGTACTGCTGCCGCTCACAAGG - Intronic
1072711101 10:97715894-97715916 CTGATCTGGAGCAGCTGACAGGG + Exonic
1073179589 10:101575589-101575611 CTGGGTTCCAGCTGCTCACAGGG - Intronic
1073179609 10:101575662-101575684 CTGGGTTCCAGCTGCTCACAAGG - Intronic
1073921554 10:108465863-108465885 CTGATCTTCAGCTTCACACATGG + Intergenic
1074530645 10:114296683-114296705 CTGAGCTGCAGCTGGCCTCCTGG + Intronic
1075555344 10:123426959-123426981 CTGAGCTGCTTCGGCTCACCTGG + Intergenic
1075903083 10:126058581-126058603 TGGAGCTGCATCTGCTCCCAAGG - Intronic
1076128082 10:127992010-127992032 AGGAGCTTCAGCTGCTCACCCGG - Intronic
1076580999 10:131510920-131510942 CTGAGTTTAAGCTGCTCACCTGG - Intergenic
1076686111 10:132199168-132199190 TGGAGCAGCAGCTGCTCACCAGG + Intronic
1076730013 10:132433766-132433788 CAGAGCTGCAGCTTCTCCCAGGG + Intergenic
1076756636 10:132576026-132576048 CTGACCTGCAGCTACCCACTGGG + Intronic
1076773201 10:132678559-132678581 CTGAGCTGCTGCTGCTCAGCCGG + Intronic
1076874418 10:133208608-133208630 GTGAGCTGCCCCTGGTCACATGG + Intronic
1078581591 11:12543273-12543295 CTGAGCTTCAGGAGCTCAGAAGG - Intergenic
1080052424 11:27870971-27870993 CTGAGCTGCAGCAGCTCTGGTGG - Intergenic
1080554395 11:33402727-33402749 CTCTGCTCCAGCTGCTCCCACGG - Intergenic
1083664042 11:64265155-64265177 CTGTCCTCCAGCTCCTCACAGGG + Intronic
1083823605 11:65186149-65186171 CTGACCTGGAGCTGCCCACAGGG + Exonic
1083967497 11:66051764-66051786 CTGAGCTCCAGCTGCCGACCTGG - Intronic
1084705614 11:70814557-70814579 CTGAGGTGCAGCTGCGTTCAGGG - Intronic
1084735588 11:71103273-71103295 CTGTGCTCCAGCAGCACACAGGG - Intronic
1084759652 11:71261551-71261573 CTGATCTGGGTCTGCTCACATGG + Intergenic
1085039168 11:73317014-73317036 CAGAGCTACAACTTCTCACATGG + Intronic
1085238572 11:75033487-75033509 CTAATCTGCAGGTGTTCACATGG - Intergenic
1085242837 11:75072874-75072896 CTGAGCTGCAGCAGCCAGCAGGG - Intergenic
1085878302 11:80435210-80435232 CTGAGATGTAGCTCCTAACATGG - Intergenic
1086949989 11:92882360-92882382 CTGAGATGCATCTGCTCCCGCGG + Intronic
1087750879 11:102005636-102005658 CTGGGCTGCAGCATCCCACAGGG + Intergenic
1088463712 11:110111018-110111040 CTAAGCTGCAGCTGCCAACCTGG - Intronic
1088652907 11:111974173-111974195 CAGAGCAGCAGCTGCTCCCTGGG - Exonic
1088765033 11:112966706-112966728 CTCAGCTGCAGATGCTCATTAGG + Intronic
1089750599 11:120648556-120648578 CTGAGCTCCAGCTTCTCTCTGGG + Intronic
1090006064 11:123003250-123003272 CTGAGCTGCAGGAGGTCACCTGG - Intergenic
1090646564 11:128771197-128771219 CTGAGCCGTCACTGCTCACAGGG + Intronic
1090853730 11:130593612-130593634 CTGAGCTTCATCTGCCAACAAGG + Intergenic
1091233236 11:134001831-134001853 CTGAGCTGCCTCTGCTCATTAGG + Intergenic
1091284163 11:134398819-134398841 CTGTGCTGCAGCTGCACACCCGG + Intronic
