ID: 1132620593

View in Genome Browser
Species Human (GRCh38)
Location 16:866375-866397
Sequence CCCCCGCCATAGTGTCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 54}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132620593_1132620599 0 Left 1132620593 16:866375-866397 CCTCCATGACACTATGGCGGGGG 0: 1
1: 0
2: 2
3: 4
4: 54
Right 1132620599 16:866398-866420 TGGCCTAGTCATTGCTGGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 108
1132620593_1132620602 6 Left 1132620593 16:866375-866397 CCTCCATGACACTATGGCGGGGG 0: 1
1: 0
2: 2
3: 4
4: 54
Right 1132620602 16:866404-866426 AGTCATTGCTGGCTGGGTGGTGG 0: 1
1: 0
2: 2
3: 28
4: 370
1132620593_1132620597 -5 Left 1132620593 16:866375-866397 CCTCCATGACACTATGGCGGGGG 0: 1
1: 0
2: 2
3: 4
4: 54
Right 1132620597 16:866393-866415 GGGGGTGGCCTAGTCATTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 175
1132620593_1132620601 3 Left 1132620593 16:866375-866397 CCTCCATGACACTATGGCGGGGG 0: 1
1: 0
2: 2
3: 4
4: 54
Right 1132620601 16:866401-866423 CCTAGTCATTGCTGGCTGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 106
1132620593_1132620604 26 Left 1132620593 16:866375-866397 CCTCCATGACACTATGGCGGGGG 0: 1
1: 0
2: 2
3: 4
4: 54
Right 1132620604 16:866424-866446 TGGTGAAGGTCCTGACTTTCTGG 0: 1
1: 0
2: 0
3: 9
4: 127
1132620593_1132620598 -1 Left 1132620593 16:866375-866397 CCTCCATGACACTATGGCGGGGG 0: 1
1: 0
2: 2
3: 4
4: 54
Right 1132620598 16:866397-866419 GTGGCCTAGTCATTGCTGGCTGG 0: 1
1: 0
2: 1
3: 8
4: 93
1132620593_1132620603 12 Left 1132620593 16:866375-866397 CCTCCATGACACTATGGCGGGGG 0: 1
1: 0
2: 2
3: 4
4: 54
Right 1132620603 16:866410-866432 TGCTGGCTGGGTGGTGGTGAAGG 0: 1
1: 0
2: 6
3: 76
4: 750

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132620593 Original CRISPR CCCCCGCCATAGTGTCATGG AGG (reversed) Intronic