1091309260 11:134561124-134561146 CTGAGATGCAGCTGGCCCCAGGG - Intergenic
1092144829 12:6207359-6207381 CTGAGCTGCACTTGATCACTAGG - Intronic
1096762602 12:53854851-53854873 CTGAGCTCCAACTACCCACAGGG - Intergenic
1099932014 12:89085697-89085719 CTGAGCTCCAGCTATTCTCATGG - Intergenic
1100013174 12:89977685-89977707 CAGGGCTGCAGCTGCTTCCACGG + Intergenic
1101349118 12:103911927-103911949 CAGAGCTGCAGCTGTACCCATGG - Intergenic
1103019818 12:117525065-117525087 CCGATCTCCAGCTGCTCAAAGGG + Exonic
1104656246 12:130575768-130575790 CTGCCCTGGAGCCGCTCACATGG + Intronic
1104727439 12:131086646-131086668 CTGAGCTGCAGCCCCTCACAGGG + Intronic
1104913979 12:132254913-132254935 CTGAGCTGTGGCTGCTCCCTCGG - Intronic
1106456197 13:29929458-29929480 CTGAGATGCAGCCATTCACATGG - Intergenic
1112548353 13:100394138-100394160 TTGAGATGCAGCTTCTCAGATGG + Intronic
1113258734 13:108536167-108536189 CTGAGCTGAAGCAGATCACTAGG - Intergenic
1114532899 14:23406491-23406513 CTGAGCCGCAGCTGGTAACCAGG + Intronic
1114621001 14:24095927-24095949 CTGATCTGCTGCTGCCCACTTGG - Intronic
1115642382 14:35342783-35342805 CTGAGGTTAAGATGCTCACAGGG - Intergenic
1115707885 14:36016754-36016776 CTACACTTCAGCTGCTCACAGGG + Intergenic
1117166492 14:53039482-53039504 TTGAGCTGCTGGTGCTTACAGGG + Intronic
1117809571 14:59532536-59532558 CTGAGTTTCAGCTGAGCACATGG + Intronic
1121422346 14:93824584-93824606 CTGAGCTGACGCTGCTCCCAGGG + Intergenic
1122639097 14:103146819-103146841 TTGAGCAGCAGTGGCTCACAGGG + Intergenic
1122783123 14:104152115-104152137 CACACCTGCAGCAGCTCACACGG + Exonic
1122916832 14:104863333-104863355 CACAGCTGCAGCTGCTCTCCTGG + Intergenic
1123459888 15:20460063-20460085 CTCAACAGAAGCTGCTCACATGG + Intergenic
1123658174 15:22540357-22540379 CTCAACAGAAGCTGCTCACATGG - Intergenic
1123714697 15:23019196-23019218 GTGAGCTGCAGCAGAGCACAAGG - Intronic
1124312038 15:28634849-28634871 CTCAACAGAAGCTGCTCACATGG - Intergenic
1124653651 15:31490111-31490133 CTGAGCAGCCGCTGCTCACGAGG - Intronic
1126697569 15:51339251-51339273 CGGTGTTCCAGCTGCTCACAGGG + Intergenic
1129170094 15:73802321-73802343 CTGTGCTGGAGCTGAGCACACGG - Intergenic
1130765216 15:86863384-86863406 CACAGTTGCAGCTGCTCACACGG - Intronic
1130868662 15:87952956-87952978 CTGAGCTGTGGCTGCCCACGCGG - Intronic
1130985521 15:88842308-88842330 CAGAGCTGGGGCTGCCCACAGGG - Intronic
1131989523 15:98079875-98079897 CTGAGCTGCAGATGCCTGCAGGG + Intergenic
1132153208 15:99476796-99476818 CTGAGCTGCAGCTTACCCCACGG - Intergenic
1132618775 16:854779-854801 CTGAGCTGCAGCTGCTCACAGGG + Intronic
1133246368 16:4451420-4451442 CTGAGCTCCTGTTGCTCCCAGGG + Intronic
1133410820 16:5567251-5567273 CTGAGCTGCACGTGTCCACATGG - Intergenic
1133835302 16:9362391-9362413 CTGAGCCCCAGCTGTCCACAGGG + Intergenic
1136704293 16:32173258-32173280 CTCAACAGAAGCTGCTCACACGG + Intergenic
1136763617 16:32756148-32756170 CTCAACAGAAGCTGCTCACACGG - Intergenic
1136804482 16:33114238-33114260 CTCAACAGAAGCTGCTCACACGG + Intergenic
1138733597 16:59224772-59224794 ATGAGATGCAGCTGTTCATAAGG + Intergenic
1139085566 16:63581123-63581145 CCTAGCTGCAGCTACTCAGAAGG - Intergenic
1139625959 16:68188367-68188389 CCCAGCTGCAGCTGCTGACCCGG - Intronic
1141072622 16:80972023-80972045 CTCACCGGCAGCTGGTCACATGG - Exonic
1141503844 16:84462191-84462213 CTGGGCTGCAGCTCCCCACCTGG - Intronic
1141715085 16:85722397-85722419 CCCAGCTTCAGCTGCCCACAGGG - Intronic
1141893221 16:86941896-86941918 TTGAGCGGCACCTGCTTACATGG + Intergenic
1142074727 16:88110821-88110843 CTGAGCTGCACCTGCTGCCCTGG - Intronic
1142137228 16:88456967-88456989 CTGAGCTGCAGCAGCTGCCTGGG - Intronic
1142269095 16:89079844-89079866 CCGAGCTGCAACAGCTCCCAAGG - Intergenic
1203065766 16_KI270728v1_random:1016469-1016491 CTCAACAGAAGCTGCTCACACGG - Intergenic
1143239375 17:5430964-5430986 CTGAGCTGAAGCTGTACACTTGG - Intronic
1143296946 17:5878214-5878236 CTGGGTTCCAGCTGCTGACATGG + Intronic
1143561998 17:7701902-7701924 CTGGGCTGCACCTGCTCCCGGGG - Intronic
1144275081 17:13658823-13658845 TTCAGCTGCTGCTTCTCACAGGG + Intergenic
1144814074 17:18021104-18021126 CTGAGGTGCTGCTCCTCACCTGG + Exonic
1146399750 17:32493591-32493613 CTGAGCCCCAGCTGCTGAGAAGG - Exonic
1146660719 17:34663541-34663563 CTGAGCTGCAGCAGCCAGCAGGG + Intergenic
1151173838 17:72270678-72270700 CTGAGCAGCAGCTGGGCAAACGG - Intergenic
1151176946 17:72296399-72296421 CAGAGATGCAGGTGCTAACAGGG + Intergenic
1151439364 17:74118326-74118348 CTGAGCAGCAGCTTCACCCAGGG + Intergenic
1151807716 17:76416919-76416941 CAAAGCTGCGGCTGGTCACATGG + Intronic
1152040684 17:77900740-77900762 CTGAGCTTCAGCTGCACGCTAGG + Intergenic
1152230916 17:79113659-79113681 GTGAGCAGCAGCTGCTGAAAAGG - Intronic
1152311947 17:79556884-79556906 CTGAGCACCAGCTGGACACAGGG - Intergenic
1152717790 17:81908180-81908202 CTCAGCTGCAGATGCTCAGCGGG - Intronic
1152882018 17:82823104-82823126 CTCAGCTGGAGCTGCTCTCCTGG - Intronic
1153541312 18:6159021-6159043 CTGATCATCAGCAGCTCACAGGG - Intronic
1153856347 18:9151700-9151722 CTGAGCTGCAGCCGCTTTCAGGG - Intronic
1154030054 18:10745735-10745757 GTGAGTTGCAGCTGCTGAGAGGG - Intronic
1154199112 18:12287335-12287357 CTGAGCTGGCGCAGCTCACCTGG - Intergenic
1156043246 18:32847955-32847977 CAGAGCTGCCACTTCTCACAGGG + Intergenic
1156161270 18:34361058-34361080 CTGATCTGCAGCTGCTTACCTGG + Intergenic
1156492866 18:37506616-37506638 TTGAGCTGCAGTCGCCCACAAGG + Intronic
1157633900 18:49130106-49130128 CTGAGATCCAGGTGCACACAGGG + Intronic
1160694233 19:474794-474816 CAGAGCTGCTGCGGCTCAGAAGG - Exonic
1161104664 19:2437271-2437293 CTGACCTGCAGCCCCTCACCTGG - Intronic
1162004883 19:7771384-7771406 CTGAGCCCCAGTTGCCCACATGG + Intergenic
1162569889 19:11465719-11465741 CCCAGCTGCAGCTGCTGAGAAGG + Intronic
1162967357 19:14162191-14162213 CTGAGCTGCTGATGCTGACCGGG - Intronic
1163324081 19:16592098-16592120 CAGGGCTGCAGCTGGGCACATGG - Intronic
1163654578 19:18538343-18538365 CTGACCTGGAGATGCTCACGGGG - Exonic
1164281627 19:23774076-23774098 CTGTGTTGGTGCTGCTCACAGGG + Intronic
1164562798 19:29304449-29304471 CAGAGCTAGAGCTGCGCACAGGG + Intergenic
1164584182 19:29455728-29455750 CTGCACTGCAGCTGCACTCAGGG + Intergenic
1165258350 19:34593440-34593462 CTGAGCTGCAGGTGTTCATTGGG + Exonic
1165264201 19:34646782-34646804 CTGAGCTGCAGGTGTTTACTGGG - Intronic
925648175 2:6059730-6059752 CTGTGTTGCAGCTGCTTAAATGG - Intergenic
925659255 2:6184719-6184741 CACAGCTGCAGGTGCTCACCAGG - Intergenic
926291861 2:11538123-11538145 CAGAGCTGCAGATGCTCGCTCGG + Intronic
926744663 2:16141025-16141047 TAGAGCTGCAGCTGCTGAAAAGG - Intergenic
927084216 2:19658435-19658457 CTGTGCTGCTGCTTCTCAGAAGG - Intergenic
927964871 2:27262498-27262520 CCGAGCGGCAGCTGCTCCCAGGG + Intronic
928328297 2:30337384-30337406 CTGAGCTGCAGCTGCTTGCCTGG + Intergenic
928442659 2:31305014-31305036 CTAAGCTGCAGCTGCCACCAGGG + Intergenic
928911920 2:36430504-36430526 GTGAGCTGCAGCTGAGCAAAGGG - Intronic
929877473 2:45808675-45808697 CTGAGCTGAAGATGCTCTCAAGG + Intronic
931924000 2:67051352-67051374 CTGAGCTTCAGCAGGTCACCTGG + Intergenic
933719858 2:85390990-85391012 CTGAGCTGCAGGGGCTTTCAGGG + Exonic
934612618 2:95752377-95752399 CTGAGCTGCAGCTGCTCCTCCGG + Intergenic
934648297 2:96072046-96072068 CTGAGCTGCAGCTGCTCCTCCGG - Intergenic
936487600 2:112939671-112939693 CAGAGCCACAGCTGCTCACTGGG - Intergenic
938069800 2:128302461-128302483 AGGAGCTGCAGATGGTCACAGGG - Intronic
938095023 2:128455937-128455959 CAGAGCTGAAGCTGCTCTCCTGG - Intergenic
938135680 2:128754615-128754637 CTGAACTGTACCTGCACACAGGG + Intergenic
940018056 2:149127501-149127523 CTTAGCAGCACCTGCTCCCAGGG + Intronic
940638471 2:156325640-156325662 TTGAGCTGAGACTGCTCACACGG + Exonic
942040419 2:172056264-172056286 CTGAGCTTCTGCATCTCACAGGG + Intronic
945077751 2:206057211-206057233 CTCAGCTACTGCTTCTCACATGG + Intronic
946358374 2:219203593-219203615 CTGAGCTGCAGCCTCTCATTGGG - Intronic
946394920 2:219438698-219438720 GTGAGCTGATGATGCTCACATGG + Intronic
946669679 2:222089425-222089447 TTGAGCCTCAGCTGCTCACAGGG + Intergenic
947653630 2:231808157-231808179 CTGAACTGGAGCTGCCAACAAGG - Exonic
948183844 2:236003555-236003577 CTGCGCTGCTGCTGCCCGCATGG + Intronic
948348594 2:237320000-237320022 CTGAGCCCCAGTTGCTCTCAAGG + Intergenic
948888868 2:240897233-240897255 CTGGGCTGCAGCCCCTCATAGGG - Intergenic
949076696 2:242063864-242063886 CTGAGCTGCGGCCCCTCCCAAGG + Intergenic
1169260843 20:4136827-4136849 GCGGCCTGCAGCTGCTCACAGGG + Intronic
1169347569 20:4840673-4840695 TTGAGCTGCAGTTGCCTACAGGG - Intergenic
1171121256 20:22571192-22571214 CTGAGCTGCAGCAGGAAACAGGG + Intergenic
1171420591 20:25014808-25014830 CTGAGCTCCTGCTGCACACCAGG + Intronic
1173668365 20:44779140-44779162 TTGAGGGGCAGCTGGTCACATGG - Intronic
1174830247 20:53805674-53805696 CTGAGCAGCAGCTGCACCCTTGG - Intergenic
1175204454 20:57301139-57301161 CTGTGAGGCAGCTGCTCACGGGG + Intergenic
1175670803 20:60901214-60901236 CTGAGCCCCAGTTGTTCACAAGG + Intergenic
1175716905 20:61261050-61261072 GTGAGAAGCAGCTGCACACAGGG - Intronic
1176127950 20:63484292-63484314 GTGAGCTGTAGCTGCTCCCTGGG - Intergenic
1176218963 20:63961088-63961110 CTGAGCTGGAGCTGCCCTCGGGG - Intronic
1177207150 21:18023256-18023278 CCCAGCTGGAGCTGCTCTCAAGG + Intronic
1178583982 21:33857896-33857918 CTGGGCTGCGGCTGCTCCCTGGG - Intronic
1179110158 21:38439218-38439240 CTGAGCTGGGGATGCTCAGATGG + Intronic
1179403894 21:41109619-41109641 CTGATCTGCAGCTTCCCTCAGGG - Intergenic
1179473878 21:41631117-41631139 CTGGGCTGCAGCTGCTGTCGTGG + Intergenic
1179513747 21:41892331-41892353 CTGAGCTGCTGGTGCTAGCAGGG - Intronic
1179602300 21:42487986-42488008 CTGAGCAGCAGCTGAGGACAGGG + Intronic
1179625046 21:42644561-42644583 ATAATCTGCAGCTGCTCACACGG + Intergenic
1179642278 21:42755654-42755676 CTGGCCTGCAGCAGCTCCCAGGG + Intronic
1179930693 21:44569047-44569069 CTGCTCTCCAGCTGCTCACTGGG - Intronic
1180965916 22:19787895-19787917 CACAGCTGCGGCTGCACACAGGG - Exonic
1181404520 22:22673244-22673266 CTGAGCTTCAGCTCAGCACAGGG + Intergenic
1181406699 22:22690096-22690118 CTGACCTTCAGCTGCTCACAGGG - Intergenic
1181413112 22:22738807-22738829 CTGAGCTTCAGCTCAGCACAGGG + Intronic
1181414672 22:22750746-22750768 CTGACCTATAGCTGCTCAGAGGG - Intronic
1181423041 22:22815038-22815060 CTGACCTACAGCTGCTCAGAGGG - Intronic
1181565744 22:23736178-23736200 CTGGGCTGCAGCTGACCACTGGG + Intergenic
1182412239 22:30197031-30197053 CTGGGCTGCAGCTGCTTTTATGG - Intergenic
1184194050 22:42914714-42914736 CTTCCCTGCAGCTGCTCCCATGG - Intronic
1184233569 22:43171301-43171323 CTGAGCTCCAGGTGCTCAGATGG + Intronic
1184430019 22:44437267-44437289 CTGAGCAGCACCGGGTCACATGG + Intergenic
1185196073 22:49470267-49470289 CTGAGCTGCAGCCGCTCCTCTGG - Intronic
952736543 3:36697040-36697062 CTGAGCTGCATCTGCTGTAAAGG - Intergenic
952899462 3:38099922-38099944 CTCAGTTGAAGCTGCTCAGAGGG + Intronic
953853401 3:46483032-46483054 CTGAGTTCAAGCTGCTGACATGG + Intronic
955352726 3:58205946-58205968 ATGAGCTGCAGCTGCAGCCATGG - Intronic
958712243 3:97731387-97731409 CTGAGCTAGAGCTGCAGACATGG + Intronic
959226511 3:103595263-103595285 CATATCTGCAGCTGGTCACATGG + Intergenic
960988663 3:123296413-123296435 CTGAGCTGCAGGTGCAAGCAGGG - Intronic
961091560 3:124117191-124117213 CTGATCTGCATCAGCTCAGAGGG + Intronic
961623795 3:128245180-128245202 CTGAGCTGCAGCAGCCCATTAGG + Intronic
963311889 3:143718688-143718710 CAGTTCTGCAGCTGCTCACCTGG + Intronic
964791930 3:160460639-160460661 CTGACCTGCAGCTGCAGACCTGG - Intronic
967969355 3:194987751-194987773 CTGAACTGAAACTGCACACAAGG + Intergenic
968332270 3:197881137-197881159 CTTTGCAGCAGCTGCTCACGAGG + Intronic
968974985 4:3817387-3817409 ATTGGCTGCAGCTGGTCACATGG + Intergenic
969179130 4:5423954-5423976 CTCAGCTGCAGCTGCAGACCTGG + Intronic
972430743 4:38979251-38979273 CTTGGCTGCTGCTGCCCACAAGG - Intronic
975279691 4:72546735-72546757 GTGAGCTGCCACTACTCACAGGG + Intronic
976408689 4:84687975-84687997 CTGAGTTGCAGCTGCTCAGGAGG - Intronic
976815935 4:89148586-89148608 ATGGGCTGCAGCTGCTTGCAGGG + Intergenic
977117205 4:93045085-93045107 CTGGGATGCTGCTGCTCATAAGG + Intronic
978638830 4:110844145-110844167 CTGAGCACCTGCTGGTCACAAGG - Intergenic
979723947 4:123937832-123937854 ATGAGCTGCAGCTGCACGCTAGG + Intergenic
982029029 4:151280412-151280434 GTGAGCTGCAGCTGCAATCAAGG - Intronic
983572254 4:169222994-169223016 CCCAGCTGCAGCTCTTCACAAGG + Intronic
984064084 4:175026575-175026597 CTGAGCTTCAGTTAATCACAGGG - Intergenic
984309044 4:178033167-178033189 TTGATCTAAAGCTGCTCACATGG + Intergenic
985101046 4:186459001-186459023 GTGAGCAGCAGATGCTAACAAGG - Intronic
985696115 5:1341326-1341348 CTGGCCTGCAGCTTCTCACCAGG - Intronic
986332568 5:6728112-6728134 CAGAGCTGCAGCTGCTGCCTGGG + Intronic
986772860 5:10989242-10989264 CACAGCTGCAGGTGCCCACAGGG - Intronic
987002498 5:13674273-13674295 CTGACCTGCAGGTGCACTCAGGG - Intergenic
990661678 5:58022469-58022491 CTCTGCTGCATCTGCTCACATGG + Intergenic
993524856 5:88952614-88952636 CAGAGATGCAGCTGATGACAAGG - Intergenic
993905461 5:93618682-93618704 CTGAGCTGTAGCAGCCCAGAGGG - Exonic
996215312 5:120858819-120858841 CTGAGCTGCCGATGGCCACATGG - Intergenic
997371951 5:133367608-133367630 CCAAGCTGCAGCTGTTCAAATGG - Intronic
1000326508 5:160176361-160176383 CTAAGTTGCAGCTTCTCTCAAGG + Intergenic
1001317719 5:170656208-170656230 CTGAGAGGAAGCTGTTCACAGGG - Intronic
1001684578 5:173583909-173583931 GTGACCTGCAGCTGCTCTGATGG + Intergenic
1001702579 5:173718060-173718082 CTTCCCTCCAGCTGCTCACAAGG + Intergenic
1002161958 5:177319501-177319523 CTGAGCTACAGCTATTCCCAGGG - Intergenic
1002197416 5:177509008-177509030 CTCAGCTGCAGCTGCTGCCCAGG - Intronic
1003468304 6:6402767-6402789 TGGAGCTCCAGCTGCCCACATGG + Intergenic
1003483807 6:6557102-6557124 CTGGTCTGCAGCTTCCCACAAGG - Intergenic
1004134563 6:12954228-12954250 CTGAGCTGGAAATGCTCCCAGGG + Intronic
1004688480 6:17970927-17970949 CTGAGCTGCAGCTTTTCCCTTGG - Intronic
1005928742 6:30465335-30465357 CTGTCCTGCAGGTCCTCACAAGG + Intergenic
1007704838 6:43784314-43784336 CTGAGCAGCAGCTCCACTCAGGG - Intronic
1008957148 6:57228364-57228386 TTGAGATGCAGCTTCTCAGATGG + Intergenic
1013634024 6:112011397-112011419 CTTAGCTGCATTTTCTCACAAGG + Intergenic
1013806493 6:114001916-114001938 CTGACCTGCAGATGCTCCAAAGG + Intronic
1014521735 6:122452035-122452057 CAGAGCTGTAGCTGATAACAAGG + Exonic
1016348033 6:143137178-143137200 CTGAGATGCAGTTGTCCACAGGG + Intronic
1017223514 6:151993548-151993570 CAGAGCTGGAGCTGGTCCCAGGG - Intronic
1018042321 6:159935824-159935846 CTGAGCTTCAGCATCTCACTAGG + Intergenic
1018640062 6:165897467-165897489 CTGAGCTGCAGGTGCCCCCAGGG + Intronic
1019017208 6:168888517-168888539 CTGCTCTCCAGCTGCTCAGAGGG + Intergenic
1019081066 6:169430059-169430081 CTGAGCTGCAGAAGGGCACAGGG + Intergenic
1019179527 6:170177706-170177728 CAGAGCTGCAGCTGCCCCCAAGG + Intergenic
1019617625 7:1973389-1973411 CGGACGTGCACCTGCTCACAAGG + Intronic
1020271013 7:6595896-6595918 CTTGGCTGTTGCTGCTCACAGGG + Intronic
1020955917 7:14740024-14740046 CTGAGCCGCAGCTGCTGCCCAGG + Intronic
1021936130 7:25633356-25633378 CTTAGCTGTACCTGTTCACATGG + Intergenic
1022046991 7:26629612-26629634 ATGAGTAGCAGATGCTCACATGG + Intergenic
1022259247 7:28688385-28688407 TTGTGCTTCAGTTGCTCACATGG + Intronic
1024058851 7:45683456-45683478 AAGTGCTGCAGCTGCCCACAAGG + Intronic
1025940390 7:66072705-66072727 CTGGGCTGCAGCTGACCACTGGG - Intergenic
1027333841 7:77127229-77127251 CTGACCAGCAGCTGCTGACCTGG - Intronic
1028228015 7:88272313-88272335 CTGAGCTCCAGTTGCCCAGATGG + Intergenic
1029421524 7:100474336-100474358 CTGAGCTGCTACTGCTCCGAAGG + Exonic
1029665648 7:101993426-101993448 GAGAGCTGCAGCTGCTCTGATGG + Intronic
1030111097 7:106027558-106027580 CAGACCTGGAGCTGCTCAGATGG - Intronic
1031126783 7:117782873-117782895 CTGAGCAGCTGCAGCACACAAGG + Exonic
1031198295 7:118644576-118644598 GTGAGCTGCAGATGAGCACATGG + Intergenic
1033048957 7:137986975-137986997 CTGTGCTGCAGCTGTTCGCCTGG + Intronic
1035240175 7:157524120-157524142 CTGAGCCAGAGCTGCTCCCATGG - Intergenic
1035368867 7:158365987-158366009 TTGGGCTGCAGCTTCTCCCAGGG - Intronic
1035368885 7:158366162-158366184 TTGGGCTGCAGCTTCTCCCAGGG - Intronic
1035368899 7:158366281-158366303 TTGGGCTGCAGCTTCTCCCAGGG - Intronic
1035368930 7:158366470-158366492 ATGTGCTGCAGCTTCTCCCAGGG - Intronic
1035412396 7:158655642-158655664 GTGAGCTGAGGCTGCTCACCTGG - Intronic
1036585055 8:10116042-10116064 CTGAGTTGGAGCTGCTGAAATGG + Intronic
1036667926 8:10759817-10759839 CTGAGATGCAGTTACTCACCGGG + Intronic
1036800818 8:11789566-11789588 ATGAGCTACAGAGGCTCACAGGG + Intergenic
1038040095 8:23717024-23717046 CTGTGCTGCAGCAGCTCCCCAGG - Intergenic
1038397354 8:27257125-27257147 CTGATCTGCAGCTCCACAGAAGG - Intronic
1038821590 8:30957117-30957139 CTGAGGTCCAGTTCCTCACATGG - Intergenic
1039194838 8:35019608-35019630 CTAAGCTGCAGATGCTAACAAGG + Intergenic
1039605196 8:38874775-38874797 CCGAGCAGCAGCTGCTGAAAAGG + Intergenic
1041828386 8:62124396-62124418 CTCAGCTGCAGCTGCTGTAAAGG + Intergenic
1041897974 8:62948036-62948058 CTAAGCGGCAGTTGCTCATATGG - Intronic
1042115385 8:65426081-65426103 CTGAGATGAAGGTGCTGACAGGG - Intergenic
1043207106 8:77458850-77458872 CTGTGCTGCAGCTCCACAGAAGG - Intergenic
1044441161 8:92225830-92225852 ATGAGCTGCAGCAGGTCACTTGG + Intergenic
1048162179 8:132031691-132031713 CTGAGCCTCAGCTGCTCACCAGG + Intronic
1049026497 8:139994261-139994283 TTGAGCCCCAGCTGCCCACAGGG - Intronic
1049293925 8:141819668-141819690 CTGAGATGCAAATGTTCACAGGG - Intergenic
1051626607 9:19104684-19104706 CTGTGGTCCAGCTGCTCAGAAGG + Intergenic
1055267301 9:74510417-74510439 CTGTTCTGCAGCTGCTCTTAAGG + Intronic
1058778354 9:108308520-108308542 CTGAGCTGCAGTGTCTCACTTGG + Intergenic
1058993114 9:110273637-110273659 CACAGCTGGAGCTGCTGACATGG - Intergenic
1060217251 9:121745814-121745836 CTGAGCTCAAGCTGCCAACAAGG + Intronic
1061429794 9:130523805-130523827 CTGAGGGGAAGCTGCTCACCAGG + Intergenic
1061878817 9:133558204-133558226 CTGAGATGCCGCTGCTCCCCCGG + Intronic
1062047569 9:134431569-134431591 GTGAGCCGCAGCTGCACAGAGGG - Intronic
1062479635 9:136745340-136745362 CTGAGCTGATGCTGGCCACAGGG + Intronic
1062718085 9:138021203-138021225 CTGTGCTGCCCCTGCTCCCAGGG - Intronic
1185861633 X:3584810-3584832 CTGAGCACCAGCTCCTGACATGG + Intergenic
1187874548 X:23793332-23793354 CTGAGCTTCAGCGGTTCCCAGGG + Intergenic
1189229591 X:39441922-39441944 TTGAGCCCCAGCTGCCCACAGGG - Intergenic
1189892250 X:45615734-45615756 GCGAGTTGCAGCTGCTCACTAGG - Intergenic
1190445568 X:50520470-50520492 TTAAGCTGCAGCAGCACACAGGG - Intergenic
1192727159 X:73765546-73765568 CACAGCTGCAGCTTCTCCCATGG - Intergenic
1195802199 X:108725410-108725432 GTGAGCTCCAGTTGATCACAGGG - Intronic
1198781858 X:140246584-140246606 CTGAGCTGCTCCAGCTCAAAGGG - Intergenic
1198836824 X:140814912-140814934 CACAGCTGCAGCTTCTCCCATGG - Intergenic
1200046938 X:153408247-153408269 CTGAGTGGCAGCTTCTCTCATGG - Intergenic
1200277885 X:154751247-154751269 CGGAGCTGCAGTTGCTCGAAGGG - Intronic
1202163546 Y:21961546-21961568 CTGAGCTGCAGTTGTGCATATGG - Intergenic
1202227810 Y:22624823-22624845 CTGAGCTGCAGTTGTGCATATGG + Intergenic
1202315347 Y:23571353-23571375 CTGAGCTGCAGTTGTGCATATGG - Intergenic
1202555454 Y:26099242-26099264 CTGAGCTGCAGTTGTGCATATGG + Intergenic